ID: 1094058534

View in Genome Browser
Species Human (GRCh38)
Location 12:26289724-26289746
Sequence AGGTTTCATTCTAAACCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094058528_1094058534 30 Left 1094058528 12:26289671-26289693 CCAGAGATTAAATGTTATAGAGC 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1094058534 12:26289724-26289746 AGGTTTCATTCTAAACCATGGGG 0: 1
1: 0
2: 0
3: 18
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094058534 Original CRISPR AGGTTTCATTCTAAACCATG GGG Intronic
906288769 1:44605736-44605758 AGGTTGCATCCTAAAGGATGAGG + Intronic
907262400 1:53229571-53229593 AGTTTTCATTGTCAACAATGTGG + Intronic
907360313 1:53908711-53908733 GGGTCTCATTCTAGACCAAGGGG + Intronic
907752812 1:57279777-57279799 ATGTTTCCTTCTCAATCATGTGG + Intronic
908068397 1:60432757-60432779 AGTTTTCATTCTGAGGCATGAGG + Intergenic
908642664 1:66242702-66242724 AGGTTTCATGGTACACCTTGTGG + Intronic
910373613 1:86545262-86545284 CAGTTTCATTCTTCACCATGTGG - Intergenic
911879042 1:103209480-103209502 AGTTTCCATTCTAAATCAAGTGG + Intergenic
912987729 1:114451501-114451523 AGGTTTCTAGATAAACCATGGGG - Intronic
913286700 1:117233171-117233193 AGGTTTCATTCTCTTCCTTGAGG + Intergenic
916941286 1:169681182-169681204 AGGTTTAATTAGAAACCAGGAGG - Intronic
916997865 1:170320778-170320800 AGATTTCATGTTCAACCATGAGG + Intergenic
917241557 1:172954377-172954399 ATGTTTCAATCCCAACCATGAGG - Intergenic
918335141 1:183502713-183502735 AACTTTCATTCTAAAGGATGAGG - Intronic
919614644 1:199790855-199790877 AGGTTTCATTATAAAACATAAGG + Intergenic
920059955 1:203220422-203220444 AGGTGTCATTCTAGACACTGAGG - Intronic
920243270 1:204569334-204569356 GGGTTTCATTCTAAACAAGTGGG - Intergenic
921279056 1:213547646-213547668 AGATTTCACTCTCAACCAAGAGG - Intergenic
921937962 1:220812107-220812129 AGGTACAATTCTAAAGCATGGGG + Intronic
923771377 1:236940511-236940533 AAGTTGCATTCTAATCCCTGTGG - Intergenic
924270753 1:242330072-242330094 AGGTTTCAATCTAATTCAAGAGG - Intronic
1063859222 10:10290128-10290150 AGGTTTCCTCCTAGACCATGAGG + Intergenic
1064376724 10:14803086-14803108 AAGATTCATTCAAAACAATGTGG - Intergenic
1064614713 10:17141075-17141097 ATGTCTCATCCAAAACCATGAGG - Intergenic
1065292044 10:24240416-24240438 AGGTCTCATTCTCACACATGAGG - Intronic
1065321320 10:24512761-24512783 AGTTCCCATTCTACACCATGCGG + Intronic
1066532725 10:36358071-36358093 ACTCTTCTTTCTAAACCATGTGG + Intergenic
1069021347 10:63491922-63491944 AGAATTCATTCTAAACTAAGAGG + Intergenic
1069787263 10:70996862-70996884 AGGTCACATCCTAAAGCATGGGG - Intergenic
1071237099 10:83661768-83661790 AGGCTTCAGGCTAAGCCATGTGG - Intergenic
1072068291 10:91891681-91891703 AGATTTCATTCTTAGGCATGTGG + Intergenic
1073150794 10:101310291-101310313 AGGTTTCATCCTTTCCCATGCGG - Intergenic
1074224086 10:111466659-111466681 GGCTTTGTTTCTAAACCATGTGG - Intergenic
1074978386 10:118599393-118599415 AGCTTTCTTAATAAACCATGGGG - Intergenic
1077849696 11:6063505-6063527 AGGAGTCATTCTAACTCATGAGG + Intergenic
1077962086 11:7086454-7086476 AGGTTTTATTCTATACTGTGTGG + Intergenic
1078071041 11:8110693-8110715 TGTTTTCACTCTAAACCCTGGGG + Exonic
1078825608 11:14927366-14927388 ATGTCTCATTCTCTACCATGTGG + Intronic
1080430322 11:32192096-32192118 AGGTTTCATTCTGAGGCATCAGG - Intergenic
1081530337 11:43954229-43954251 AGGTATCACTCCAAACAATGAGG - Intergenic
1083146320 11:60762176-60762198 GGGTTACATTATATACCATGTGG - Intronic
1085735779 11:79037751-79037773 AGTTTTCATTCAAATCCATCAGG + Intronic
1086075776 11:82850341-82850363 ATATTTCATCCTAAACCAGGCGG + Exonic
1087392411 11:97554399-97554421 AGCTTTGATTCTAAAACATCTGG + Intergenic
1093872654 12:24310579-24310601 AGGTTTCATCCAAAAGAATGTGG - Intergenic
1094058534 12:26289724-26289746 AGGTTTCATTCTAAACCATGGGG + Intronic
1101975841 12:109357940-109357962 AAGTGTCATTCTAAAACAGGCGG + Intronic
1102476049 12:113189235-113189257 AGGGTTCATTCTGAACCACAGGG + Intronic
1104416086 12:128597625-128597647 AGGTAGTATTCTAAACCTTGGGG + Intronic
1106179725 13:27360347-27360369 AGGTATCATTCTAGAACATGAGG - Intergenic
1106878134 13:34098448-34098470 AGGCTCAATTTTAAACCATGTGG + Intergenic
1110076056 13:71244710-71244732 AGGTTTCAGTCAAATCCAAGTGG + Intergenic
1111941198 13:94609480-94609502 ATGTTTCATTTTAAATTATGTGG - Intronic
1112044901 13:95586999-95587021 AGGTCACATTCTAAGCAATGGGG - Intronic
1112855176 13:103759876-103759898 ATGTTTCATTCTTAAACCTGTGG + Intergenic
1113547592 13:111166232-111166254 GGGTTTCATTCTAAGACATTAGG - Intronic
1116672214 14:47857938-47857960 ATGTTTCACTCTAAACGTTGAGG - Intergenic
1118732996 14:68682481-68682503 AGGTTATGTTCTAAACCAGGAGG - Intronic
1121383533 14:93495439-93495461 AGGTTTCTTCCTAAAACCTGGGG + Intronic
1126926428 15:53592638-53592660 AAATTTCATGCTAAACCATGTGG - Intronic
1126962870 15:54017785-54017807 TGGTTTTATTCTTAACCAGGTGG - Intronic
1127060726 15:55180609-55180631 AGATCTCATTCTAAACTATATGG - Intergenic
1129646372 15:77437552-77437574 AAGTTTCAATCTAAAAAATGTGG - Intronic
1131945600 15:97616952-97616974 ATGTTTCTTTCTATACCTTGTGG - Intergenic
1132236434 15:100225387-100225409 GGGTTTCTTTCTGAACCATCGGG - Intronic
1135313817 16:21426482-21426504 GGGTTTTTTTCTAAAACATGCGG - Intronic
1135366741 16:21858762-21858784 GGGTTTTTTTCTAAAACATGCGG - Intronic
1135445074 16:22512396-22512418 GGGTTTTTTTCTAAAACATGCGG + Intronic
1137322553 16:47400146-47400168 AGCCTGCATTCTTAACCATGAGG + Intronic
1139070331 16:63372827-63372849 AGTTTTGATTGTAAATCATGAGG - Intergenic
1140777596 16:78264294-78264316 AGGTTTTATTCTTATACATGCGG + Intronic
1144970704 17:19107648-19107670 AAGTTTCCTTCTAGCCCATGGGG - Intergenic
1144991006 17:19233810-19233832 AAGTTTCCTTCTAGCCCATGGGG - Intronic
1147241180 17:39091441-39091463 GGATCTCATTCTAAACCATCCGG - Intronic
1149422428 17:56523525-56523547 AGATTACATTGTAAACCATACGG - Intergenic
1149894228 17:60416681-60416703 TGGTTTTATTATCAACCATGGGG - Intronic
1152660715 17:81540735-81540757 CGGTTTCCCTCTAACCCATGAGG + Exonic
1156278439 18:35607675-35607697 AAGTTTCATTTGAGACCATGAGG - Intronic
1156588977 18:38464546-38464568 AGGTTGCATTTTAAAAGATGTGG + Intergenic
1159158426 18:64612864-64612886 AGGTTACATTCTAGAGCATATGG + Intergenic
1159285950 18:66352019-66352041 AGATTTCATACTAAATCCTGTGG + Intergenic
1161747214 19:6068367-6068389 AGTTTCTATTCTAGACCATGCGG + Intronic
1167693967 19:51003224-51003246 AGGTTCCATTGCAAACCAGGGGG + Exonic
927432782 2:23041079-23041101 AGGATCCATTCTGATCCATGGGG + Intergenic
932617513 2:73243425-73243447 AGGTCTCAATATACACCATGAGG - Intronic
942280096 2:174353268-174353290 ATATTTCATTTTAAACCAAGAGG + Intronic
942476284 2:176326050-176326072 AGGTTTCATTCTTTAGCATTTGG + Intronic
943037395 2:182764285-182764307 GGGTTACATTATATACCATGTGG + Intronic
943367801 2:186982182-186982204 ACCTTTCATTCTAAGTCATGTGG + Intergenic
943985103 2:194608287-194608309 AGGTTTCATTAAAAAACTTGGGG + Intergenic
944108433 2:196104548-196104570 TTGTTTGATTCTCAACCATGTGG + Intergenic
946379569 2:219336530-219336552 ATTTTTCATTATAAACCATGTGG + Intergenic
949073659 2:242041422-242041444 AGGCTTTATTCAAGACCATGCGG - Intergenic
1172086194 20:32384893-32384915 AAGTTTGATTTTAAAGCATGAGG + Intronic
1173161318 20:40654596-40654618 AGGTTTAATCCTAAACCTTAAGG + Intergenic
1173495754 20:43516037-43516059 GGGCTTCATCCCAAACCATGAGG + Intronic
1174982716 20:55415268-55415290 AGGTTTCATTCTGACACATGTGG - Intergenic
1175065507 20:56283098-56283120 AGGTTTCATTCTTCTGCATGTGG - Intergenic
1177509548 21:22067116-22067138 AATTGTCATTCTAAACCCTGGGG + Intergenic
1178269089 21:31173122-31173144 TGGTTTCATTCAAGTCCATGTGG + Intronic
1183987385 22:41577025-41577047 AGGTTTCTTTCTGCACCAGGAGG - Exonic
1184248187 22:43246139-43246161 AGGTTTCATATTAAAGCAGGTGG + Intronic
1184441271 22:44517833-44517855 AGGTTTCAGTCTAAATGCTGTGG - Intergenic
951848485 3:27111300-27111322 AGGTATCATTCCTATCCATGGGG - Intronic
952518512 3:34130331-34130353 TGGTTTCAGTCTTAACCAAGAGG + Intergenic
954895345 3:53970489-53970511 AGGTTTCATTATGGGCCATGTGG + Intergenic
955362266 3:58285741-58285763 AGTTTTCATTATAAACCTTTTGG - Intronic
955497503 3:59550230-59550252 AGTGTTCATTCTATACCAAGAGG + Intergenic
956209152 3:66785561-66785583 AGTTTTTATTCCAAGCCATGAGG + Intergenic
957837929 3:85623414-85623436 AGGTGTCATTTTGAACCATAAGG + Intronic
957858577 3:85912720-85912742 GAGTTTCATTCTTAACAATGAGG + Intronic
958868415 3:99528190-99528212 AGGCTACATCCAAAACCATGGGG + Intergenic
959144918 3:102532977-102532999 AGGTTTCACTCCAAAACTTGTGG + Intergenic
959973890 3:112436994-112437016 AGGTACCACTCAAAACCATGGGG + Intergenic
960821021 3:121731642-121731664 AGCTTTCTTGATAAACCATGTGG + Intronic
962261894 3:133915739-133915761 AGGTTTCAATCTGAAAGATGAGG + Intergenic
962672378 3:137722224-137722246 AGTTTTCATTTTCTACCATGTGG + Intergenic
963655805 3:148048820-148048842 ATTTTTCATTAGAAACCATGGGG - Intergenic
963776922 3:149449185-149449207 AGGTCTCAGTCTAAAGCAAGTGG - Intergenic
964215486 3:154275737-154275759 AAGTTTCATTTTAAAAAATGTGG + Exonic
965137804 3:164795410-164795432 ACATTTGATTCTAAACCTTGAGG + Intergenic
965925652 3:173976312-173976334 AGATTCCATTCTATACCCTGGGG + Intronic
966514281 3:180800504-180800526 CGGTTTCATTCTTATACATGTGG - Intronic
966586364 3:181630155-181630177 AGGTTTGAATCTAAACCTAGTGG + Intergenic
967027140 3:185574763-185574785 GGGTTACATTATATACCATGTGG - Intergenic
967683575 3:192394089-192394111 AGCTTTCACTCAAAATCATGTGG + Intronic
971495220 4:27257153-27257175 AGGTATCATTCTAAGCCTTGAGG - Intergenic
971500595 4:27314163-27314185 AGGTTTTAATTTAAAGCATGGGG - Intergenic
975631092 4:76403039-76403061 ATGTTTTATTTTTAACCATGTGG - Intronic
975692399 4:76978852-76978874 AGGGTTCATACTGAAGCATGTGG + Intronic
976027522 4:80707988-80708010 ACTTTCCATTCTCAACCATGAGG + Intronic
977140716 4:93368357-93368379 AAGTTACATTCTTAACTATGGGG + Intronic
978069526 4:104450147-104450169 AGCTTATACTCTAAACCATGAGG + Intergenic
978293228 4:107171498-107171520 AGGATTCATTCTATAAAATGTGG + Intronic
984365659 4:178796318-178796340 AGGTTTATTTTTAAAACATGGGG - Intergenic
987339834 5:16929997-16930019 AGGATTGAATCTCAACCATGAGG + Intronic
989410533 5:41115170-41115192 AAATTTCAATCAAAACCATGTGG + Intergenic
992951133 5:81858959-81858981 AGGTTTCCAACTAAAGCATGTGG + Intergenic
993988327 5:94624431-94624453 AGTTTTCATCTTAAACCATATGG - Intronic
994559417 5:101347882-101347904 AGCTTTCATTCTAAACTCTGTGG - Intergenic
994804274 5:104423307-104423329 AGGTTTCATTCTACCAAATGGGG + Intergenic
996247087 5:121277994-121278016 AGGTTTCATTTTAAATCTTTAGG + Intergenic
997031960 5:130140644-130140666 AGATTCCATTCTAAACAATGAGG - Intronic
997608276 5:135192104-135192126 AGCTATATTTCTAAACCATGGGG + Intronic
1003585333 6:7383461-7383483 AGGTGTCATTATAAACCAGTGGG - Intronic
1003615621 6:7652779-7652801 TGGTATCATTACAAACCATGGGG - Intergenic
1004099882 6:12598357-12598379 GGCTTTTATTCTAAACCAGGTGG - Intergenic
1004308901 6:14526373-14526395 AGGTTTTGGCCTAAACCATGGGG - Intergenic
1004537194 6:16514571-16514593 AGATTTGATCCTAAACCTTGGGG + Intronic
1007465199 6:42046877-42046899 AGGCTTTATTCTTAACCATTAGG - Intronic
1009755610 6:67936159-67936181 ATAGTTCATTGTAAACCATGGGG - Intergenic
1011331835 6:86216777-86216799 GGGTTTCATGTTCAACCATGGGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015264342 6:131275714-131275736 AGGGCTCATCCTGAACCATGTGG + Intronic
1018472908 6:164112281-164112303 AGCTGTCATCCTGAACCATGTGG - Intergenic
1018838518 6:167502657-167502679 AGGCTTCATTCGAGTCCATGTGG + Intergenic
1018952240 6:168386705-168386727 AGGTTTGATTGAAAACCAGGTGG + Intergenic
1022102823 7:27179263-27179285 AGTTTCCATTCTAAACAATGGGG - Intronic
1022345750 7:29512722-29512744 ACGTTTTATTCTAATCCATCAGG + Exonic
1022418411 7:30197925-30197947 GGGTTACATTCTAAAACATTAGG - Intergenic
1022422468 7:30236920-30236942 AGGTGCCATTTTGAACCATGAGG - Intergenic
1023239995 7:38133802-38133824 AGGTATCAGTGGAAACCATGTGG + Intergenic
1027650180 7:80856912-80856934 AATTTTCATTCCAAATCATGGGG - Intronic
1028017324 7:85732208-85732230 ATGTTTCATTGTAAAACATAGGG - Intergenic
1028525775 7:91784664-91784686 AGGTTTAATTTTCAACCATAAGG - Intronic
1028528291 7:91809680-91809702 ATGTTGCATTCTAAAGCAGGAGG - Intronic
1028766206 7:94562842-94562864 TGGTTTCATTTTAGACCAGGTGG + Intergenic
1030151734 7:106413148-106413170 AGGTATCATTTTGGACCATGAGG - Intergenic
1037178402 8:15974063-15974085 AGGTTTCAGCCAAACCCATGGGG + Intergenic
1038143190 8:24868421-24868443 AGTTTTGTTTCTAATCCATGAGG + Intergenic
1038640300 8:29319155-29319177 GGGTTACATTATATACCATGTGG - Intergenic
1039915762 8:41859148-41859170 AGGTTTCCTGCTGCACCATGGGG - Intronic
1040138775 8:43885745-43885767 AGGACTCATGCTAACCCATGGGG - Intergenic
1041219724 8:55637182-55637204 AGGTATCAATCTATACCACGTGG + Intergenic
1042188482 8:66161223-66161245 AAGTTTCATTCTACTACATGTGG + Intronic
1042358399 8:67854778-67854800 AGGTTTCATCGTACACCATGGGG - Intergenic
1042941145 8:74109367-74109389 AGGTTTTATAACAAACCATGTGG - Intergenic
1043259827 8:78182864-78182886 AGTTTTCAATCTTATCCATGAGG + Intergenic
1051172363 9:14331516-14331538 AGGATTCATTCAATACCCTGTGG + Intronic
1052282792 9:26752513-26752535 AGGTTCTCTTCTAAACAATGAGG + Intergenic
1054722233 9:68615702-68615724 ACTTTTCACTCTAAACAATGTGG - Intergenic
1056676852 9:88683161-88683183 AGTTTTCATTCAAAACCTTTTGG + Intergenic
1061443417 9:130622792-130622814 AGGATTCAGTTTAAACCAGGTGG + Exonic
1062357830 9:136173382-136173404 AGGTTTTACTCTAATCCAGGAGG - Intergenic
1188211849 X:27435085-27435107 AGGTAGCATTCTAAACCATCTGG + Intergenic
1189388777 X:40558529-40558551 AGGATTCATTCTAAAGGAAGAGG - Intergenic
1192508035 X:71702221-71702243 GGGTTACATTATACACCATGTGG - Intergenic
1192518661 X:71779332-71779354 GGGTTACATTATACACCATGTGG + Intergenic
1196131086 X:112157249-112157271 AGGTTTCACTTTAAAAAATGGGG - Intergenic
1197820264 X:130534702-130534724 AGGCTGCATTCTAAAACATTGGG + Intergenic
1201860650 Y:18593922-18593944 AGGTTTCATTGTAAGCCACGTGG - Intergenic
1201872673 Y:18726458-18726480 AGGTTTCATTGTAAGCCACGTGG + Intergenic
1202165417 Y:21982113-21982135 AGGTTTCATAGTAAGCCATGTGG + Intergenic
1202225940 Y:22604259-22604281 AGGTTTCATAGTAAGCCATGTGG - Intergenic
1202317173 Y:23591402-23591424 AGGTTTCATAGTAAGCCATGTGG + Intergenic
1202553592 Y:26078656-26078678 AGGTTTCATAGTAAGCCATGTGG - Intergenic