ID: 1094061938

View in Genome Browser
Species Human (GRCh38)
Location 12:26323570-26323592
Sequence TCTGCAGGTGAGACACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094061938_1094061943 30 Left 1094061938 12:26323570-26323592 CCAGAATGTGTCTCACCTGCAGA No data
Right 1094061943 12:26323623-26323645 GGAAATAAAACTCATTCTTCAGG No data
1094061938_1094061941 8 Left 1094061938 12:26323570-26323592 CCAGAATGTGTCTCACCTGCAGA No data
Right 1094061941 12:26323601-26323623 GAGGTCAATTTTGAAGCACATGG No data
1094061938_1094061942 9 Left 1094061938 12:26323570-26323592 CCAGAATGTGTCTCACCTGCAGA No data
Right 1094061942 12:26323602-26323624 AGGTCAATTTTGAAGCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094061938 Original CRISPR TCTGCAGGTGAGACACATTC TGG (reversed) Intergenic
No off target data available for this crispr