ID: 1094065407

View in Genome Browser
Species Human (GRCh38)
Location 12:26356523-26356545
Sequence GGCACAAGGTGTTGGTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094065407 Original CRISPR GGCACAAGGTGTTGGTGAAC AGG Intronic
902833718 1:19033954-19033976 TGCACAAGGGGTGGGTGAGCGGG - Intergenic
904413112 1:30336903-30336925 GGAACAAGGTGAGGGTGAGCTGG + Intergenic
906645490 1:47471499-47471521 GGCACAAGGTGTGGGCAAACTGG + Intergenic
907425348 1:54375899-54375921 GCCACAAGGTGGTGCTGACCAGG + Intronic
907651038 1:56295053-56295075 GGAACAAGGTGTAGGTCAACAGG - Intergenic
908407571 1:63830260-63830282 GGCATAAGGTGGTGGAGAAGAGG + Intronic
912890720 1:113526736-113526758 GGCTAAAGATGTTGGTGACCCGG + Intronic
913493963 1:119410317-119410339 GGCACAAATTATTGATGAACAGG + Intergenic
913558761 1:119997055-119997077 GACACAAGGTGAGGGTGCACAGG + Exonic
915069267 1:153252602-153252624 CTCACAAGGTGTTGGTGGCCAGG + Intergenic
917514894 1:175699055-175699077 GGCACAAGGTGATGGAGACAGGG + Intronic
921675041 1:217967607-217967629 GTCACAAGGATTTGGTGTACAGG - Intergenic
922352020 1:224742159-224742181 TGAAGATGGTGTTGGTGAACTGG + Intergenic
923372359 1:233327379-233327401 GGCCCAAGGTGGTGGGGGACGGG + Intergenic
924333847 1:242967206-242967228 AGAACAAGGAGTTGGTCAACAGG + Intergenic
924334306 1:242971839-242971861 GGAACTATGTGTAGGTGAACAGG - Intergenic
924856955 1:247883450-247883472 GGCCCACAGTATTGGTGAACAGG - Intergenic
1066699692 10:38113818-38113840 AGCAGAAGTTGATGGTGAACTGG - Intronic
1066761575 10:38759213-38759235 GGCACAAGGAATCTGTGAACTGG - Intergenic
1069883989 10:71611873-71611895 TGCGCAAGGTGTTGGAGAATCGG - Intronic
1070604388 10:77888667-77888689 GGCACACGGTGTTGGTGCGCAGG - Intronic
1071692999 10:87842442-87842464 GGCAGTAGGTAATGGTGAACAGG + Intergenic
1073842196 10:107510395-107510417 TGCACAAAGTCTTGTTGAACTGG + Intergenic
1074685908 10:115962241-115962263 GACAAAAGGTGGTGGAGAACAGG + Intergenic
1079400193 11:20100727-20100749 AGCACATGGCGTTGATGAACAGG + Intronic
1082716205 11:56617323-56617345 GTCACAGGGTTTTGGTGTACAGG + Intergenic
1083730599 11:64650533-64650555 GGCACAACGTGGTGGTGTCCAGG - Exonic
1085285113 11:75354590-75354612 TGCTCCTGGTGTTGGTGAACAGG + Intergenic
1086191063 11:84079790-84079812 GGCACAAGGTGAAGGTGGAGAGG - Intronic
1087624893 11:100585231-100585253 GGCACAAGGTAGGGGTGAATGGG - Intergenic
1094065407 12:26356523-26356545 GGCACAAGGTGTTGGTGAACAGG + Intronic
1094171655 12:27499418-27499440 GGCACAGAGTGTTGGGGAATAGG + Intronic
1095214333 12:39529941-39529963 GGCACAAAGTATGGGTCAACTGG - Intergenic
1097187683 12:57204435-57204457 TGCACAAGGTGTTGTTGCACTGG - Exonic
1097407470 12:59208093-59208115 GGTACAAAGTTTTGATGAACAGG + Intergenic
1100659952 12:96686141-96686163 AGAACAAGGTGTTGGTTAATTGG + Intronic
1103873380 12:124107289-124107311 GTCACAAGGTGCTGGTGAGAAGG + Intronic
1111462060 13:88558304-88558326 AGGAAAAGGTATTGGTGAACAGG + Intergenic
1111804384 13:93021176-93021198 GGCAGAAGGTGATGGGGAGCAGG + Intergenic
1115641657 14:35339180-35339202 GGCACAAGGTGCTTGTTAGCGGG - Intergenic
1117030533 14:51664667-51664689 GGCACAAGGTTTTTGAGAAGTGG + Intronic
1118322462 14:64761366-64761388 AGCAGAAGCTGTTGCTGAACAGG + Intronic
1119427342 14:74544265-74544287 GGCACAAGCATTTGCTGAACTGG - Intronic
1202932922 14_KI270725v1_random:55570-55592 GGCACAAGGAATCTGTGAACTGG - Intergenic
1126557868 15:50009356-50009378 GGCACCAAGTGTTGGAGAACAGG + Intronic
1126828215 15:52572044-52572066 AGCACATGGTGTTGGAGAAATGG - Intergenic
1130028120 15:80287093-80287115 GGCTTAAGGTGCTGGTGCACAGG + Intergenic
1132516433 16:368223-368245 TGCACAAGGGGCTGGTGCACTGG - Intronic
1132589209 16:719110-719132 AGCCCAGGGTGTTTGTGAACAGG - Exonic
1133744491 16:8676015-8676037 GGGACAGGATGTTGGTGACCTGG + Intronic
1136021872 16:27445654-27445676 GCCACTAGGTGGTGGTGAAGAGG + Intronic
1138482667 16:57314163-57314185 GGAAAAAGGTGTCGGTGAACTGG + Intergenic
1138628947 16:58278275-58278297 TGCACTAGGTGTTTCTGAACTGG + Intronic
1142153143 16:88521488-88521510 GGAACATGGTGTTGGTGCTCAGG - Intronic
1142592458 17:1012326-1012348 GGGCCAGGGTGGTGGTGAACCGG + Intronic
1143311276 17:5991572-5991594 GGCACCAGGTGTGGGTGAACCGG + Intronic
1148795727 17:50195799-50195821 GGACAAAGGTGTTAGTGAACGGG + Intronic
1150835334 17:68558577-68558599 GGCAGAAGGTGGTAGAGAACAGG - Intronic
1152194542 17:78909531-78909553 GGCACCAGGTGATGGGGTACGGG - Intronic
1152851937 17:82642085-82642107 GGAACAAGGTGTGGGGGGACAGG - Intronic
1155915998 18:31557619-31557641 AGCAGAAGGTGTGGGTGAAGAGG + Intergenic
1159653016 18:70999928-70999950 GGCACAAGCTGAGTGTGAACAGG + Intergenic
1160775158 19:852184-852206 GGCACAGGGCGTTGATGAAAAGG - Intronic
1163801421 19:19368027-19368049 AGTACAAGGTGGTGGTGGACTGG - Intergenic
1167269092 19:48498093-48498115 GGGAGAAGGTGCTGGTGAATGGG - Exonic
925282333 2:2693345-2693367 GGCATAAGGTGGTGGGGTACAGG - Intergenic
928925817 2:36578132-36578154 GGCACAAATTGTTTGTAAACAGG - Intronic
930529217 2:52570905-52570927 GGCACCATGGGCTGGTGAACAGG + Intergenic
931388531 2:61818801-61818823 GGTAAAATGTGTTGGGGAACAGG + Intergenic
934463263 2:94234592-94234614 GGCACAAGGAATCTGTGAACTGG - Intergenic
936727933 2:115344693-115344715 GGCATAATGTGTTGGTGAAAAGG + Intronic
938118519 2:128618232-128618254 GGCAGAAGGTGAAGGGGAACAGG - Intergenic
939401924 2:141705520-141705542 AGCACAATGTGTTAGTAAACAGG - Intronic
944616436 2:201465287-201465309 GGCGCAAGGTCTTGGTCAGCAGG + Intronic
945830396 2:214777719-214777741 GGAACAAGGAGTTGGTAAAGAGG - Intronic
947911717 2:233804974-233804996 GGCACAAGACGTTGGTGAGAAGG - Intronic
948627098 2:239275965-239275987 GGCACCAGGCGGTGGTGGACAGG + Intronic
1169200176 20:3705474-3705496 GACACAAAGGGTTGGGGAACAGG - Intronic
1170147025 20:13186588-13186610 GGTATAAGGTGTTGGGGAAGGGG - Intergenic
1173582991 20:44160372-44160394 GGCGCATGCCGTTGGTGAACTGG + Exonic
1175500501 20:59446757-59446779 TGCAAAACATGTTGGTGAACTGG - Intergenic
1175900738 20:62359019-62359041 GGGTCAAGGTGTGGGGGAACTGG - Intronic
1176594310 21:8677642-8677664 GGCACAAGGAATCTGTGAACTGG - Intergenic
1179075331 21:38115103-38115125 GGAACAAGGTATTTGGGAACAGG - Intronic
1180584386 22:16873665-16873687 GGCACAAGGAATCTGTGAACTGG - Intergenic
1181771420 22:25128481-25128503 GACACAAGTTGCTGTTGAACAGG - Intronic
1183328580 22:37207404-37207426 GGCAGAATATGCTGGTGAACTGG + Exonic
1184387809 22:44186276-44186298 TGCCCAAGGTGTAGGAGAACTGG + Intronic
1184820833 22:46908202-46908224 GGCACAAGGTGATGGTGGTCAGG + Intronic
1184879826 22:47297691-47297713 GGCACAAGGGGTGGGTGACGTGG + Intergenic
949539368 3:5020223-5020245 TGTACAAGGTGTGGGTGAAGTGG + Intergenic
950139303 3:10604234-10604256 GGCAGAAGGTGATGGTGACCTGG - Intronic
954294823 3:49668460-49668482 GTCACAAGGTGGTGGTGGAGGGG - Exonic
962186009 3:133260054-133260076 GGCTCAAGGTGCAGATGAACTGG - Intronic
962349050 3:134643579-134643601 GGCACAAGGGGTGTGTGCACAGG - Intronic
962492083 3:135904091-135904113 GGCAGAAGGTGAAGGGGAACTGG + Intergenic
962860652 3:139397314-139397336 GGCACACAGAGTTGGTGAAAAGG - Intergenic
965666589 3:171100621-171100643 AGCACAAGGTGTTTGTGCCCTGG - Intronic
970697218 4:18692115-18692137 AGCGCAAGGTGTTGGTGCAGGGG + Intergenic
971036698 4:22701186-22701208 GTCACAAGGTGTGGGGGAAGGGG - Intergenic
971127079 4:23765693-23765715 TGCATAAAGTGTTGGTGAGCCGG - Intronic
976987234 4:91316881-91316903 GGCAGAAGATGGAGGTGAACGGG + Intronic
977539312 4:98297438-98297460 AGCACAAGGTGTTGGAAAAATGG - Intronic
979242803 4:118463447-118463469 GGAACTATGTGTAGGTGAACAGG + Intergenic
979448808 4:120844404-120844426 AGCACATGGTGTTGGAGAAATGG - Intronic
980306547 4:131068084-131068106 GGCAGAAGGTGAAGGTGAAGGGG - Intergenic
981439373 4:144765686-144765708 GGCACATGCTGTTGGAAAACTGG + Intergenic
982609958 4:157560360-157560382 GGGACAGGGTAATGGTGAACTGG - Intergenic
982737293 4:159019735-159019757 GGAACAAGGTTTTGCTGACCTGG + Intronic
989648003 5:43657072-43657094 GGATCAATGTGTTGGTGAACAGG + Intronic
993072945 5:83188622-83188644 GGCAGAAGATGATGGAGAACTGG + Intronic
998447031 5:142206326-142206348 GACACAATGTGTTGGTGAGAAGG + Intergenic
1010998172 6:82557474-82557496 GGCCAAACGTGTTGGTAAACAGG + Intergenic
1013690663 6:112638451-112638473 GGAAGAAGGTGTTGGTAAAAGGG - Intergenic
1014031276 6:116707918-116707940 GGCACAAGGTGATGGCAAAACGG - Intronic
1016693321 6:146964377-146964399 GGCAGAAGGTGAAGGGGAACAGG - Intergenic
1019213504 6:170424618-170424640 GGCACAAGAGGATGCTGAACTGG - Intergenic
1022360483 7:29651866-29651888 TGCACGAGATGTTGGTGCACTGG - Intergenic
1022559807 7:31336496-31336518 GGCACAAGGGGCGGGTGAAGGGG + Intergenic
1025147415 7:56516647-56516669 GGGAGCAGGTGCTGGTGAACTGG + Intergenic
1026471517 7:70696640-70696662 GACAGAAGCTGTGGGTGAACAGG - Intronic
1027247439 7:76376725-76376747 GGGACAAGGTGGTGATGGACAGG - Intergenic
1028362930 7:89990803-89990825 GTCACAAGGATTTGGTGTACAGG - Intergenic
1030567722 7:111180596-111180618 GGCACATGCTGTTGGAAAACTGG + Intronic
1031380889 7:121084786-121084808 GGGACAATGTGTTGTTGCACAGG + Intronic
1034561688 7:151884220-151884242 GGCATAAAGTGCTAGTGAACAGG - Intergenic
1036004810 8:4649903-4649925 GGCACCATGTGTTGATGCACAGG + Intronic
1036294802 8:7527209-7527231 GGGACCAGGAGTTGGTGAAGGGG - Intergenic
1036327761 8:7793782-7793804 GGGACCAGGAGTTGGTGAAGGGG + Intergenic
1036492210 8:9238125-9238147 GTCAGTAGGTTTTGGTGAACTGG + Intergenic
1039786284 8:40837364-40837386 GGCACCAGGGGTTGGGGAAAGGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1043450532 8:80361811-80361833 GCCACAAGGGGTTGGTAAAAAGG + Intergenic
1049134501 8:140883663-140883685 CGTACTAGGTGTTGGAGAACAGG - Intronic
1049375303 8:142286622-142286644 GGCAGAAGGTGGTGGTGACGAGG - Intronic
1049980538 9:900245-900267 GGCAGAAGGTGCTGGAGCACCGG - Intronic
1053070978 9:35101844-35101866 GGCACAAGATTTTAGTGAAGAGG + Intronic
1053693331 9:40611236-40611258 GGCACAAGGAATCTGTGAACTGG - Intergenic
1053940315 9:43241629-43241651 GGCACAAGGAATCTGTGAACTGG - Intergenic
1054271501 9:63028851-63028873 GGCACAAGGAATCTGTGAACTGG + Intergenic
1054304574 9:63410464-63410486 GGCACAAGGAATCTGTGAACTGG - Intergenic
1054403320 9:64734483-64734505 GGCACAAGGAATCTGTGAACTGG - Intergenic
1054436942 9:65219971-65219993 GGCACAAGGAATCTGTGAACTGG - Intergenic
1054493455 9:65802021-65802043 GGCACAAGGAATCTGTGAACTGG + Intergenic
1055753372 9:79531352-79531374 GGGACAAGGTGAAGCTGAACAGG - Intergenic
1056736983 9:89218444-89218466 GTCACAGGATGATGGTGAACAGG - Intergenic
1057357312 9:94342369-94342391 GGCACAATTTGCTAGTGAACAGG + Intergenic
1060210546 9:121707495-121707517 GGCAGGAGGTGATGGTTAACTGG - Intronic
1060343082 9:122793754-122793776 GGCAAGAGGAGTTGGGGAACTGG - Intergenic
1062440223 9:136566421-136566443 AGCACACGGTGTTGGTGGAGGGG - Intergenic
1203624441 Un_KI270749v1:157903-157925 GGCACAAGGAATCTGTGAACTGG - Intergenic
1188212746 X:27443853-27443875 GGCAGGAGGGGATGGTGAACAGG + Intergenic
1189072421 X:37877778-37877800 AGCACAAGCTGTTGGAGAAATGG - Intronic
1202371159 Y:24196933-24196955 GGCAGGAGGTGATGGTGATCAGG - Intergenic
1202390535 Y:24365548-24365570 GGAACTATGTGTAGGTGAACAGG + Intergenic
1202480249 Y:25304568-25304590 GGAACTATGTGTAGGTGAACAGG - Intergenic
1202499625 Y:25473184-25473206 GGCAGGAGGTGATGGTGATCAGG + Intergenic