ID: 1094069816

View in Genome Browser
Species Human (GRCh38)
Location 12:26400874-26400896
Sequence CCTCATCTGTAAAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094069808_1094069816 15 Left 1094069808 12:26400836-26400858 CCACACTGGGACTCAGGCAAGTT 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG 0: 15
1: 99
2: 349
3: 811
4: 1556
1094069807_1094069816 16 Left 1094069807 12:26400835-26400857 CCCACACTGGGACTCAGGCAAGT 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG 0: 15
1: 99
2: 349
3: 811
4: 1556
1094069805_1094069816 21 Left 1094069805 12:26400830-26400852 CCGTTCCCACACTGGGACTCAGG 0: 1
1: 0
2: 5
3: 26
4: 278
Right 1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG 0: 15
1: 99
2: 349
3: 811
4: 1556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094069816 Original CRISPR CCTCATCTGTAAAATGGGGA GGG Intronic
Too many off-targets to display for this crispr