ID: 1094076987

View in Genome Browser
Species Human (GRCh38)
Location 12:26488068-26488090
Sequence CAGGAGAAGCAGTAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 771
Summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 689}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094076981_1094076987 3 Left 1094076981 12:26488042-26488064 CCTGCTCAATGCCTTATGGAAGT 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG 0: 1
1: 0
2: 4
3: 77
4: 689
1094076977_1094076987 30 Left 1094076977 12:26488015-26488037 CCTTGGGAAGATTTACCCTAATT 0: 1
1: 0
2: 2
3: 11
4: 129
Right 1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG 0: 1
1: 0
2: 4
3: 77
4: 689
1094076979_1094076987 14 Left 1094076979 12:26488031-26488053 CCTAATTCTTGCCTGCTCAATGC 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG 0: 1
1: 0
2: 4
3: 77
4: 689
1094076978_1094076987 15 Left 1094076978 12:26488030-26488052 CCCTAATTCTTGCCTGCTCAATG 0: 1
1: 0
2: 0
3: 10
4: 176
Right 1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG 0: 1
1: 0
2: 4
3: 77
4: 689
1094076983_1094076987 -8 Left 1094076983 12:26488053-26488075 CCTTATGGAAGTGTCCAGGAGAA 0: 1
1: 0
2: 1
3: 22
4: 201
Right 1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG 0: 1
1: 0
2: 4
3: 77
4: 689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094076987 Original CRISPR CAGGAGAAGCAGTAGGAGGT AGG Intronic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901210173 1:7520197-7520219 GAGGAGGAGGAGGAGGAGGTCGG - Intronic
901762676 1:11480765-11480787 CAGGTGTAGTAGTAGGAGGTGGG - Intronic
902142355 1:14367401-14367423 GAGGAGAAGCAGCTGGACGTTGG - Intergenic
902151126 1:14444403-14444425 CAGGAGAATCAGTTGGACCTGGG - Intergenic
902403854 1:16172545-16172567 CAGGAGAAACAGTAGGGTGGAGG - Intergenic
902469623 1:16639339-16639361 CAGGAGAGACAGCAGGTGGTAGG - Intergenic
902513459 1:16978241-16978263 CAGGAATAGCAGGAAGAGGTAGG + Exonic
902828650 1:18995454-18995476 GAGGAGGAGGAGGAGGAGGTAGG - Intergenic
902835944 1:19046956-19046978 CAGGTGAAGCGGGTGGAGGTGGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904051208 1:27640123-27640145 GAGGAGAAGGGGTAGGATGTTGG - Intergenic
904085358 1:27903020-27903042 CAGGAGAATCAGTTGAAGCTGGG - Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
904357045 1:29947022-29947044 AAAGAGAAGGAGGAGGAGGTTGG - Intergenic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
904568428 1:31442592-31442614 GAGGAGGAGCAGTGGGAAGTGGG - Intergenic
904663381 1:32101729-32101751 CAGGAGAAGTGGTAGGAAATGGG - Intronic
904899869 1:33848412-33848434 CAGGAGAATCAGTGGGAGACTGG - Intronic
904945782 1:34197786-34197808 CAGGACGTGCAGGAGGAGGTCGG - Exonic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906262523 1:44405367-44405389 CAGCAGCAGCAGTAGGCGGCTGG - Exonic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906960809 1:50418657-50418679 CCGGAGAAGCAGTAGGGCGAGGG - Exonic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907894545 1:58673872-58673894 CAGGAGCACCAGTAGCAGGTGGG + Intronic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908919099 1:69168794-69168816 CACGAGAAGATATAGGAGGTGGG - Intergenic
909060282 1:70871249-70871271 CAAGAGAGACAGTAGGGGGTGGG + Intronic
909430310 1:75580743-75580765 CAGGAGAATCAGTAGAACCTGGG + Intronic
910895584 1:92066215-92066237 CAGAAAAAGCAGTTGGATGTGGG + Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
913275635 1:117135318-117135340 CAGGAGGTGCGGTAGGAGGTGGG + Intergenic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
913380302 1:118203085-118203107 CAGGAGAAGCTGGAGGAGAAAGG - Intergenic
914003112 1:143709266-143709288 CAGGAGAAGAAGGAGCAGTTGGG + Intergenic
914704881 1:150162446-150162468 GAGGAGAAGCACTGGGAGGAAGG - Intronic
914720733 1:150286732-150286754 CAGGAGATGCTGTAGTAGGTGGG - Exonic
914741966 1:150472755-150472777 CAGGAGGGGGAGGAGGAGGTGGG - Exonic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914920048 1:151840191-151840213 CAGGAAAAGAGGTAGGACGTAGG - Exonic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915170313 1:153972905-153972927 CAGGAGAAGCATTGGGGAGTTGG + Intronic
915361619 1:155289400-155289422 CAGGAGGAGTAGGAGGAGGCAGG + Exonic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
917422897 1:174883408-174883430 CTGGAGACGCAGGAGGAGTTGGG + Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918045668 1:180939546-180939568 CAGGAGAAGTGGTGGGAGGCAGG - Intronic
918388675 1:184036712-184036734 CAGGGCTAGCAGTATGAGGTGGG + Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919920439 1:202163815-202163837 CTGGAGAAGCACTAGGATCTCGG + Intergenic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
921006642 1:211100318-211100340 CATGAGAAGTAATATGAGGTTGG - Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922015121 1:221637496-221637518 CTGGAGAAATAGTAGGAAGTGGG - Intergenic
922076856 1:222253666-222253688 CAGCAGAAGCAGTTGGACGTTGG + Intergenic
922159592 1:223068858-223068880 GAGGAAAAGCAGTGGGAGGGTGG + Intergenic
922222517 1:223619247-223619269 GAGGATAAGCTGGAGGAGGTTGG + Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923036824 1:230290329-230290351 CTGGAGAAGCGGTAGTGGGTAGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923869574 1:237976330-237976352 CACGAGAGGAAGTAGGGGGTGGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063934869 10:11066859-11066881 GAGGAGATGCAGCAGGAGCTGGG - Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1067048262 10:42997940-42997962 CAGCAGAAGCTGGAGGATGTGGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1068451214 10:57191643-57191665 CAGCAAAAGCCGTAGGAGGAGGG - Intergenic
1068981799 10:63070470-63070492 GAGGAGGAGAAGGAGGAGGTGGG - Intergenic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1070360126 10:75680254-75680276 CAGGAGTAACAGTAGGATGCTGG + Intronic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072279207 10:93850779-93850801 GAAGAGAAGCAGCAGGACGTCGG + Intergenic
1072803806 10:98411317-98411339 CAGGAGAAGCAATGGGTGGCTGG + Intronic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1072934864 10:99702390-99702412 AAGGTGAAGCGGGAGGAGGTAGG + Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1074134957 10:110618148-110618170 AAGGAGGAGGAGGAGGAGGTAGG + Intergenic
1074154062 10:110783035-110783057 AAGGAGAAGGGGTGGGAGGTGGG + Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074429596 10:113382607-113382629 AAGGAGAAGGTGGAGGAGGTAGG - Intergenic
1074456652 10:113601304-113601326 CAGGAGAAGCAGCTGAAGGCTGG + Intronic
1075115574 10:119623843-119623865 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076816735 10:132918793-132918815 CAGGGGATGCAGGAGGAGTTGGG - Intronic
1077065096 11:637540-637562 CAGGAGAGCGAGGAGGAGGTCGG - Exonic
1077458523 11:2695771-2695793 TAGGAGAAGCATTAGAAAGTAGG - Intronic
1077870486 11:6258537-6258559 CAGCAGTAGCTGTAAGAGGTTGG - Intergenic
1078190468 11:9089745-9089767 CAGGAGCACTTGTAGGAGGTGGG + Exonic
1078338325 11:10481491-10481513 CAGGAGACACAGGAGGAGTTAGG - Intronic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1079110717 11:17603611-17603633 CAGGAGAAGCAGTATGGGAAGGG - Intronic
1079298033 11:19252116-19252138 CAGTAGGGGCAGTGGGAGGTCGG - Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079996946 11:27305019-27305041 CATGAATAGCAGTAGGAGGCAGG + Intergenic
1080051125 11:27860117-27860139 CGGGAGAAGCAGTTGAAGGGGGG + Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080757536 11:35216495-35216517 ATGGAGGAGCACTAGGAGGTAGG + Intronic
1081127238 11:39336612-39336634 AAGTAGAAGTAGTAGGAGCTGGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1082179769 11:49103314-49103336 AAGCAGAACCAGTAGGAGGGCGG - Intergenic
1082790467 11:57343250-57343272 AAGGAGGAGGAGGAGGAGGTAGG + Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1086026840 11:82303928-82303950 CAGGAGAAGCAGTGGATGGAAGG - Intergenic
1086163251 11:83747088-83747110 GAGGAGAAGTGGTGGGAGGTTGG + Intronic
1086286178 11:85253944-85253966 GAGGAGAAGCAGCTGGATGTTGG - Intronic
1086364606 11:86095929-86095951 CAGGAGAATCACTAGGACCTAGG - Intergenic
1086462339 11:87018292-87018314 CAGGAAAAGCAGTGGGTGCTTGG + Intergenic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086950882 11:92889158-92889180 CAGGAAAAGAAGTCGGAGGTAGG - Intronic
1088224003 11:107599096-107599118 GAGGACAAGTAGGAGGAGGTGGG + Intronic
1088494376 11:110418787-110418809 CCAGAGAATCAGCAGGAGGTAGG - Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088757290 11:112896314-112896336 CAGGAGCAGGAGTGGGAGGTGGG - Intergenic
1088883703 11:113991128-113991150 AAGAAGAAACACTAGGAGGTGGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089173158 11:116529394-116529416 CCAGAAAAGCAGTAGGAGGCTGG + Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089251268 11:117163810-117163832 CAGCAGAAGAAGTAGCAGGTGGG + Exonic
1089336311 11:117726095-117726117 CACGAGAAGCAGGACGAAGTGGG + Intronic
1089522124 11:119071932-119071954 CCGGAGTAGGAGTAGGAGATTGG - Intronic
1089523093 11:119078694-119078716 CAGGGGAAGCTGTAAGAGTTTGG + Exonic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090648370 11:128784715-128784737 CAGGAGAGCCAGTGAGAGGTGGG - Intronic
1090938385 11:131365664-131365686 CATGAGGAGGAGGAGGAGGTGGG - Intergenic
1091082184 11:132681373-132681395 GAGGAGAAGCAGCTGGATGTCGG + Intronic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091690983 12:2597298-2597320 CAGGAGGAGCAGAAGGGGATGGG - Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092465673 12:8729473-8729495 CAGGAGAAGCAGCTGGACGTCGG - Intronic
1092695946 12:11171417-11171439 CAGAAGACGCCGTACGAGGTGGG - Intronic
1093401734 12:18754293-18754315 GAGGAGAAGCAGCTGGACGTTGG - Intergenic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093611469 12:21164401-21164423 GAGGAGAACCAACAGGAGGTGGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1095180751 12:39144779-39144801 CGGGAAAGGCAGTAGGAGGGAGG + Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095617886 12:44214236-44214258 CAGGAGAATCACTAGGACCTGGG - Intronic
1096216627 12:49801367-49801389 CAGGAGAAGCAGGAGGCTATTGG - Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096387429 12:51204134-51204156 CAGGTGGAGCAGTACCAGGTGGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1097994490 12:65872698-65872720 CAGGAAAACTAGTAGGAGGCTGG - Intronic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1098860163 12:75700325-75700347 GAGGAGGAGGAGTAGGAGGAGGG + Intergenic
1099019590 12:77386920-77386942 CATGAGAAGCAGTTGGAAGAAGG + Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099285201 12:80708179-80708201 CAGGAGAAGATGCAGGAGCTGGG + Exonic
1100613025 12:96208142-96208164 CAGGAGAATCGCTAGGAGCTGGG - Intronic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1101204248 12:102469398-102469420 CAGGATATGCAGTAGGATCTGGG - Intronic
1101837188 12:108303841-108303863 CAGGAGAAGCCTTTGGAGGCGGG + Intronic
1101920126 12:108925650-108925672 CAGGGGAAGAAGTAGAAGGTGGG - Intronic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103016775 12:117500804-117500826 CAGGACATGCAGCAGGAGCTGGG + Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103904064 12:124318549-124318571 GAGGAGAAGCTGCAGGAGGTCGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107604072 13:42040961-42040983 AAGGAGAAGCGGGAGGGGGTGGG - Intronic
1107744813 13:43493150-43493172 CAGGAGAGGGAGTGGGAGGGGGG - Intronic
1108128784 13:47274365-47274387 CAGGAGAAGCTTTGGGGGGTTGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1109267168 13:60215239-60215261 CAGCAGAATCTGTAGGAGGATGG - Intergenic
1110028710 13:70576676-70576698 TAGGGGGAGCAGGAGGAGGTGGG - Intergenic
1110466311 13:75806229-75806251 CAGGAGAAGCAGTAGTGCTTCGG + Intronic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1110955610 13:81549251-81549273 CAGGAGAAACAGTGAGAGGGGGG + Intergenic
1111767553 13:92551700-92551722 ATTGAGAAACAGTAGGAGGTAGG + Intronic
1111912709 13:94329769-94329791 GAGGAGGAGGAGTAGGAGGAAGG - Intronic
1112622660 13:101067347-101067369 GAGGAGGAGGAGTAGGAGGAAGG + Intronic
1112724679 13:102289627-102289649 TACGAAAACCAGTAGGAGGTAGG + Intronic
1113260184 13:108553109-108553131 CAGGAGAAGCAGTTGAACCTGGG - Intergenic
1113538963 13:111092070-111092092 GAGGAGGAACAGGAGGAGGTGGG + Intergenic
1114042384 14:18691141-18691163 TAGGAGAAGCTGTAGGAAGACGG - Intergenic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114241629 14:20873871-20873893 CCGGAGAAGCCGGAGGAGCTTGG - Intergenic
1114672185 14:24417213-24417235 CAGGAGAAGGAGTGGAATGTGGG + Exonic
1115153715 14:30314809-30314831 GAGGAGAAGCAGCTGGATGTTGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115498698 14:34030660-34030682 CAGGAGAAGCAGTTGAACCTGGG - Intronic
1115617827 14:35113155-35113177 CAGAAGAAACATTAGGAGATGGG + Intronic
1115731698 14:36276236-36276258 CAGGAAAAGGACTAGGACGTGGG - Intergenic
1116467937 14:45254596-45254618 AAGGAAAAACAGTTGGAGGTAGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117625755 14:57636139-57636161 CAGGAGAACCAGTAGGAGTTAGG + Intronic
1117886273 14:60367328-60367350 TAGCAGTAGCAGTAGGAGATAGG - Intergenic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118976011 14:70677182-70677204 CAGGACAAGTACTTGGAGGTGGG + Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1119485181 14:74982167-74982189 TGGGAGAAGCAGCAGGACGTGGG + Intergenic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1120527454 14:85593635-85593657 CAAAAGAAACAGTAGAAGGTTGG - Intronic
1121145291 14:91577704-91577726 GAGGAGAAGCAGCTGGACGTTGG + Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122273441 14:100578666-100578688 CTAGAGAAGAAGCAGGAGGTTGG - Intronic
1122326453 14:100883547-100883569 CATGAGCAGCAGGAAGAGGTGGG + Exonic
1122511318 14:102270506-102270528 CAGGAGAATCAGTTGGACCTGGG + Intronic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127142698 15:55993623-55993645 GAGGAGAAGCGGGAGGAGGCGGG + Intronic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128512084 15:68319505-68319527 GAGGAGAAGTGGCAGGAGGTGGG + Intronic
1128554746 15:68623696-68623718 CAGGAGCAGCAGCAGCGGGTGGG + Intronic
1128568138 15:68714656-68714678 CTGGAAAGGTAGTAGGAGGTGGG + Exonic
1128749541 15:70139225-70139247 GAGGAGCAGCAGGCGGAGGTGGG - Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129265653 15:74391906-74391928 CAGAGGCAGCAGTAGGCGGTGGG - Intergenic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1131000768 15:88938084-88938106 CAGGAGAACAAATAGGAGATAGG + Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1132219559 15:100095142-100095164 AAGGAGAGGCAGGAGCAGGTTGG - Intronic
1132722034 16:1321219-1321241 CAGGCGGAGCAGTGGGGGGTCGG - Intronic
1132953593 16:2578780-2578802 CAGGAAAAACTGTGGGAGGTGGG + Intronic
1132960758 16:2621387-2621409 CAGGAAAAACTGTGGGAGGTGGG - Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133514870 16:6498805-6498827 CAGGAGAAGAACTAGCAGGTGGG - Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133701774 16:8315741-8315763 CAGGAGAATCAGTTGAACGTGGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135304419 16:21356108-21356130 TGGGAGATGCAGTAGGAGGGTGG + Intergenic
1135682654 16:24471641-24471663 CAGAAGAAGGAGTGGGAAGTAGG - Intergenic
1136294240 16:29292540-29292562 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1136616591 16:31402050-31402072 CAGGAGCTGCAGGAGGGGGTTGG + Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139277528 16:65741657-65741679 CAGGAGAATCACTAGGACTTGGG + Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139747206 16:69084132-69084154 TAGGAGATGCAGTTGGAGGTGGG + Exonic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141323375 16:83033190-83033212 CAGGAGGAGCATGAGTAGGTTGG - Intronic
1141775760 16:86121753-86121775 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1142100144 16:88266586-88266608 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1142220941 16:88854636-88854658 CAGCAGACCCAGTGGGAGGTTGG - Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142827388 17:2522298-2522320 CAGGAGAGGCTGTCGGGGGTCGG + Intergenic
1142841521 17:2635068-2635090 CAGGAGAATCACTAGAAGCTGGG + Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143125067 17:4636685-4636707 CAGGCTAAGGAGTATGAGGTGGG - Intronic
1143141982 17:4745906-4745928 CAGGAGGAGCAGAGGGAGTTGGG - Exonic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143181354 17:4986334-4986356 CAGGATGAGAAGTATGAGGTAGG + Intronic
1143332348 17:6147018-6147040 CAGGAGAGGCTGTACTAGGTTGG - Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143510595 17:7393442-7393464 AAGTAGAAGGAGTGGGAGGTTGG - Intronic
1143588335 17:7863730-7863752 CAGGAGTAGGAGTAGGGGGTTGG - Intronic
1143861031 17:9890767-9890789 CAGGTAAAGCAATAGGAGTTTGG + Exonic
1144146491 17:12404254-12404276 CAGCAGATGAAGTATGAGGTGGG + Intergenic
1144718056 17:17447954-17447976 CACCAGAAGCTGGAGGAGGTAGG + Intergenic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1147769376 17:42857027-42857049 CAGGAGGAGGAGGAGGAAGTAGG - Exonic
1148647170 17:49225720-49225742 CAGGAGAAGCAGTGGGGCTTGGG + Intronic
1148758077 17:49985059-49985081 CAGGAGAAGCAATTGGATGCTGG + Intergenic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1149066423 17:52485921-52485943 CAGGAGGAGGAGGAGGAGATGGG - Intergenic
1149092542 17:52801464-52801486 CAGCAGTAGCAGTAGCAGATTGG - Intergenic
1149302181 17:55315659-55315681 AAGGAGAAGCAGTAAAATGTTGG + Intronic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150463864 17:65375272-65375294 CAGGTGCACCAGTAAGAGGTGGG + Intergenic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151045015 17:70909619-70909641 CAGGTGAAGCAGGAGGATTTAGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152008254 17:77695680-77695702 CAGGTGAAGCAGCAGCAGATTGG - Intergenic
1152945931 17:83197318-83197340 CAGAAAAAGCAGCAGGCGGTTGG + Intergenic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1157244426 18:46040894-46040916 CAGGAGAGGGAGAAGGAGCTGGG + Intronic
1157275043 18:46304360-46304382 CTGGAGAAGCTGTGGGAAGTAGG + Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159491502 18:69140749-69140771 CAAGAGAAGAAGAAGGGGGTGGG + Intergenic
1159915400 18:74183191-74183213 GAGGAGAAGTAGGGGGAGGTGGG - Intergenic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163114306 19:15180033-15180055 CAGGAGAGGGAAGAGGAGGTGGG - Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163666175 19:18605147-18605169 CAGGCGAAGGTGTAGGGGGTGGG - Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163786622 19:19278030-19278052 CCTGAGAAGCAGGAGGAGCTTGG - Intronic
1163833899 19:19562066-19562088 CAGGTGAGGCAGTTGCAGGTTGG + Exonic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165230193 19:34381932-34381954 CAGGAGCTGCAGGAGGAGCTGGG + Intronic
1165293548 19:34907843-34907865 CTGCAGAAGCAGTGGTAGGTGGG - Intergenic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1166119781 19:40678996-40679018 CAGGAGAATCACTTGAAGGTTGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166783292 19:45353237-45353259 CTGGAGAAGTACCAGGAGGTGGG - Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167853570 19:52220263-52220285 CAGGAGCAGCAAGAGGAGATGGG + Intronic
1167981033 19:53276008-53276030 CAAGAGAAGGATTAGGAGATAGG - Intergenic
1168124668 19:54276865-54276887 GAGGAGGAGCAGTAGGACGACGG + Exonic
1168147254 19:54426681-54426703 CAGGAGCAGCAGGAGGACGTAGG - Exonic
1168177318 19:54634683-54634705 GAGGAGGAGCAGTAGGATGACGG - Exonic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
927258496 2:21061890-21061912 CTGGAGAAACAATAGGAAGTGGG - Intergenic
927537067 2:23871789-23871811 GTAGAGAAGGAGTAGGAGGTGGG - Intronic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
928060410 2:28107111-28107133 CAGGAGCAACAGTAGCAAGTTGG - Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928338099 2:30416231-30416253 TAGGAGAAGAAGTGGGAGTTTGG + Intergenic
928813088 2:35253497-35253519 GAGGAGAAGCAGCTGGATGTCGG + Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931251052 2:60530817-60530839 CAGGAGGGGTAGTGGGAGGTGGG - Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931474237 2:62571341-62571363 CTGGAGATGGAGTTGGAGGTGGG - Intergenic
933105206 2:78316075-78316097 AAAGAGAGGCAGTAAGAGGTAGG + Intergenic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
935639896 2:105280649-105280671 CGGGTGAAGGAGGAGGAGGTGGG + Exonic
936160053 2:110078058-110078080 CTGGAGAAGCAGCAGGATTTGGG - Intergenic
936164242 2:110105899-110105921 GAGTAGAAGCAGCAGCAGGTTGG + Intronic
936184611 2:110293295-110293317 CTGGAGAAGCAGCAGGATTTGGG + Intergenic
936868615 2:117107348-117107370 GAGGAGAAGCAGTTGGATGTTGG + Intergenic
937490257 2:122359548-122359570 AAGGAGGAGGAGTAGGAGGATGG - Intergenic
937899852 2:127011564-127011586 AAGGAGAAGTTTTAGGAGGTGGG + Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938942486 2:136181271-136181293 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
938982061 2:136536398-136536420 CAGGAGAGTCAGTACGAAGTGGG + Intergenic
939006433 2:136792789-136792811 CAGGATAGGCAGTAGGAGATAGG - Intronic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939462913 2:142519673-142519695 GAGGTGAAGGAGTAGGAGGAGGG + Intergenic
939608308 2:144279343-144279365 GAGGAGATGCAGTAGAGGGTGGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941712752 2:168731615-168731637 AAGGAGAAGTAGCAGGGGGTGGG + Intronic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
942775119 2:179572050-179572072 CAGGAAATGTAGTTGGAGGTTGG + Intronic
943694456 2:190909640-190909662 TAGGAGAAGAAATAGGAGTTTGG + Intronic
945122280 2:206469255-206469277 CAGGAGAAGGAGGTGGTGGTAGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945517050 2:210775281-210775303 CAAGAGCAGCACTAGGAGGATGG - Intergenic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946471395 2:219964285-219964307 GAGGAGAAGCAGCTGGATGTAGG + Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948371049 2:237489167-237489189 CAGGTGAGGCTGTAGGAGGATGG - Intronic
948735729 2:240003769-240003791 GATGAGAAGCAGCAGGGGGTGGG + Intronic
948949091 2:241237206-241237228 CAGGAGAGGCAGTGGGAAGGGGG + Intronic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169403171 20:5301067-5301089 CCTGGGAGGCAGTAGGAGGTGGG + Intergenic
1169642470 20:7769584-7769606 CCAGTGAAGCAGTAGGGGGTTGG - Intergenic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172205425 20:33159863-33159885 CAGGAGCTGCAGGAGGTGGTGGG + Intergenic
1172946975 20:38697247-38697269 CAGGAAAAGAAGCAGGAGATGGG + Intergenic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173106974 20:40146100-40146122 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1173107856 20:40154648-40154670 GGGAAGAAGCAGTTGGAGGTTGG + Intergenic
1173235873 20:41244897-41244919 CAGGAAAAGCAAAAGGAGTTGGG + Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173656809 20:44705075-44705097 CATGAGAGCCAGTTGGAGGTGGG - Intergenic
1174943290 20:54956115-54956137 CAGGAGAAGCACCTGGAGTTCGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175073392 20:56353616-56353638 CAGGAGCAGCAGGAGGGGGTGGG - Intergenic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176726802 21:10442657-10442679 CAGGAGCTGGAGTGGGAGGTAGG - Intergenic
1177329310 21:19635656-19635678 CAGGGGAAGGGGTACGAGGTGGG + Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1178691511 21:34754124-34754146 TGGGGGCAGCAGTAGGAGGTGGG - Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179939326 21:44628006-44628028 GAGGAGAAGCTGTAGCAGGCCGG - Exonic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1181373133 22:22433714-22433736 CAGGAGAAAGGGTAGGAGGGGGG - Intergenic
1181755069 22:25018016-25018038 GAGGAGGAGGAGGAGGAGGTTGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182029974 22:27151014-27151036 CAGGAGAAACTGGAGCAGGTGGG + Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182332419 22:29560784-29560806 CAGGAGAACCAGGAGGCAGTGGG - Exonic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183572181 22:38661884-38661906 CAGGAGGAGCAGTGAGAGGTCGG + Intronic
1184263122 22:43330962-43330984 CAGGAAAGGCAGTAGGCGGTGGG - Intronic
1184726144 22:46347799-46347821 CAGCAGAAGCAGCAGGGGCTGGG - Intronic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
949114323 3:301416-301438 CAGAACAGCCAGTAGGAGGTTGG - Intronic
949225876 3:1695240-1695262 GAGGAGAAAGAGTAGGAAGTGGG + Intergenic
949935016 3:9109857-9109879 CAGGAGAGGGAGGAGCAGGTAGG + Intronic
950254501 3:11493311-11493333 GAGGAGAAGCAGCTGGATGTTGG - Intronic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952125630 3:30297278-30297300 AGTGAGAGGCAGTAGGAGGTAGG - Intergenic
952441823 3:33338317-33338339 CAGGAGAACCACTTGAAGGTGGG + Intronic
952476685 3:33717947-33717969 CAGGTGCAGCAGAAGGACGTCGG - Intronic
952867706 3:37865670-37865692 CAGGAGAATCACTATGATGTTGG - Intronic
954299821 3:49694878-49694900 CAGGAGAGACAGCAGGTGGTAGG + Intronic
954752192 3:52819920-52819942 CAGGTGACAAAGTAGGAGGTGGG - Exonic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
954852754 3:53617310-53617332 GAGGGGAGGCAGGAGGAGGTAGG + Intronic
955393681 3:58539443-58539465 CAGCAGAAGGAATTGGAGGTTGG + Intergenic
955432594 3:58864049-58864071 CAGGAGAATCACTTGAAGGTTGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955884964 3:63588332-63588354 CAGGAGACACAGTGGAAGGTTGG - Intronic
955933126 3:64077581-64077603 CAGCAGGTGCAGTAAGAGGTAGG + Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
957090091 3:75721372-75721394 CAGGAGAAGCACTTGAATGTGGG - Intronic
957591016 3:82197795-82197817 CAGGAGAATACTTAGGAGGTTGG + Intergenic
958467349 3:94473849-94473871 GAGGAGAAGCAGTTGGACTTTGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
960223949 3:115147818-115147840 AAGTAAAAGCAGTAGGGGGTGGG - Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960574793 3:119218875-119218897 CAGGAGAAGCAGGAGTGGGTGGG - Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
960999926 3:123367357-123367379 CAGGAGAAGCAGTTTGTGGGTGG - Intronic
961101450 3:124202598-124202620 CAGGAGGAGGAGGAGGAGGGAGG - Intronic
961346041 3:126263974-126263996 CTGGGGAAGCGGTAGGATGTTGG + Intergenic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
962263403 3:133928797-133928819 CAGGAGAGGCAGTCGGATGCAGG - Exonic
962352366 3:134665265-134665287 CAGGGGCAGCACCAGGAGGTAGG - Intronic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962966877 3:140363885-140363907 AATGAGGAGCAGTAGGAGGCAGG + Intronic
963346600 3:144102405-144102427 CAGGAGAAGCAGTAGAAAAGTGG - Intergenic
964902030 3:161671210-161671232 CAGCAGGAGCAGTTGTAGGTAGG + Intergenic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
966439273 3:179925993-179926015 CAGGAGAAACATTTGGAGGGGGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
967214136 3:187195991-187196013 CAGGAGAAGCACTTGGAAGATGG + Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968270467 3:197399528-197399550 CAGGGGTAGCAGTTGGGGGTTGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
969111889 4:4849491-4849513 CAGGAGAAGCTAGAGGGGGTTGG + Intergenic
969158821 4:5237264-5237286 CAGGAAAAGCAGTAGGAATCTGG - Intronic
969160739 4:5256487-5256509 CAGGGGAAGCAGTGGGAGAGTGG - Intronic
969506455 4:7591187-7591209 CAAGAGAAGAAGGAGAAGGTGGG - Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970418671 4:15884027-15884049 GAGGAGTAGCAGCAGGCGGTTGG + Intergenic
971427466 4:26530420-26530442 GAGGAGAGGCAGTAGGACATGGG + Intergenic
971565933 4:28141608-28141630 CAGCAGAAGCAGCAAGAGTTAGG - Intergenic
971819991 4:31539440-31539462 CAGGAGAGGCAGGAGTAAGTAGG + Intergenic
971926859 4:33022538-33022560 CAGGAGAATCACTTGGAGTTAGG - Intergenic
972217817 4:36916709-36916731 GAGAAGGAGCAGTAGGAGGCAGG - Intergenic
973572347 4:52253261-52253283 GAGGAGAAGTGGCAGGAGGTTGG + Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973849600 4:54948053-54948075 AGGAAGAAGCAGTAGGAGATAGG + Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975491884 4:74998196-74998218 CAGTTGCAGCAGTTGGAGGTTGG + Intronic
976405711 4:84658869-84658891 CAGAAGAAGCAGGAGAATGTGGG - Intergenic
977069637 4:92368293-92368315 CTTGAGAAGCATTAAGAGGTAGG + Intronic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
977934399 4:102784780-102784802 GAGGAGGAGGAGGAGGAGGTTGG - Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978442009 4:108743399-108743421 CAGCAGAAGCATTAGTAGGGAGG - Intronic
979577622 4:122313670-122313692 CAGGACAAGCAGCAGCTGGTAGG + Exonic
980492951 4:133552949-133552971 GAGCAGAAGCAGCAGGATGTTGG - Intergenic
980644087 4:135619181-135619203 CTGGAGAAGAGGCAGGAGGTGGG - Intergenic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
982235377 4:153247184-153247206 CATGAGAACCAGTGGCAGGTAGG + Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983698259 4:170559503-170559525 GAGGAGAAGCAGGAGCAGGCAGG - Intergenic
983946703 4:173594110-173594132 CAGGAGAAAGAGTTGGGGGTGGG + Intergenic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
984346046 4:178527458-178527480 CAGCAGAAAAAATAGGAGGTAGG + Intergenic
984359646 4:178711806-178711828 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
984365905 4:178800056-178800078 CAGGAGAATCACTAGAACGTGGG + Intergenic
984419111 4:179496850-179496872 AAGGAGAAAGAGGAGGAGGTGGG + Intergenic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
985196214 4:187432486-187432508 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985196228 4:187432555-187432577 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985489516 5:171211-171233 CAGGACAAGCAGCGGGAGCTAGG + Exonic
985515726 5:343751-343773 CACGAGGAGGAGCAGGAGGTGGG + Intronic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986123161 5:4861043-4861065 CAGGAGAAGCAATAGGTGAAAGG + Intergenic
986759926 5:10870542-10870564 GAGGAGGAGAAGGAGGAGGTGGG - Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986884965 5:12222818-12222840 CAGCAAAAGCAGTACGAAGTGGG - Intergenic
987703167 5:21427734-21427756 TAAGAGAAGTAGTAGAAGGTAGG - Intergenic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988987957 5:36639096-36639118 CTGGAGAAGCAGTGTGTGGTAGG + Intronic
990232880 5:53734093-53734115 CAGGAGAGGCTGCAGCAGGTTGG + Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
992912335 5:81408164-81408186 GAGGAGGAGGAGGAGGAGGTGGG + Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993466279 5:88250609-88250631 CAGGAGAAGGAAGAGGATGTTGG + Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
997551882 5:134760414-134760436 TTTGAGAAGTAGTAGGAGGTAGG + Intronic
997668335 5:135649991-135650013 CAGGAGAAGCGGGTGGATGTAGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998391282 5:141788536-141788558 TAGGAGAAAAAGGAGGAGGTGGG - Intergenic
998391894 5:141792535-141792557 CAGGAGAATCACTAGAAGCTGGG + Intergenic
998644002 5:144042332-144042354 GAGGAGAAGCAGCTGGACGTTGG - Intergenic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
1000046210 5:157523986-157524008 CAGGAACAGCAGTTGGAGGAAGG - Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001201392 5:169720821-169720843 CAGGAGAATCAGTTGAAGGTGGG - Intronic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1002192125 5:177483787-177483809 CAGGAGATGCAGGAGAAGTTGGG - Intronic
1002787490 6:414666-414688 CAGGAGCAGAAGGAGGAAGTGGG - Intergenic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1004495156 6:16156116-16156138 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1004524602 6:16394899-16394921 AAGGAGAAACAGTAGCATGTTGG + Intronic
1004536645 6:16509629-16509651 CAAGAGAAGGAGTAGTAGATAGG - Intronic
1004973418 6:20937191-20937213 CAGGAGCTGAAGTAGGAGGATGG - Intronic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1006233123 6:32602535-32602557 GGGGAGAAGGAGTAGGAGCTGGG + Intergenic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006311891 6:33266915-33266937 CAGGAGTAGCAACAGCAGGTGGG - Intronic
1006433155 6:34010583-34010605 CAGCAGGAGGAGTTGGAGGTGGG - Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1008118012 6:47575599-47575621 CAGAAGACACAGTAGTAGGTAGG + Intronic
1008255791 6:49297978-49298000 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1010753101 6:79636467-79636489 CAGAAGAAGCAGGAGTAAGTTGG + Intronic
1011817143 6:91205684-91205706 CAGGAGAAAGGGTGGGAGGTGGG - Intergenic
1012271168 6:97213509-97213531 AAGGAGAAGCAATAGCAGCTGGG + Intronic
1012624968 6:101393766-101393788 GAGGAGCAGCCGGAGGAGGTCGG - Intergenic
1013033821 6:106361109-106361131 AAGGAGGAGGAGGAGGAGGTGGG - Intergenic
1013039616 6:106420774-106420796 CAAGTGAAGCAGTAGGAGTGGGG - Intergenic
1013351928 6:109313605-109313627 GAGGAGAAGAAACAGGAGGTAGG + Intergenic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1013918423 6:115369472-115369494 CAGAAAAAGCATTAGAAGGTTGG + Intergenic
1014168638 6:118253501-118253523 CAGGAAAGGAAGTAAGAGGTGGG + Intronic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1015961845 6:138658352-138658374 CAGGAGCTGGAGTGGGAGGTAGG - Intronic
1016056014 6:139578563-139578585 CAGGTGATGTAGTAGGTGGTGGG + Intergenic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1017127812 6:151081934-151081956 AAGGAGAAGCTGGAGGAGATGGG - Intronic
1017326694 6:153149230-153149252 CAAGAGAGGAAGCAGGAGGTAGG + Intergenic
1017998930 6:159561069-159561091 GAGGAGAAGCAGTTGGACATTGG - Intergenic
1018180434 6:161218228-161218250 CAGGGGAGGCAGTAGGTGGGAGG + Intronic
1018214678 6:161515161-161515183 CAGTAGATGCAGTTGGAGGAAGG - Intronic
1019200361 6:170308779-170308801 AAGAGGAAGAAGTAGGAGGTAGG - Intronic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1020555913 7:9670157-9670179 GAGGAGGAGGAGGAGGAGGTTGG + Intergenic
1021411061 7:20330682-20330704 CAGGAGCAGCAGTAACAGCTCGG - Intronic
1021564996 7:22008202-22008224 CAGGAGAAGCAGCAGTAGACAGG + Intergenic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1023036526 7:36135948-36135970 CAGGAGAGGCAGTGGGTGGCAGG + Intergenic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023412172 7:39899043-39899065 GAGGAGGAGAAGTAGGAGGAGGG - Intergenic
1023820232 7:43976803-43976825 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1024533096 7:50409344-50409366 GAGGAGAAGCAGGAGGAATTAGG + Intergenic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026294172 7:69036604-69036626 CAGGAGGAGGAGAAGCAGGTTGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027216523 7:76187293-76187315 CAGGAGAAGCACTTTGGGGTAGG - Intergenic
1028259896 7:88650158-88650180 CAGGAAAAGCAGTACTAAGTGGG + Intergenic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029160045 7:98545023-98545045 AATGATCAGCAGTAGGAGGTGGG + Intergenic
1029748520 7:102530324-102530346 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1029766467 7:102629408-102629430 CAGGAGAAGGGGTGGGAGGTGGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030546894 7:110907437-110907459 GAGGAGAAGCAGTTGGATGTTGG - Intronic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034603311 7:152285297-152285319 CAGGAGCTGGAGTGGGAGGTAGG + Intronic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035079834 7:156206739-156206761 CAGGAGAAGAATTTAGAGGTGGG - Intergenic
1035184024 7:157111887-157111909 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1035263302 7:157675081-157675103 CAAAAGAAACAGTAGGCGGTGGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037589808 8:20303373-20303395 GAGGTGAAGAAGTGGGAGGTGGG - Intronic
1037683415 8:21117499-21117521 GAGGAGAAGGAGTGAGAGGTGGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038097681 8:24333595-24333617 CATGAGAAACAGCAGCAGGTAGG - Intronic
1039842287 8:41302800-41302822 CAGGAGAAGGAGGAGCTGGTGGG - Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1041080177 8:54208245-54208267 CTGGAGAGGCAGTAGGGGTTAGG + Intergenic
1041326167 8:56667661-56667683 CAGGAGTAGCAGCTGGAGCTGGG - Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042291436 8:67172902-67172924 GAGGAGAAGCAGGAGAATGTAGG + Intronic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042510313 8:69604332-69604354 AAGGAAAAGAAGTAGGAAGTAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1044274680 8:90285838-90285860 AAGGAGAAGCAGCTGGATGTTGG - Intergenic
1044325417 8:90852630-90852652 GAGGAGAAGCGGTGGGATGTTGG + Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1044985527 8:97753315-97753337 GAGAAGAAGAAGGAGGAGGTCGG + Intergenic
1045870790 8:106924639-106924661 CAGGAGAATAAGTTGGAGATAGG - Intergenic
1046324311 8:112620725-112620747 CACAAGATGCAGTAGGAGGCGGG - Intronic
1047090148 8:121565494-121565516 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1047353204 8:124095490-124095512 CCAGAGAAGCAATAGGTGGTAGG + Intronic
1047491994 8:125382699-125382721 TAGGAGGAGCAGTGGGTGGTGGG + Intergenic
1047499372 8:125430123-125430145 GGGGAGAGGGAGTAGGAGGTGGG - Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1050350427 9:4736020-4736042 CAGGAGAAGCACTTGAACGTGGG + Intronic
1050934323 9:11375394-11375416 GAGGAGAAGAAGGAGGTGGTAGG + Intergenic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1052169701 9:25377797-25377819 GAGGAGAAGCAGTTGGATGATGG - Intergenic
1052540453 9:29804801-29804823 GAGGAGAAGCAGATGGATGTGGG - Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1052964505 9:34329580-34329602 CACCCGAAGCAGAAGGAGGTAGG - Exonic
1053103609 9:35391773-35391795 CAAGAGAAGTAGTGTGAGGTGGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053577086 9:39364094-39364116 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053841592 9:42192019-42192041 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054098657 9:60922784-60922806 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054120057 9:61198413-61198435 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054587699 9:66984149-66984171 CAGGATCAGCAGGAGGAGCTGGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056192002 9:84194233-84194255 CAGGACAACCAGTAGCAGGGAGG - Intergenic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057718816 9:97516458-97516480 CATGGGAAGCAGTTGGAGCTTGG + Intronic
1058144132 9:101392156-101392178 CAGCAGAAGCAGTAGTAAGAGGG + Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058593636 9:106591570-106591592 GGGGAGGAGCAGCAGGAGGTGGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060857777 9:126928692-126928714 CAGGAGAATCACTTGGAGCTGGG - Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061263877 9:129494621-129494643 CAGGAGGAGCTGTAGCGGGTTGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062437884 9:136554691-136554713 CAACAGAAGCTGGAGGAGGTGGG + Intergenic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185566605 X:1099730-1099752 CAGGAGAAGGAGTAGGTGAAGGG + Intergenic
1185625338 X:1477094-1477116 CAGGAGAAGCACTTGGACCTGGG + Intronic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1188113373 X:26217044-26217066 CAGGAGAATGAGTAGGAGAACGG - Intronic
1188188345 X:27144414-27144436 GAGGAGAAGCAGCTGGACGTTGG + Intergenic
1188553245 X:31383692-31383714 GAGGAGAAGCAGCTGGATGTTGG + Intronic
1188677434 X:32959642-32959664 CAGTAGAATCAGTAGGTTGTAGG - Intronic
1188980352 X:36721583-36721605 CAGGAGAAGCCATAGTAGGTGGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189083257 X:37995910-37995932 CAGGAGAAGCCATAGTAGGTGGG + Intronic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189785484 X:44555463-44555485 GAGGAGAAGCAGCAGGCGATTGG - Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1190924221 X:54887423-54887445 CAGGAGCAGCAGGTGGTGGTAGG + Intergenic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194360676 X:92946483-92946505 CAGGAAAAGCAGTACTAGGAGGG - Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195067505 X:101250817-101250839 CAGGAGAACCAGCAGGGGCTGGG - Intronic
1195649146 X:107266508-107266530 CAGGAAAAGTAGTAGGGGGAGGG - Intergenic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196679239 X:118453963-118453985 CTGGAGAAGCAGCAGCAGCTGGG + Intergenic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1197752246 X:129973213-129973235 CACGAGGAGCAGTAGGAGCATGG - Intergenic
1198216707 X:134562044-134562066 CAGGTGAAGATGTAGGAGGAGGG - Intergenic
1198485725 X:137085672-137085694 CTGGAGAAACACTAGCAGGTAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199177961 X:144814220-144814242 CAGCAAAAGCAGTAGAAAGTGGG + Intergenic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1200668874 Y:6062298-6062320 CAGGAAAAGCAGTACTAGGAGGG - Intergenic