ID: 1094078575

View in Genome Browser
Species Human (GRCh38)
Location 12:26506433-26506455
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1354
Summary {0: 3, 1: 14, 2: 111, 3: 328, 4: 898}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094078566_1094078575 19 Left 1094078566 12:26506391-26506413 CCCAACTACTAGGAGGCTGAGGT 0: 2
1: 37
2: 512
3: 2500
4: 3564
Right 1094078575 12:26506433-26506455 GGGAAATCAAGGCTGCAGTGAGG 0: 3
1: 14
2: 111
3: 328
4: 898
1094078567_1094078575 18 Left 1094078567 12:26506392-26506414 CCAACTACTAGGAGGCTGAGGTG 0: 2
1: 32
2: 361
3: 965
4: 3113
Right 1094078575 12:26506433-26506455 GGGAAATCAAGGCTGCAGTGAGG 0: 3
1: 14
2: 111
3: 328
4: 898
1094078563_1094078575 27 Left 1094078563 12:26506383-26506405 CCTGTGGTCCCAACTACTAGGAG 0: 1
1: 19
2: 333
3: 3582
4: 25741
Right 1094078575 12:26506433-26506455 GGGAAATCAAGGCTGCAGTGAGG 0: 3
1: 14
2: 111
3: 328
4: 898

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900044690 1:495951-495973 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
900066093 1:730857-730879 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
900066490 1:734265-734287 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
900066887 1:737672-737694 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
900613069 1:3552623-3552645 GGGAGTTCAAGGCTGCAGTACGG + Intronic
901484638 1:9550083-9550105 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
901528562 1:9839577-9839599 AGAAGGTCAAGGCTGCAGTGAGG - Intergenic
901594196 1:10371858-10371880 AGGAGTTCAAGGTTGCAGTGAGG + Intronic
901716291 1:11157301-11157323 GGGAAAGAAAGACTGCTGTGAGG + Intronic
901960665 1:12824034-12824056 AGGAAATTGAGGCTGCAATGAGG + Intergenic
901967261 1:12878644-12878666 CGGAAATTGAGGTTGCAGTGAGG + Intronic
901982662 1:13048908-13048930 AGGAAATTTAGGTTGCAGTGAGG + Intronic
901986360 1:13078432-13078454 AGGAAATTGAGGCTGCAGTGAGG - Intergenic
901995452 1:13148335-13148357 AGGAAATTGAGGCTGCAGTGAGG + Intergenic
901999428 1:13180011-13180033 AGGAAATTTAGGTTGCAGTGAGG - Intergenic
902017908 1:13323142-13323164 AGGAAATTGAGGCTGCAGTGAGG - Intergenic
902028527 1:13403142-13403164 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
902127966 1:14233202-14233224 AGGAAACCGAGGCTGCAGTGAGG - Intergenic
902667591 1:17950509-17950531 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
902920116 1:19660967-19660989 GAGAAATCAAGGCCCCAGGGAGG - Intergenic
902950560 1:19879682-19879704 GGGAGTTTGAGGCTGCAGTGAGG - Intergenic
903091704 1:20925604-20925626 AGGAGTTCGAGGCTGCAGTGAGG - Intronic
903609324 1:24598708-24598730 GGGAAGTGGAGGTTGCAGTGAGG - Intronic
903636496 1:24821624-24821646 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
903704930 1:25278791-25278813 GGCAGACCAAAGCTGCAGTGTGG - Intronic
903722300 1:25414530-25414552 GGCAGACCAAAGCTGCAGTGTGG + Intronic
903879084 1:26496603-26496625 AGGAGATCAAGGCTGCATTGAGG - Intergenic
903927459 1:26840823-26840845 AGGAGTTCAAGGTTGCAGTGAGG - Intronic
904117500 1:28173576-28173598 AGGAGATCGAGGCTGCAGTGAGG + Intronic
904168745 1:28576224-28576246 AGGAGGTCGAGGCTGCAGTGAGG - Intronic
904214005 1:28905124-28905146 GGGAGATGGAGGTTGCAGTGAGG + Intronic
904467330 1:30716087-30716109 AGGACATCAAGGCGGCTGTGCGG - Exonic
904468292 1:30720657-30720679 GGCTAACGAAGGCTGCAGTGGGG + Intronic
904549835 1:31306738-31306760 AGGAGATCAAGGCTGCAGTGAGG - Intronic
904634246 1:31867400-31867422 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
904665120 1:32114911-32114933 GGGAGACAGAGGCTGCAGTGAGG - Intronic
904793467 1:33041109-33041131 AGGAATTCAAGGCTGCAGCCAGG + Intronic
904907615 1:33909864-33909886 GGGAAGTCAAGGCTGCAAGAAGG - Intronic
905163261 1:36056338-36056360 GAGAAATAAAGGCGGTAGTGGGG - Exonic
905396544 1:37670072-37670094 GAGAAGTCAGGGCTGGAGTGAGG - Intergenic
905427802 1:37897861-37897883 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
905631269 1:39520211-39520233 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
905666487 1:39765960-39765982 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
905993491 1:42360333-42360355 AGGAAGTTGAGGCTGCAGTGAGG + Intergenic
906009524 1:42510582-42510604 GGGAAGTGGAGGTTGCAGTGAGG + Intronic
906267319 1:44442585-44442607 GGGAAGTCAAAGCTGCAGTGAGG - Intronic
906623589 1:47306337-47306359 AGGAGTTTAAGGCTGCAGTGAGG - Intronic
906637969 1:47422542-47422564 AGGAGGTCAAGGCTGCAGTGTGG - Intergenic
906712417 1:47940795-47940817 GAGAAATAAAGGCAGCAGTGTGG + Intronic
906830940 1:49031158-49031180 GGGAGGTCAAGGCTGTAGTGAGG - Intronic
907043344 1:51282993-51283015 GGGAAGTGAAGCCTGCACTGAGG - Intergenic
907199733 1:52716190-52716212 GGAAAGTGGAGGCTGCAGTGAGG + Intergenic
907214533 1:52851115-52851137 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
907251689 1:53143762-53143784 GGGAAGTGCAGTCTGCAGTGAGG + Intergenic
907338253 1:53714987-53715009 GGGAGGGCAAGGCTGCAGTGAGG - Intronic
907371647 1:54007513-54007535 GGGAGATTGAGGCTGCAATGAGG - Intronic
907397563 1:54202073-54202095 TGGTGGTCAAGGCTGCAGTGAGG - Intronic
907484228 1:54766010-54766032 GGGAAAAGAAGGCTTCACTGAGG + Intergenic
907731814 1:57073947-57073969 GGGAGGTGAAGGTTGCAGTGAGG - Intronic
907933921 1:59025279-59025301 TGGAGGTCAAGGCTGCAGTGAGG + Intergenic
908285090 1:62588811-62588833 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
908292756 1:62685227-62685249 GGGAAAACGAGGCAGAAGTGTGG + Intronic
908429024 1:64037909-64037931 TGGAGAGCAAGGCTGCAGAGGGG - Intronic
908502006 1:64753124-64753146 GGAAGGTCGAGGCTGCAGTGAGG - Intronic
909616976 1:77621742-77621764 AGGAAATCGAGGCTGCGGTAAGG + Intronic
909767287 1:79372161-79372183 GGGAAATGAAGGATGGAGGGAGG - Intergenic
910196262 1:84642547-84642569 GGGAGAGCAAGGCTGCAGTGAGG + Intergenic
910298004 1:85671379-85671401 AGGCGTTCAAGGCTGCAGTGAGG + Intronic
910447887 1:87317374-87317396 GGGAGATGAAGGCTGCAGTGAGG + Intergenic
910488310 1:87740417-87740439 TGGAAAACAGGTCTGCAGTGAGG - Intergenic
910860330 1:91737202-91737224 AAGAAAGCAAAGCTGCAGTGAGG + Intronic
910971615 1:92861849-92861871 GGGAGGTCGAGGCTACAGTGAGG - Intronic
911007923 1:93247131-93247153 AGGAACTCGAGGCTGCAGTGAGG - Intronic
911521776 1:98938351-98938373 AGGAGTTCAGGGCTGCAGTGAGG + Intronic
911589570 1:99730961-99730983 AGGAGGTCAAGTCTGCAGTGTGG + Intronic
911923146 1:103792806-103792828 GTGAAATCAAGGTTTCAGTTGGG - Intergenic
912169305 1:107078997-107079019 AGGAAGTTGAGGCTGCAGTGAGG + Intergenic
912320820 1:108711189-108711211 GGGAGGTCAAGACTGCAGTGAGG + Intergenic
912477583 1:109949778-109949800 AGGAGGTCGAGGCTGCAGTGAGG - Intergenic
912775842 1:112506077-112506099 AGGAAGTCAAGGCTGCAGTGAGG - Intronic
912847377 1:113087068-113087090 GGGAGGTGAAGGCTGTAGTGAGG + Intronic
912878148 1:113383915-113383937 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
912916109 1:113816402-113816424 GGGAGGTCAAGGCTGCAGAGGGG + Intronic
913003518 1:114605719-114605741 GGGAGGACGAGGCTGCAGTGAGG + Intronic
913111533 1:115661688-115661710 GGGAGGTAGAGGCTGCAGTGAGG - Intronic
913157160 1:116111217-116111239 GGAAAATCAAGGCTGTTTTGAGG + Intergenic
913202554 1:116507007-116507029 AGGAGTTCAAGGCTCCAGTGAGG + Intergenic
914254782 1:145952982-145953004 AGGAAGTCAAGGCTGCAGTGAGG - Intronic
914793409 1:150899360-150899382 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
914853928 1:151336189-151336211 GGGAGTTCAAGACTGCAGAGAGG - Intergenic
914881567 1:151550852-151550874 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
915030321 1:152874380-152874402 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
915174410 1:154003081-154003103 AGGAGTTTAAGGCTGCAGTGAGG - Intronic
915515070 1:156407964-156407986 AGGAGATGAAGGCTGCAGGGAGG + Exonic
916047935 1:161014637-161014659 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
917532571 1:175850066-175850088 GGGAGATTGAGGCTGCAGTGAGG - Intergenic
917950766 1:180032524-180032546 GGGAAATCTAGATTGCAGTATGG - Intronic
918036955 1:180883033-180883055 AGGAGTTCAAGGCTGCAGTAAGG - Intronic
918177949 1:182061570-182061592 GGGAAATGCAGACAGCAGTGTGG + Exonic
918436063 1:184514230-184514252 AGGAATTCAAGGCTGCAGTGAGG + Intronic
918518883 1:185392789-185392811 GGGAGATCAATGCTGCAGTGAGG - Intergenic
918556618 1:185808444-185808466 GGAAAGTTGAGGCTGCAGTGAGG + Intronic
918676270 1:187289966-187289988 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
919107211 1:193168595-193168617 GGGAAATGGAGGGTGCAGTGAGG - Intronic
919729626 1:200904803-200904825 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
919856377 1:201709075-201709097 GGGAAGTTGAGCCTGCAGTGAGG + Intronic
919942901 1:202300580-202300602 AGGAAGTCGAGGCTGCACTGCGG + Intronic
919969415 1:202563985-202564007 GGGAGTTCAAGGCTGCAGTGAGG + Intronic
919985269 1:202669683-202669705 AGGAGGTCAACGCTGCAGTGAGG + Intronic
920056263 1:203194756-203194778 GGGAGGTGGAGGCTGCAGTGAGG - Intergenic
920218115 1:204375872-204375894 GGGAAATAAAGGCACCAGTGGGG - Intronic
920246155 1:204589172-204589194 AGGAGATCGAGGCTGCAGAGAGG - Intergenic
920322283 1:205133436-205133458 CAGAGTTCAAGGCTGCAGTGAGG + Intergenic
920337527 1:205255128-205255150 GGGAGGTCAAGGCTGTAGTGAGG + Intronic
920781975 1:209002300-209002322 GGGGGGGCAAGGCTGCAGTGAGG + Intergenic
920923245 1:210315849-210315871 GGGAGGTTAAGGCTGCGGTGAGG + Intergenic
921197789 1:212776479-212776501 GGGAGGTCAAGACTGCAGTGAGG + Intronic
921233883 1:213103125-213103147 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
921383117 1:214544906-214544928 AGGAAAGGAAGGCTTCAGTGGGG + Intronic
921581492 1:216901438-216901460 GGGAGGTCGAGGCTGCAATGAGG - Intronic
921959820 1:221022867-221022889 GGGAAATGAAGGCTGTGGTAGGG + Intergenic
922124365 1:222708438-222708460 GGGAAGTGGAGGTTGCAGTGAGG - Intronic
922262303 1:223953322-223953344 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
922407810 1:225334794-225334816 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
922733405 1:227966458-227966480 GGGAGGTCAAGGCTGCAGCGAGG - Intergenic
922746764 1:228048635-228048657 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
922981351 1:229829620-229829642 GGGAGATGGAGGTTGCAGTGAGG - Intergenic
922981466 1:229830610-229830632 GGGAGATGGAGGTTGCAGTGAGG - Intergenic
923570351 1:235107928-235107950 AGGACTTCGAGGCTGCAGTGAGG - Intergenic
923689970 1:236182660-236182682 AGGAGCTGAAGGCTGCAGTGAGG + Intronic
923714960 1:236417039-236417061 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
923721874 1:236473710-236473732 GGGAGGTGGAGGCTGCAGTGAGG + Intronic
923839875 1:237658462-237658484 GGTAGTTCCAGGCTGCAGTGAGG - Intronic
924186181 1:241493870-241493892 GGGAGGTCAAGGCTGTAGAGAGG - Intergenic
924231094 1:241962291-241962313 AGGAAGTCAAGGTTACAGTGAGG + Intergenic
924344138 1:243058323-243058345 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
924609785 1:245564145-245564167 GGGACATTGAGGCTTCAGTGTGG - Intronic
924690939 1:246349533-246349555 AGGAGGTCAAGTCTGCAGTGAGG + Intronic
924757821 1:246957706-246957728 AGGAGCTCGAGGCTGCAGTGAGG - Intronic
924805749 1:247360285-247360307 GGGAAATCAAAACTTAAGTGGGG + Intergenic
1062817773 10:513575-513597 GTGAATTGCAGGCTGCAGTGTGG - Intronic
1063132368 10:3189244-3189266 GGGACATGGAGGCTGCAGTGAGG - Intergenic
1063207037 10:3842502-3842524 GGGAAGTGGAGGTTGCAGTGAGG + Intergenic
1063211833 10:3887761-3887783 GGGAGATGGAGGCTGCAGTGAGG + Intergenic
1063394397 10:5673638-5673660 AGGAGTTCAAGGCTGTAGTGTGG - Intergenic
1063408043 10:5814904-5814926 AGGAGATCAAGGCTGCAGTGAGG - Intronic
1063529959 10:6821353-6821375 AGGAATTCAAGGCTGCAGTGAGG + Intergenic
1063980047 10:11445507-11445529 TGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1064097390 10:12434041-12434063 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1064212443 10:13371490-13371512 AGGAGATCAAGGTTGCAGTGAGG + Intergenic
1064493062 10:15880752-15880774 AGCAATTCAAGGCTGTAGTGCGG - Intergenic
1064516981 10:16160938-16160960 GGAAACTCCAGGCTGAAGTGGGG + Intergenic
1064595602 10:16941767-16941789 GGGAGATAGAGGCTGAAGTGAGG + Intronic
1064660664 10:17604776-17604798 TGGACGTCAAGGCAGCAGTGAGG - Intronic
1064778492 10:18806900-18806922 GGGAGCTCAAGGCTGCTGTGAGG - Intergenic
1064971926 10:21074874-21074896 AGGAGTTCAAAGCTGCAGTGAGG - Intronic
1065081647 10:22135366-22135388 GAGAGGTCAAGGCTGCAGAGAGG + Intergenic
1065105510 10:22379865-22379887 AGGAGGTCAAGGCTACAGTGAGG - Intronic
1065224973 10:23534213-23534235 AGGAAGTCATGGCTGCAGTGAGG + Intergenic
1065573849 10:27099485-27099507 AGGAGTTCTAGGCTGCAGTGAGG - Intronic
1065703163 10:28444798-28444820 GGGAGGCAAAGGCTGCAGTGAGG + Intergenic
1065731430 10:28713083-28713105 AGGAGATCAAGGCTGCAGTGAGG - Intergenic
1065784815 10:29203362-29203384 AAGAATTCAAGGCTGCAGTGAGG + Intergenic
1065919461 10:30379641-30379663 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1066353798 10:34662797-34662819 GGGAGACCAATGTTGCAGTGAGG + Intronic
1066363268 10:34751674-34751696 GGGAAGTCGAGGCTGCAGTGAGG - Intronic
1066662181 10:37747632-37747654 GGGAATTGAAGGCTGCAGTGAGG - Intergenic
1066669853 10:37825509-37825531 GGGAAGTTTAGGCTGCAGTGAGG - Intronic
1066732197 10:38446741-38446763 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1068024652 10:51628240-51628262 GGGAGGTCGAGGCTGCAGTGAGG - Intronic
1068190347 10:53643432-53643454 AGGAAGTCAAGGCTGCAGGGAGG + Intergenic
1068553373 10:58430931-58430953 AAGAGATCAAGGCTGCAGTGAGG - Intergenic
1068860046 10:61838794-61838816 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1068897404 10:62222179-62222201 AGAAGTTCAAGGCTGCAGTGAGG - Intronic
1069043723 10:63721372-63721394 AGGAGGTTAAGGCTGCAGTGAGG - Intergenic
1069093000 10:64224091-64224113 TGGGAGTGAAGGCTGCAGTGAGG - Intergenic
1069173133 10:65257537-65257559 TGGAGGTCAAGGCTGCAATGAGG + Intergenic
1069467281 10:68652759-68652781 GGGAGATCAAGGCTGCAGTGAGG - Intronic
1069515980 10:69077628-69077650 GAGAGGTCGAGGCTGCAGTGAGG - Intergenic
1069603705 10:69726501-69726523 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1070046126 10:72838537-72838559 AGGAGGTCAAGGCTGCAATGAGG + Intronic
1070128427 10:73640219-73640241 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
1070188598 10:74090871-74090893 GGGAGTTCAAAGCTGCAGTGAGG - Intronic
1070224384 10:74485387-74485409 AGGATGTCAAGGTTGCAGTGTGG + Intronic
1070256961 10:74821217-74821239 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1070302301 10:75212482-75212504 AGGAGGTCCAGGCTGCAGTGAGG - Intronic
1070416985 10:76200032-76200054 GGGAGGTCAAGGCTGCAGTAAGG - Intronic
1070472405 10:76795847-76795869 AGGAAATCAAGGCAGCAGACGGG + Intergenic
1070876584 10:79818327-79818349 AGGAGTCCAAGGCTGCAGTGAGG - Intergenic
1071229248 10:83565420-83565442 GGGAATTTGAGGCTGCAATGAGG + Intergenic
1071362529 10:84863857-84863879 GGGAAGTGGAGGTTGCAGTGAGG - Intergenic
1071428334 10:85582163-85582185 GGGAAACGAAGGCTGGAGTCTGG + Intergenic
1071536062 10:86431200-86431222 AGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1071681113 10:87706684-87706706 GGGAGTTCAAGGCTGCAGTGAGG + Intronic
1071975129 10:90947957-90947979 AGGAGATCAAGGCTGCAGTGAGG - Intergenic
1071994385 10:91133241-91133263 AGGAGGTCGAGGCTGCAGTGAGG + Intergenic
1072118867 10:92388661-92388683 AGGAGTTCAAAGCTGCAGTGAGG + Intergenic
1072130993 10:92494132-92494154 AGGAGTTCAAGGCTGCAGTAAGG - Intronic
1072176372 10:92926604-92926626 GGGAGTTCAAGGCTACAGTGAGG - Intronic
1072264574 10:93714771-93714793 GGGAGATGGAGGCTGCAGTGAGG + Intergenic
1072352215 10:94567834-94567856 GGGAGGTGAAGGCTGCAGTGAGG + Intronic
1072649265 10:97281326-97281348 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1072675551 10:97463242-97463264 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1073075379 10:100822693-100822715 GGGATTTTAAGGCTTCAGTGGGG + Intronic
1073226232 10:101922313-101922335 AGGAGATCGAGGCTGCAATGAGG - Intronic
1073410843 10:103340667-103340689 GGGAGTTTGAGGCTGCAGTGAGG - Intronic
1073462395 10:103673489-103673511 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1073537057 10:104287123-104287145 AGGAGTTCAAGGTTGCAGTGAGG - Intronic
1073559305 10:104483106-104483128 GGAAGACCAGGGCTGCAGTGGGG + Intergenic
1074081427 10:110170765-110170787 GGGAAATTAAGCCTGATGTGTGG + Intergenic
1074329194 10:112487194-112487216 GGGAGATGGAGGCTGCAGTGAGG - Intronic
1075045538 10:119143406-119143428 GGGAGGTCAAGGCTACAATGGGG - Intronic
1075076471 10:119354472-119354494 GGAAGGTCGAGGCTGCAGTGAGG - Intronic
1075103601 10:119522948-119522970 GGGAGGTCAAGGCTGCAGTGAGG - Intronic
1075879403 10:125837498-125837520 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1076246786 10:128953264-128953286 TGGAAGTTAAGGCTACAGTGAGG - Intergenic
1076572875 10:131444077-131444099 GGTAAATGAAGGCTGCCGGGTGG - Intergenic
1076574137 10:131452844-131452866 GGGAAAGCAAGGCAGCAGGAAGG + Intergenic
1076579667 10:131498876-131498898 GGGACCACTAGGCTGCAGTGTGG - Intergenic
1076971017 11:132426-132448 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1077411978 11:2407914-2407936 TGGAAAGCAAGGGTGCTGTGGGG + Intronic
1077880011 11:6341503-6341525 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1078076400 11:8165849-8165871 TGGAGGTCAAGGCTACAGTGAGG - Intronic
1078144254 11:8712380-8712402 GGGAAGACAGGGCTGCAGCGGGG - Intronic
1078657666 11:13256796-13256818 AGGAGCTCGAGGCTGCAGTGAGG + Intergenic
1079164833 11:18030347-18030369 AGGAATTCTAGGCTGCAGTGAGG + Intronic
1080338660 11:31231030-31231052 TGGAGGTCGAGGCTGCAGTGAGG - Intronic
1080479515 11:32631762-32631784 GGCAGATTGAGGCTGCAGTGAGG + Intronic
1080577952 11:33617066-33617088 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1081975012 11:47228065-47228087 GGGAAGTGGAGGTTGCAGTGAGG + Intronic
1082274472 11:50206878-50206900 GGGAGGTCGAGGCTACAGTGAGG - Intergenic
1082845212 11:57719591-57719613 GGGAGGTCAAGGTTGCAGTAAGG - Intronic
1083018008 11:59476451-59476473 CGGAAGTCCAGGCTGCAGTGAGG - Intergenic
1083521655 11:63319219-63319241 GGGATGTCGAGGCCGCAGTGAGG + Intronic
1083551824 11:63595854-63595876 AGGAAATCAAGGCTGAAGAATGG + Intronic
1083604735 11:63971417-63971439 GGGAGGTCGAGGCTGCAGTGAGG + Intergenic
1083698750 11:64459999-64460021 GGGAGGTTGAGGCTGCAGTGAGG - Intergenic
1083713266 11:64561519-64561541 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1083883952 11:65561803-65561825 GGGAGATGAAGGTTGCAGAGTGG - Intergenic
1083922603 11:65788561-65788583 GGGAAATGAGGGCAGCAGTGAGG + Intronic
1084137512 11:67197244-67197266 AGGAAGTCAAGGCTGCAGGGAGG - Intronic
1084156075 11:67313255-67313277 GGGAATTCAAGGCTGCACTGAGG - Intergenic
1084289229 11:68151217-68151239 GGGAGGTCAAGGCTACAGTGAGG + Intergenic
1084540784 11:69785547-69785569 GGGAAGTTGAGGCTGAAGTGAGG - Intergenic
1085089838 11:73702232-73702254 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1085110502 11:73883587-73883609 GGGAGGTGAAGGCTGCAGTGAGG - Intronic
1085363132 11:75911160-75911182 CTGGAATCAAGGCTGCAGTTTGG - Intronic
1085487686 11:76881180-76881202 GGGAGGTCAATGCTGCAGTGAGG + Intronic
1085842353 11:80027047-80027069 GGCAAATCAAAACTGCAATGAGG + Intergenic
1086039730 11:82461212-82461234 GGGAGATGGAGGCTGCAGTAAGG + Intergenic
1087802337 11:102517868-102517890 AGGAGGTCAGGGCTGCAGTGAGG - Intergenic
1087816101 11:102660928-102660950 GGGAGATTGAGGCTGCAGTGAGG - Intergenic
1088274397 11:108069182-108069204 AGGAGTTCAAGGCTGTAGTGAGG + Intronic
1088583034 11:111333824-111333846 TGGTGATCAAGGATGCAGTGTGG + Intergenic
1088614349 11:111609392-111609414 GGGAGGTGGAGGCTGCAGTGAGG - Intronic
1088763268 11:112952029-112952051 GGGAAATCAAGAGTTCAGTTTGG - Intergenic
1089096517 11:115924294-115924316 GGAAGGTCAAGGCTGCAGTTAGG - Intergenic
1089278935 11:117359015-117359037 GGGAGATAGAGGTTGCAGTGAGG - Intronic
1089469884 11:118712286-118712308 GGGAGGTCTAGGCTGCAGTGAGG - Intergenic
1089482254 11:118815599-118815621 AGGAAGTTGAGGCTGCAGTGAGG - Intergenic
1090239739 11:125173718-125173740 GGGGCAGCGAGGCTGCAGTGTGG + Intronic
1090282294 11:125466403-125466425 TGGAGATGGAGGCTGCAGTGAGG + Intronic
1090592459 11:128287107-128287129 GGGAAATCAGGGATTCACTGAGG - Intergenic
1091138287 11:133212554-133212576 GGGAGATCAAGAGTGCAGCGGGG - Intronic
1091429682 12:423191-423213 GGTAGGTAAAGGCTGCAGTGAGG - Intronic
1091475172 12:765472-765494 GGGAGGTCAGGGCTGCAGTGAGG + Intronic
1091559894 12:1604100-1604122 AGGAGGTCGAGGCTGCAGTGAGG + Intronic
1091571021 12:1686089-1686111 AGGAGATCAAGGCTGCAGTGAGG + Intergenic
1091769568 12:3142229-3142251 GTAAAATAAAGGCTGCAGTGAGG - Intronic
1091993642 12:4976088-4976110 GGGGGTTCAAGGATGCAGTGAGG - Intergenic
1092035142 12:5327904-5327926 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1092168565 12:6358785-6358807 AGGAAATCAAAGCTACAGTGAGG + Intronic
1092233575 12:6791807-6791829 GGGAGACGGAGGCTGCAGTGAGG + Intronic
1092240216 12:6831514-6831536 CGGAACTCCAGGCTGCCGTGGGG - Intronic
1092344515 12:7704351-7704373 AAGAGTTCAAGGCTGCAGTGAGG + Intergenic
1092356239 12:7797724-7797746 GGGAAGTCGAGGCTACAGTGAGG - Exonic
1092449181 12:8585857-8585879 AGGAATTCGAGGCTGCAGTGAGG + Intergenic
1092868170 12:12782592-12782614 AGGAGGTCAAGGCTGCGGTGAGG + Intronic
1093142343 12:15523868-15523890 AGGAGATCCAGGCTGCAGTGAGG - Intronic
1093351491 12:18108129-18108151 TTGAAATCAAGGCATCAGTGGGG - Intronic
1093457521 12:19379455-19379477 GGGAGATGAAGGCTGCAGTGAGG + Intergenic
1093740720 12:22683325-22683347 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1094009622 12:25793582-25793604 TGGAAATGAAGGCTGCAGCTAGG - Intergenic
1094014055 12:25842834-25842856 GGGAAGTGGAGGTTGCAGTGAGG - Intergenic
1094078575 12:26506433-26506455 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1094585939 12:31777417-31777439 AGGAGATTGAGGCTGCAGTGAGG - Intergenic
1094696921 12:32829006-32829028 GGAAAGTTGAGGCTGCAGTGAGG - Intronic
1094751998 12:33420577-33420599 AGGAGCTCAAGGCTGCAGAGAGG + Intronic
1095441851 12:42245902-42245924 GGGAAGTTAGGGCTGCAGTGAGG - Intronic
1095451205 12:42332129-42332151 AGGAGGTCAAGGCTACAGTGAGG + Intronic
1095463217 12:42463645-42463667 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1095905521 12:47373544-47373566 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1096203359 12:49702228-49702250 GGGAGTTCAAAGCTGCAGTGAGG + Intronic
1096244223 12:49975367-49975389 GGGAGATCAAGTCGGCACTGGGG + Intronic
1096285883 12:50299679-50299701 GGCAGGTCCAGGCTGCAGTGAGG + Intergenic
1096734162 12:53639705-53639727 AGGAGGTCAGGGCTGCAGTGAGG - Intronic
1097132354 12:56821810-56821832 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1098249307 12:68552380-68552402 AGGAGTTCAAGGTTGCAGTGAGG + Intergenic
1098383242 12:69891769-69891791 GGGAGGTCAAGGCTGCAATGAGG - Intronic
1098458524 12:70704343-70704365 AGGAGTTCGAGGCTGCAGTGAGG + Intronic
1098723398 12:73930605-73930627 CGGAGTTCAAGGCTGCATTGAGG - Intergenic
1099119360 12:78668728-78668750 GGGAGATTGAGGCTGCAGTGAGG - Intergenic
1099533476 12:83817045-83817067 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1100181784 12:92094020-92094042 AGGAATTTGAGGCTGCAGTGAGG - Intronic
1100275332 12:93066812-93066834 AGGAAGTCAAGACGGCAGTGAGG + Intergenic
1100323179 12:93516607-93516629 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1100647963 12:96551183-96551205 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1101658597 12:106746457-106746479 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1101734665 12:107454010-107454032 GGGAAATCAAGAATGCAGCTGGG + Intronic
1101920574 12:108929392-108929414 GGGAAGTCAAAGCTGCAGTGAGG - Intronic
1102051840 12:109868075-109868097 CGGAGGTCAAAGCTGCAGTGAGG - Intronic
1102118337 12:110420704-110420726 GGGAAGTTGAGGCTACAGTGAGG - Intergenic
1102267691 12:111501962-111501984 GGGAGATGGAGGTTGCAGTGAGG - Intronic
1102304372 12:111793290-111793312 AGGAATTCAAGGCTGAGGTGAGG - Intronic
1102592976 12:113971215-113971237 AGGAGATCAAGGCAGCAGTAAGG - Intergenic
1102700967 12:114839276-114839298 AGGAAGTCAAGGCTGCAGTGAGG - Intergenic
1102825028 12:115941740-115941762 AGGAAGTCAAGGCTGCAGTGAGG + Intergenic
1102900923 12:116636179-116636201 GGGAGGTCAAGGCTGCATTGAGG - Intergenic
1103205826 12:119128166-119128188 GAGCAATCAGGGCTGCAGAGTGG - Intronic
1103525240 12:121563240-121563262 AGGAGGTCAAGTCTGCAGTGAGG + Intronic
1103543608 12:121683669-121683691 AGGAGTTCAAAGCTGCAGTGAGG - Intergenic
1103565688 12:121814305-121814327 GGGGAAGCCAGGCTGCGGTGGGG - Exonic
1103621741 12:122191171-122191193 AGGAAAACAAGGCTGAAGAGGGG + Intronic
1103630904 12:122259968-122259990 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1103872274 12:124100475-124100497 AGGAAGTTGAGGCTGCAGTGAGG - Intronic
1103885214 12:124195328-124195350 GGGGAAACAAGGCTCCACTGTGG - Intronic
1104252177 12:127105477-127105499 GGGAAATCAAGGCTGCAGTGAGG - Intergenic
1104444812 12:128824253-128824275 GGGAAGCTGAGGCTGCAGTGAGG - Intergenic
1104606479 12:130193201-130193223 GGGAAATAGAGGGTGCAGGGCGG + Intergenic
1105055827 12:133098307-133098329 GGGAGGTGGAGGCTGCAGTGAGG - Intronic
1105491029 13:20888421-20888443 GGGAGGTCAAAGTTGCAGTGAGG - Intronic
1105781771 13:23711786-23711808 AGGAATTCGAGGCTTCAGTGAGG + Intergenic
1106510950 13:30412068-30412090 AGGAGGTCGAGGCTGCAGTGAGG + Intergenic
1106622251 13:31381943-31381965 AGAAGGTCAAGGCTGCAGTGAGG + Intergenic
1106961787 13:35007562-35007584 GGGAGGTCAAGCCTACAGTGAGG - Intronic
1107152207 13:37124813-37124835 GGGAAATCGAGGCTGCAGTGAGG + Intergenic
1107537033 13:41345653-41345675 AGGAGGTCAAGGTTGCAGTGAGG - Intronic
1107791794 13:44009739-44009761 TGGAGGTCAAGGTTGCAGTGAGG + Intergenic
1107925844 13:45261051-45261073 GGGAGACGGAGGCTGCAGTGAGG + Intronic
1108087450 13:46808903-46808925 AGGAGGTCAAGGTTGCAGTGAGG - Intergenic
1108182631 13:47855861-47855883 GGGAGGTTGAGGCTGCAGTGAGG - Intergenic
1108606747 13:52046656-52046678 AGGAGGTCGAGGCTGCAGTGAGG + Intronic
1109157219 13:58926020-58926042 AGGAGGTCAAGGCTGCACTGAGG - Intergenic
1109217894 13:59610848-59610870 GGGAGATTGAGGTTGCAGTGAGG - Intergenic
1109295286 13:60523647-60523669 GGGAGGTGGAGGCTGCAGTGAGG - Intronic
1110198217 13:72815736-72815758 AGGACTTCAAGGCTGCAGTGAGG - Intronic
1110286899 13:73760391-73760413 AGGAATTCAAGGCTACAGTGAGG - Intronic
1110351539 13:74513991-74514013 GTGAAAAAAAGGCTGGAGTGAGG + Intergenic
1110708395 13:78622367-78622389 GGGAAATCAAGGCTGCAAGTGGG + Intronic
1111091225 13:83450762-83450784 AGGAATTCAAGGCTGCAGTGAGG - Intergenic
1111413078 13:87902464-87902486 GGGAACTTGAGGTTGCAGTGAGG - Intergenic
1111664394 13:91249036-91249058 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1111693573 13:91594749-91594771 AGGAAGTTGAGGCTGCAGTGAGG - Intronic
1112009647 13:95283440-95283462 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1112319087 13:98390966-98390988 GGGACATCAAGTCTGAAGTCTGG - Intronic
1112539676 13:100296311-100296333 AGGAAGTCGAGGCTGCAGTGAGG - Intronic
1112688996 13:101867787-101867809 GGGAAATGAAGTCTGCGCTGTGG - Intronic
1113036717 13:106057688-106057710 GGGAATTCAAGGCTGCAGTGAGG + Intergenic
1113261686 13:108571990-108572012 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1113882293 13:113634046-113634068 GGGAAATCAAGGTTGAAGGAAGG - Intronic
1114141887 14:19921481-19921503 GGGATATGAAGGCTGCCGTAAGG + Exonic
1114204642 14:20557410-20557432 AGGAAATCAAGACAGCAGTGGGG + Intronic
1114735951 14:25044096-25044118 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1115247070 14:31306408-31306430 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
1115498137 14:34027052-34027074 GGGAAGTGGAGGTTGCAGTGGGG + Intronic
1115577385 14:34724686-34724708 AGGAGAGCGAGGCTGCAGTGAGG - Intergenic
1115625905 14:35191628-35191650 AGGAATTCGAGGCTGCAGTGAGG + Intronic
1115813141 14:37132800-37132822 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
1115991423 14:39154490-39154512 GGGAGTTGGAGGCTGCAGTGAGG - Intronic
1116362129 14:44013244-44013266 GGGAGGCGAAGGCTGCAGTGAGG + Intergenic
1116673802 14:47879168-47879190 GGGAGGTGAAGGTTGCAGTGAGG - Intergenic
1116710724 14:48365043-48365065 AGGAATTGGAGGCTGCAGTGAGG + Intergenic
1117394221 14:55292953-55292975 GGGAGATGGAGGCTGCAGTAAGG - Intronic
1117450152 14:55842174-55842196 AGAAGGTCAAGGCTGCAGTGAGG - Intergenic
1117784985 14:59273990-59274012 GGGAATTGAAGGTTGGAGTGGGG - Intronic
1118205964 14:63723948-63723970 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
1118686885 14:68300276-68300298 GGGAGGCCAAGGCTACAGTGAGG - Intronic
1118777334 14:68980828-68980850 GGGAGGTCGAGGTTGCAGTGAGG + Intergenic
1118825609 14:69377732-69377754 GGGAGATTGAGGCTGCAGTGAGG + Intergenic
1119304124 14:73593409-73593431 CAGAGGTCAAGGCTGCAGTGAGG - Intronic
1119568613 14:75650074-75650096 AGGAAGTTGAGGCTGCAGTGAGG + Exonic
1119619739 14:76123289-76123311 AGGGAGTCAAAGCTGCAGTGCGG + Intergenic
1119623202 14:76148547-76148569 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1119880289 14:78094384-78094406 AGGAGTTCAAGGCTGTAGTGAGG - Intergenic
1120160797 14:81142679-81142701 GGGAGGTCAAAGCTGCAGTGAGG - Intronic
1121370168 14:93349526-93349548 GGGAAATCAAAACTTAAGTGGGG - Intronic
1121716737 14:96081669-96081691 AGGAAATCATGGCTGCAGTGAGG - Intronic
1121738725 14:96236621-96236643 AGGAAGTCAGGACTGCAGTGGGG - Intronic
1121763393 14:96464482-96464504 GGGAGGTCAAGGCTGTGGTGTGG + Intronic
1122199435 14:100113584-100113606 GGGAAATCAAGGAAGGAATGAGG + Intronic
1122204167 14:100140163-100140185 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
1122674603 14:103400820-103400842 AGGAGTTCGAGGCTGCAGTGAGG + Intronic
1123471765 15:20560646-20560668 GGGAGGTCAAGGCTGCAATGAGG - Intergenic
1123587565 15:21773036-21773058 GGGACCTCAGGGATGCAGTGAGG + Intergenic
1123624203 15:22215601-22215623 GGGACCTCAGGGATGCAGTGAGG + Intergenic
1123625331 15:22223328-22223350 GGGGGATGAAGGCTGCATTGCGG - Intergenic
1123646241 15:22439705-22439727 GGGAGGTCAAGGCTGCAATGAGG + Intergenic
1123732067 15:23155637-23155659 GGGAGGTCAAGGCTGCAATGAGG - Intergenic
1123750202 15:23353019-23353041 GGGAGGTCAAGGCTGCAATGAGG - Intergenic
1123812286 15:23940108-23940130 AGGAATTGGAGGCTGCAGTGAGG - Intergenic
1124248494 15:28092426-28092448 GGGAGGACAAGACTGCAGTGAGG - Intronic
1124282572 15:28376935-28376957 GGGAGGTCAAGGCTGCAATGAGG - Intergenic
1124300131 15:28534675-28534697 GGGAGGTCAAGGCTGCAATGAGG + Intergenic
1124849861 15:33325872-33325894 GAGAGATGGAGGCTGCAGTGGGG - Intronic
1125490557 15:40145470-40145492 AGGAAGTCGAAGCTGCAGTGAGG + Intergenic
1125498535 15:40221437-40221459 GGGAAATCAAGGCTATAGCCTGG - Intergenic
1125693260 15:41614090-41614112 AGGAGATTCAGGCTGCAGTGAGG - Intergenic
1125801767 15:42454824-42454846 AGGAAGTTGAGGCTGCAGTGAGG + Intronic
1125814120 15:42569377-42569399 GAGAGGTCAAGGCTGCAGTGAGG - Exonic
1126028933 15:44477154-44477176 AGGAGACAAAGGCTGCAGTGAGG + Intronic
1126076505 15:44916365-44916387 TTGAGACCAAGGCTGCAGTGAGG - Intergenic
1126082392 15:44977023-44977045 TTGAGACCAAGGCTGCAGTGAGG + Intronic
1126580083 15:50234684-50234706 GGCAAATCAAGGCTGCAGTGAGG + Intronic
1126599568 15:50415325-50415347 AAGAGTTCAAGGCTGCAGTGAGG + Intergenic
1126600628 15:50424140-50424162 CGGAAATGCAGGGTGCAGTGCGG + Intergenic
1126820804 15:52501524-52501546 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1126830306 15:52596039-52596061 AGGAGATCCAGGCTGCAGTGAGG + Intronic
1126834248 15:52643362-52643384 AGGAGTTCAGGGCTGCAGTGAGG - Intronic
1126949695 15:53867901-53867923 GGGAGATCCAGGCTGCAGTGAGG - Intergenic
1127125797 15:55810835-55810857 AGGAATTCAATGCTTCAGTGAGG - Intergenic
1127386316 15:58470003-58470025 GGGAGGTCAAGACTGCAGTGAGG - Intronic
1127422031 15:58815750-58815772 GGGAGATGGAGGTTGCAGTGAGG - Intronic
1127430944 15:58907546-58907568 AGGAGGTCAAGGCTGCAGTCAGG + Intronic
1127778223 15:62286507-62286529 AGGAGACCAAGGCTGCACTGAGG - Intergenic
1127878692 15:63136112-63136134 GGGAGTTCAAGGCTGCAGTGAGG - Intronic
1127908120 15:63392302-63392324 AGGAGATCAAGGCTGCGGTGAGG - Intergenic
1127984130 15:64055477-64055499 GGGAGGTCAAGACTGCAGTGAGG + Intronic
1128466087 15:67913310-67913332 AGGAGTTCAAGGCTGCAGGGAGG + Intergenic
1128641547 15:69341869-69341891 AGGAGGTCAAGTCTGCAGTGAGG + Intronic
1128939174 15:71773126-71773148 AAGAGGTCAAGGCTGCAGTGAGG + Intronic
1129035190 15:72644809-72644831 AGGAGGTCCAGGCTGCAGTGAGG + Intergenic
1129214694 15:74092407-74092429 AGGAGGTCCAGGCTGCAGTGAGG - Intergenic
1129416280 15:75383494-75383516 GGGAGGTCGAGGCTGCAGTGAGG - Intronic
1129558561 15:76540327-76540349 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1130961292 15:88660141-88660163 GGGACCTCAAGGCTGGAGAGGGG - Intergenic
1131105051 15:89728006-89728028 AGGAGATGGAGGCTGCAGTGAGG + Intronic
1131160012 15:90099538-90099560 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1131277806 15:90996640-90996662 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1131788066 15:95934440-95934462 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1131868313 15:96735075-96735097 AGGAAATCAAGGAGGCATTGAGG + Intergenic
1131871136 15:96765784-96765806 GTGAGTTCAAGGCTGCAGTGAGG - Intergenic
1131885589 15:96908286-96908308 GGGAGAGTAAGGCTGCAGAGAGG - Intergenic
1131958175 15:97760279-97760301 GGAAAAACTGGGCTGCAGTGAGG - Intergenic
1131985399 15:98038649-98038671 GGGAATTCAAGGTTACAGTAAGG - Intergenic
1132014893 15:98306875-98306897 GGGAGGTTGAGGCTGCAGTGAGG - Intergenic
1132080846 15:98864180-98864202 AGGAGGTCAAAGCTGCAGTGAGG + Intronic
1133342055 16:5043130-5043152 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1133626637 16:7576004-7576026 AGGAGATCAAGGCTGCAGTGAGG - Intronic
1133726220 16:8539888-8539910 GGGAGGTGGAGGCTGCAGTGAGG - Intergenic
1133785418 16:8969420-8969442 GGGAGATAGAGGTTGCAGTGAGG + Intergenic
1133789367 16:8997671-8997693 GGGAAGCGGAGGCTGCAGTGAGG - Intergenic
1133983268 16:10649504-10649526 GGAAGGTCGAGGCTGCAGTGAGG - Intronic
1134109530 16:11506602-11506624 GAGGAAGCAAGGGTGCAGTGGGG - Intronic
1134440085 16:14294260-14294282 GGGAAGTCAAAACTGCAGTGAGG + Intergenic
1134455495 16:14392272-14392294 GGGAGCTCGAGGCTGTAGTGAGG - Intergenic
1134588305 16:15431720-15431742 GGGAGGTCGAGGCTACAGTGAGG - Intronic
1134762284 16:16724892-16724914 AGGAGTTCAAGGCTGCAGTATGG - Intergenic
1134877120 16:17710713-17710735 GGGAAGTCGAGGCTGCAGTGAGG + Intergenic
1134894071 16:17869079-17869101 AGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1134983775 16:18634278-18634300 AGGAGTTCAAGGCTGCAGTATGG + Intergenic
1135044417 16:19143073-19143095 AGGAAGTCAAGGCTGCATTGAGG + Intronic
1135256142 16:20942994-20943016 AGGAGGTCGAGGCTGCAGTGAGG - Intronic
1135528809 16:23234788-23234810 AGGAGATGGAGGCTGCAGTGAGG + Intergenic
1135727848 16:24870705-24870727 GGGAGACAGAGGCTGCAGTGAGG + Intronic
1135907833 16:26529691-26529713 GGGAAGTTGAGGCTGCAGTCAGG - Intergenic
1136042876 16:27594185-27594207 AGGAAGCCAAGTCTGCAGTGAGG + Intronic
1136126399 16:28185285-28185307 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1136132813 16:28234654-28234676 GGAAGGTCAAGACTGCAGTGTGG - Intergenic
1136176596 16:28521372-28521394 GGGAGGTGGAGGCTGCAGTGAGG + Intergenic
1136249011 16:28991501-28991523 AGGAGTTCAAGGCTGCACTGAGG - Intergenic
1136556970 16:31012691-31012713 AGGAGGTCAAGGCTGCTGTGAGG - Intergenic
1136928651 16:34398350-34398372 AGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1136975923 16:35013454-35013476 AGGAGGTCGAGGCTGCAGTGAGG + Intergenic
1137240577 16:46652279-46652301 TGGAATTCAAGTCTGGAGTGGGG - Intergenic
1137395992 16:48116570-48116592 GGTGAACCAGGGCTGCAGTGTGG + Intronic
1137544933 16:49396167-49396189 GTGAGATAGAGGCTGCAGTGAGG + Intronic
1137691220 16:50429396-50429418 GGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1138131735 16:54485604-54485626 AGGAGTTCAAGGCTGCAATGAGG + Intergenic
1138263777 16:55644781-55644803 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1138695975 16:58813937-58813959 GGGAGGTCAAGGCTGCAGTGTGG - Intergenic
1139164083 16:64545641-64545663 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1139616729 16:68099879-68099901 AAGAGTTCAAGGCTGCAGTGAGG - Intronic
1139747449 16:69086239-69086261 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1139790120 16:69427161-69427183 GGGAGGTGGAGGCTGCAGTGAGG + Intronic
1140082785 16:71765252-71765274 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1140101258 16:71919454-71919476 AGGAAGCCGAGGCTGCAGTGAGG - Intronic
1140225250 16:73071570-73071592 GGGAAAGCCAGGATGCAGAGAGG + Intergenic
1140244165 16:73233133-73233155 GGCAAATCAAGTCTGCAGCTCGG + Intergenic
1140500109 16:75426601-75426623 AGGAAGTAAAGGTTGCAGTGAGG + Intronic
1140531208 16:75668091-75668113 GTGAAAACTAGACTGCAGTGAGG - Intronic
1140698170 16:77555872-77555894 GGGGAAACACGGCTGCACTGCGG - Intergenic
1140822721 16:78678301-78678323 AGGAGGTCAAGGCTGCAGTAGGG + Intronic
1140986278 16:80160821-80160843 GAGAAAAAAAGGCTGCAGAGGGG - Intergenic
1141060302 16:80860856-80860878 GGGAGTTCAAGGTTGCAATGAGG + Intergenic
1141090353 16:81126046-81126068 GGGAGGTGGAGGCTGCAGTGAGG - Intergenic
1141165223 16:81655783-81655805 GGGTAATAGGGGCTGCAGTGAGG - Intronic
1141176553 16:81724033-81724055 AGGAGTTCAAGGCTGCAATGAGG - Intergenic
1141433624 16:83984656-83984678 GGGAAGTCGAGGCTGCAGTGAGG + Intronic
1141489204 16:84360597-84360619 GGGAAACCGTGGGTGCAGTGGGG + Intergenic
1141544477 16:84755561-84755583 AGGAGGTCGAGGCTGCAGTGAGG + Intronic
1141573015 16:84945936-84945958 AGGAAATCAAGGCTGCAGTGAGG - Intergenic
1142404241 16:89878205-89878227 AGGAGGTCGAGGCTGCAGTGAGG + Intronic
1142449236 16:90165092-90165114 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1142457859 17:66789-66811 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1142458254 17:70209-70231 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1142543994 17:685965-685987 GGGTCATCCAGGCTGGAGTGTGG - Intronic
1142719751 17:1768127-1768149 AGGAGATTAAGACTGCAGTGAGG + Intronic
1142824961 17:2504626-2504648 GGGAGATTGAGGCTGCAGTGAGG - Intronic
1142923987 17:3216498-3216520 GGGACATGAAGGCTGCCCTGCGG + Exonic
1143062873 17:4217755-4217777 GGGAGTTCGAGGCTTCAGTGAGG - Intronic
1143183109 17:4996302-4996324 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1143255539 17:5554947-5554969 GGGAGGCCAAGGTTGCAGTGAGG + Intronic
1143469466 17:7163099-7163121 GGGAATTCAAGGGTGCAATGAGG - Intergenic
1143560903 17:7694314-7694336 GGGAAACAGAGGTTGCAGTGAGG - Intronic
1143715029 17:8761011-8761033 GGGAGGCGAAGGCTGCAGTGAGG + Intergenic
1143737645 17:8924149-8924171 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1144611992 17:16728118-16728140 TGGAGTTCAAGGCTGCAGGGAGG - Intronic
1144804057 17:17952461-17952483 GGAAGGTCGAGGCTGCAGTGAGG - Intronic
1144958205 17:19030291-19030313 GGAAAAACAAGGCTGGGGTGGGG + Intronic
1144976953 17:19144233-19144255 GGAAAAACAAGGCTGGGGTGGGG - Intronic
1145073821 17:19834835-19834857 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1145131711 17:20358474-20358496 TGGAGTTCAAGGCTGCAGGGAGG - Intergenic
1146010477 17:29190502-29190524 GGGAGGTCAAACCTGCAGTGAGG + Intergenic
1146060748 17:29605538-29605560 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
1146167182 17:30599668-30599690 AGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1146230519 17:31103946-31103968 AGGAAATTAAGGCTGCAGTGAGG + Intronic
1146236032 17:31163505-31163527 GGGAGGTCAAAGCTGCTGTGAGG - Intronic
1146821974 17:35990726-35990748 GAGAGGTCAAGGCTGCAGTGAGG - Intronic
1146833576 17:36091422-36091444 GGGAAATCAAGACTTCATTTTGG - Intergenic
1146848162 17:36198271-36198293 GGGAAATCAAGACTTCATTTTGG - Intronic
1146969494 17:37061319-37061341 AGGAGGTCAAAGCTGCAGTGAGG - Intergenic
1147174111 17:38641321-38641343 AGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1147236997 17:39065472-39065494 GGGAGGTTGAGGCTGCAGTGGGG - Exonic
1147803958 17:43116436-43116458 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1148141016 17:45328686-45328708 AGGAAGTTGAGGCTGCAGTGAGG - Intergenic
1148196771 17:45719701-45719723 CAGAAATCAAGGCTGCAGGGAGG + Intergenic
1148244813 17:46023766-46023788 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1148287699 17:46410347-46410369 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1148309868 17:46627927-46627949 GGGAAGTTGAGGCTGCAGTGAGG + Intronic
1148452350 17:47787833-47787855 GGGAAGTCAAGGCTGCCATAAGG + Intergenic
1148587108 17:48788725-48788747 AGGAAATCAAGACTGCAGAAAGG - Intronic
1148718778 17:49735315-49735337 GGGAAGCGGAGGCTGCAGTGAGG + Intronic
1148781209 17:50123166-50123188 GGCAAATTAAGGCTGCCCTGGGG - Intronic
1148848629 17:50543331-50543353 GGGAAACCAAGGGTGGGGTGAGG + Exonic
1148968961 17:51462631-51462653 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1149377068 17:56054811-56054833 GGGAGGTTGAGGCTGCAGTGAGG + Intergenic
1149751583 17:59150667-59150689 GGGAGTACAAGGCTGCAGTGAGG + Intronic
1149862183 17:60128243-60128265 AGGAGGTCGAGGCTGCAGTGAGG + Intergenic
1149926480 17:60706885-60706907 GGGAGGTCAAGGATGCAGTATGG - Intronic
1150053330 17:61987822-61987844 GAGAGGTCAAGGCTACAGTGAGG - Intronic
1150139649 17:62717223-62717245 GGACAGTCAGGGCTGCAGTGAGG + Intronic
1150348044 17:64419887-64419909 CGGAGCTCAAGGCTGTAGTGAGG - Intergenic
1150648417 17:66994252-66994274 AGGAATTTGAGGCTGCAGTGAGG + Intronic
1150740341 17:67774432-67774454 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1151211613 17:72548625-72548647 GGAAGGTCGAGGCTGCAGTGAGG + Intergenic
1151301442 17:73230221-73230243 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
1151535330 17:74736138-74736160 GGGAAGCAAAGGTTGCAGTGAGG + Intronic
1151643241 17:75411855-75411877 GGGAGATGGAGGCTACAGTGAGG + Intergenic
1151782441 17:76256307-76256329 GGGAGGTCCAGGCTGCAGTGAGG + Intergenic
1151825435 17:76521351-76521373 AGGGACTTAAGGCTGCAGTGGGG + Intergenic
1151851394 17:76692324-76692346 GGGAGGTGGAGGCTGCAGTGAGG - Intronic
1152317176 17:79587907-79587929 AGGAGTTCAAGGTTGCAGTGAGG - Intergenic
1152582925 17:81176215-81176237 TGGAAATCAAAGCCACAGTGAGG + Intergenic
1153027461 18:684454-684476 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1153786814 18:8543046-8543068 GGAAGGTCAAGGCTGCAATGAGG + Intergenic
1153884292 18:9449505-9449527 AGGAGATCAAGACTTCAGTGAGG - Intergenic
1154227793 18:12523754-12523776 GGGAGGTCAAGGCTGCCATGTGG - Intronic
1154271838 18:12926855-12926877 AGGAAAACAAAGCTGCAGTTTGG + Intronic
1154273506 18:12939966-12939988 GGGAAATCAAGGTCGCCTTGAGG - Intergenic
1154338527 18:13484534-13484556 GGAGCATCGAGGCTGCAGTGAGG + Intronic
1154994670 18:21628305-21628327 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1155003866 18:21710675-21710697 AGGAGTTCAAGACTGCAGTGAGG + Intronic
1155136338 18:22996923-22996945 AGGAATTCGAGGCTGCAGTGAGG + Intronic
1155358949 18:24981192-24981214 GGGAGATCGAGGCTGAAATGTGG - Intergenic
1155955174 18:31950823-31950845 AGGAGTTCAAGGCTACAGTGAGG + Intronic
1155958314 18:31972818-31972840 AGGAAGTCGAGGCTGCAGTGAGG + Intergenic
1156184966 18:34651991-34652013 GGGGGGTCAAGGCTGCAGTGAGG + Intronic
1156228791 18:35134188-35134210 GGGAAACTAAGGCAGCAGAGAGG + Intronic
1156240465 18:35248767-35248789 TGGAAGTCGAGGCTTCAGTGAGG + Exonic
1156816492 18:41317423-41317445 GGGAGGTTGAGGCTGCAGTGAGG + Intergenic
1156903822 18:42331434-42331456 GGGAGTTCAAGGCTGCATTGAGG + Intergenic
1157116141 18:44864380-44864402 GGGAGATGAAGGATGCTGTGGGG - Intronic
1157119393 18:44895039-44895061 AGGAATTCAAGGTTGCAGTGAGG + Intronic
1157137735 18:45073517-45073539 GTGAAATGCAGTCTGCAGTGAGG - Intergenic
1157298475 18:46462577-46462599 GGGAAAGCAAGGCTCCAGGCTGG - Exonic
1157401884 18:47395574-47395596 TGGCAATCCAGGCTGCAGTGAGG + Intergenic
1157740366 18:50087498-50087520 GGGAAGTGGAGGTTGCAGTGAGG + Intronic
1158363502 18:56704464-56704486 TGGAGTTCAAGGCTGCAGTGAGG + Intronic
1158503347 18:58023301-58023323 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1158611059 18:58941533-58941555 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1158806800 18:60983471-60983493 TGAAAATTCAGGCTGCAGTGAGG + Intergenic
1158872119 18:61698471-61698493 AGGAATTCAAGGTTACAGTGAGG - Intergenic
1158987854 18:62837052-62837074 GGGAGGTCAAGGCTATAGTGTGG - Intronic
1159262456 18:66032194-66032216 AGGAATCCAAGGCTGCAGTAAGG - Intergenic
1160123079 18:76147654-76147676 GGGAAATGAAGTCTCCTGTGTGG + Intergenic
1160647971 19:202715-202737 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1160997280 19:1888619-1888641 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1161130001 19:2582553-2582575 AGGAAGTCCAAGCTGCAGTGAGG - Intronic
1161130262 19:2584522-2584544 AAGAGGTCAAGGCTGCAGTGAGG + Intronic
1161176400 19:2844875-2844897 GTGAAATCATTACTGCAGTGTGG - Intronic
1161401038 19:4066353-4066375 GGGGAAGCAGGGCTGCATTGAGG - Intronic
1161437147 19:4270457-4270479 GGGAGATTGAGGCTGCAGTGAGG + Intergenic
1161602650 19:5194048-5194070 AGGAGATGGAGGCTGCAGTGAGG + Intronic
1161617236 19:5278289-5278311 GGGAGATTGAGGCTGCAGTGAGG - Intronic
1161805184 19:6439314-6439336 AGGAATTCGAGGCTGCAGTCAGG + Intronic
1161820099 19:6525225-6525247 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1162153035 19:8658875-8658897 AGGAGGTCGAGGCTGCAGTGAGG + Intergenic
1162203077 19:9035337-9035359 GTGAAATTTAAGCTGCAGTGAGG - Intergenic
1162244826 19:9391111-9391133 CAGAAGTCAAGGCTGCAGTGAGG + Intergenic
1162324514 19:9991167-9991189 GGGAAGTCAAGGCTGCAGTGAGG + Intronic
1162377622 19:10314493-10314515 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1162431015 19:10628477-10628499 GGGAGGCCAAGGCTGCAGTAAGG + Intronic
1162450335 19:10750404-10750426 GGGAGTTCAAGGCTGCAGTGAGG + Intronic
1162499891 19:11046873-11046895 AAGAAGTCAAGGCCGCAGTGGGG + Intronic
1162514829 19:11141757-11141779 ATGAATTCGAGGCTGCAGTGAGG + Intronic
1162532769 19:11245447-11245469 GGGTAATCAGGGCTGTTGTGGGG - Intronic
1162539808 19:11288034-11288056 GGGAAGTCGAGGCTGCAGTGAGG - Intergenic
1162732968 19:12729963-12729985 AGGAAGTGGAGGCTGCAGTGAGG + Intergenic
1163049545 19:14671857-14671879 AGGAGTTCAAGGCTACAGTGAGG - Intronic
1163112150 19:15168008-15168030 AGGAAGTTGAGGCTGCAGTGAGG - Intronic
1163556233 19:17994372-17994394 AGGAGGTCAAGGCTGCTGTGAGG + Intronic
1163596260 19:18222770-18222792 AGGAGATTGAGGCTGCAGTGAGG - Intronic
1163690972 19:18738242-18738264 GGGAAGCCAAGGCTGCAGTGAGG + Intronic
1163952151 19:20598777-20598799 GGGAAGTGGAGGTTGCAGTGAGG - Intronic
1165171189 19:33892763-33892785 AGGAGTTCAAGGCTACAGTGAGG - Intergenic
1165361959 19:35342240-35342262 AGGAATTGGAGGCTGCAGTGAGG - Intronic
1165376760 19:35448533-35448555 AGGAAATCAAGGCTGGAGAGTGG + Intronic
1165404039 19:35619193-35619215 AGGAGTTCAAGGCTGAAGTGAGG + Intronic
1165475904 19:36030688-36030710 GGGCCTTCAAGGCTACAGTGAGG - Intronic
1165873356 19:38988814-38988836 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1166063549 19:40342824-40342846 GGGAAAGCAAGGAGCCAGTGTGG + Intronic
1166170373 19:41024197-41024219 GGGAAATCAGGCTGGCAGTGGGG - Intergenic
1166184195 19:41128736-41128758 GGGAGGTCGAGGCTGCAATGGGG + Intergenic
1166200349 19:41233555-41233577 TGGCAGTCAAGGCTACAGTGAGG + Intronic
1166273801 19:41736897-41736919 TGAAGGTCAAGGCTGCAGTGAGG - Intronic
1166390361 19:42405885-42405907 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1166392513 19:42417330-42417352 AGAAGTTCAAGGCTGCAGTGAGG - Intronic
1166600659 19:44091803-44091825 GGGAGGTCAAGGCTGCAGTGGGG + Intergenic
1166661234 19:44648557-44648579 AGGAGTTCCAGGCTGCAGTGAGG - Intronic
1166699249 19:44872695-44872717 GGGAAGTCAAGGCAGAAGTATGG - Intronic
1166730440 19:45056369-45056391 GGGAACACAAGGGTGCGGTGGGG - Intronic
1166796243 19:45428154-45428176 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
1166874958 19:45891360-45891382 GGGAAATCAAGGCAGCATCGAGG - Intronic
1166940580 19:46361690-46361712 GGGAGGTGGAGGCTGCAGTGAGG + Intronic
1167009702 19:46799078-46799100 AGGAGATCGAGGCTGCAGTGAGG + Intergenic
1167020669 19:46873025-46873047 GGGAAACCGAGGTTGCAGAGAGG + Intergenic
1167053146 19:47092130-47092152 GGGAGCTCGAGGCTGCAGTGAGG + Intronic
1167129645 19:47575884-47575906 AGGAAGTCAAGGATGCAGCGAGG - Intergenic
1167338799 19:48903013-48903035 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1167702391 19:51057538-51057560 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1168044499 19:53784633-53784655 ATGAGTTCAAGGCTGCAGTGAGG - Intergenic
1168234342 19:55052563-55052585 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
1168269837 19:55243591-55243613 GGGGGGTCAAGGCTACAGTGAGG + Intronic
1168417942 19:56181222-56181244 GGGAGATCAAGGTTGCAGCCAGG - Intronic
1168725594 19:58580062-58580084 GGGAAGTGGAGGTTGCAGTGAGG - Intergenic
926047991 2:9724297-9724319 GGGAAATGCAGGATGCAGTGGGG - Intergenic
926753527 2:16218436-16218458 AGGAGTTCGAGGCTGCAGTGAGG + Intergenic
927146299 2:20168667-20168689 AGGAAATTCAGGCTGGAGTGTGG + Intergenic
927233768 2:20850889-20850911 GGGAGGTCAAGGCTGCCATGAGG + Intergenic
927545458 2:23949011-23949033 GGGAGATGGAGGTTGCAGTGAGG - Intronic
927762985 2:25777159-25777181 CGGAGGTCAAGGCTGCAGTGGGG - Intronic
927862512 2:26568946-26568968 GGGAGATGGAGGTTGCAGTGAGG + Intronic
927983484 2:27390581-27390603 GGGAAATGAAGTCTGCAGAATGG - Intronic
927986901 2:27417947-27417969 GGGAGGTTGAGGCTGCAGTGAGG + Intergenic
928016832 2:27664982-27665004 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
928117348 2:28555939-28555961 GGGAGATCAAGGCTGCAGTGAGG - Intronic
928344689 2:30480678-30480700 TGGAGTTCAAGGCTGCAGTGAGG + Intronic
928466665 2:31528691-31528713 GGGAGGTGAAGGCTGCAGTGAGG + Intronic
929188040 2:39115485-39115507 GAGAGGTCAAGGCTGCAGTGAGG - Intronic
929299549 2:40287673-40287695 GGGCCATGAAGGCTGGAGTGAGG + Intronic
929338721 2:40785695-40785717 AGGAGTTCAAGGATGCAGTGAGG - Intergenic
929366506 2:41164217-41164239 AGGAGCTCAAGGTTGCAGTGAGG - Intergenic
929645582 2:43623913-43623935 GGGAATTCAAGGAAGAAGTGAGG + Intergenic
929645836 2:43626447-43626469 AAGAGGTCAAGGCTGCAGTGAGG + Intergenic
929665269 2:43828890-43828912 GGGAGGCCAAGGTTGCAGTGAGG + Intronic
929697902 2:44134956-44134978 AGGAGTTCGAGGCTGCAGTGAGG - Intergenic
929719866 2:44356875-44356897 GGGAGGTCGAGGCTGCAGTGAGG - Intronic
929808455 2:45169172-45169194 GGGAAACCATGGCAGCATTGCGG + Intergenic
930031387 2:47060083-47060105 AAGAGGTCAAGGCTGCAGTGAGG + Intronic
930058322 2:47268966-47268988 AGGAGGTCAAGGCTGCAATGAGG + Intergenic
930103808 2:47623731-47623753 TGCAAATCAAAGCTACAGTGAGG - Intergenic
930109830 2:47668937-47668959 AGGAGGTCAAGGCTGCAATGAGG + Intergenic
930345841 2:50180092-50180114 AGGAGTTCAAGGCTACAGTGAGG - Intronic
930619207 2:53626590-53626612 AGGAGTTCAAGGCTACAGTGAGG + Intronic
930909324 2:56611558-56611580 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
931305418 2:61023866-61023888 GGGAGATGGAAGCTGCAGTGAGG - Intronic
931595755 2:63941295-63941317 AGCAGGTCAAGGCTGCAGTGAGG - Intronic
931724453 2:65095420-65095442 AGGACTTCAAGGCTGCAGTGAGG - Intronic
931846995 2:66214288-66214310 GGGAGTTCGAGGCTGCAGTGAGG - Intergenic
932469195 2:71942890-71942912 GAGACATCAAGGCTGAGGTGAGG + Intergenic
932580948 2:72992427-72992449 TGGATATTCAGGCTGCAGTGGGG - Intronic
932696730 2:73963157-73963179 GGGAAATCTAAGCTGCGGGGTGG + Intergenic
933211036 2:79568959-79568981 AGGAAGTAAAGGTTGCAGTGAGG + Intronic
933668340 2:84983397-84983419 GGGAGGTCAAGGCTGCAGTGAGG - Intronic
933768317 2:85726394-85726416 GGGAGATTGAGGCTGCAGTGAGG + Intergenic
933870976 2:86565046-86565068 GGGAGGTAGAGGCTGCAGTGAGG - Intronic
934611913 2:95745373-95745395 AGGATGTCAAGGCTGCAGTGAGG + Intergenic
934726347 2:96622347-96622369 AGGATATCAAGGCTGTAGTGAGG + Intronic
934763020 2:96866633-96866655 GGCAAATCCAGGCTGCTGGGAGG + Intronic
935258699 2:101335861-101335883 GGGAAGTCAAGGCTGCAGTGAGG + Intergenic
935293715 2:101630451-101630473 GGGAATTCCAGGCTGACGTGGGG + Intergenic
935308149 2:101757950-101757972 GGGAGATGGAGGTTGCAGTGAGG + Intronic
935709974 2:105889654-105889676 GGGAGGTCAAGGCAACAGTGAGG - Intronic
935872169 2:107462864-107462886 AGGAGTTCCAGGCTGCAGTGAGG - Intergenic
936584041 2:113736370-113736392 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
937100234 2:119263027-119263049 GGGAAAAAAAGGCTGGAGTGAGG - Intronic
937193104 2:120123728-120123750 GGGAGGTGGAGGCTGCAGTGAGG - Intronic
937516867 2:122665309-122665331 GAGAGATCGAGGCTGCAGTGAGG - Intergenic
937629480 2:124084337-124084359 AGGAAGTCCAGGCTGAAGTGAGG - Intronic
937667893 2:124507384-124507406 GGGAGGCCGAGGCTGCAGTGAGG + Intronic
937860580 2:126705402-126705424 AGGAGTCCAAGGCTGCAGTGAGG - Intergenic
938184739 2:129220248-129220270 TGCAAATCAAAGCTCCAGTGAGG + Intergenic
938380406 2:130833211-130833233 GGGAAATGGAGGTGGCAGTGAGG + Intergenic
938411555 2:131068941-131068963 GAAAAGTCGAGGCTGCAGTGAGG + Intronic
938879261 2:135568126-135568148 GGGAAGTTGAGGCTGCAGTGAGG - Intronic
939153994 2:138502350-138502372 GGGAAATCAAGGAGGGATTGGGG - Intronic
939157945 2:138547036-138547058 GGGAGGTGGAGGCTGCAGTGAGG - Intronic
939391703 2:141576679-141576701 AGGAAATCAAGGCTGCAGTGAGG + Intronic
939514532 2:143150029-143150051 GCGAAATCAAGGATGCTGGGGGG + Intronic
939929481 2:148215592-148215614 TGGAGTTCCAGGCTGCAGTGAGG - Intronic
940128200 2:150351719-150351741 GGGAGTTCGAGGCTGCAGTGAGG - Intergenic
940381035 2:153015153-153015175 AGGAGGTCAAGGCTGAAGTGAGG - Intergenic
940671146 2:156669763-156669785 TGGAGTTCAAGGCTGCAGTGAGG - Intergenic
940977723 2:159964952-159964974 GGGAGATAAAGGTTGCAGTGAGG + Intronic
941149280 2:161893625-161893647 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
941539110 2:166760499-166760521 GGGAGATCAAGGCTGCAGTGAGG - Intergenic
941616681 2:167728312-167728334 GGGAGGTGAAGGTTGCAGTGAGG + Intergenic
941718028 2:168784148-168784170 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
941772325 2:169358528-169358550 GTGAAATTAAAGCAGCAGTGAGG + Intronic
942050846 2:172139406-172139428 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
942109845 2:172670123-172670145 GGGAGGTGAAGGCTGCGGTGAGG - Intergenic
942398670 2:175578507-175578529 GGGAGGTGGAGGCTGCAGTGAGG - Intergenic
942657763 2:178231717-178231739 AGGTGTTCAAGGCTGCAGTGAGG - Intronic
943259456 2:185640280-185640302 AGGAACTCAAGGCTGCAGTGAGG + Intergenic
943763068 2:191631067-191631089 GAGAAGTCTAGGCTGCCGTGAGG - Intergenic
943954043 2:194162986-194163008 GGGAAATCAAAACTTAAGTGGGG - Intergenic
944399741 2:199311676-199311698 GGTAAATCATGGCTGCCATGAGG - Intronic
944582295 2:201142200-201142222 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
945055770 2:205867558-205867580 GGGAGGCCAACGCTGCAGTGAGG - Intergenic
945086807 2:206140274-206140296 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
946362637 2:219228586-219228608 GGGGCAGGAAGGCTGCAGTGGGG + Intronic
946665980 2:222050340-222050362 AGGAAATTAAGGCTGAAGTCTGG - Intergenic
946720440 2:222600318-222600340 GGGAAAATAAGGCTTCACTGAGG + Intronic
946766953 2:223049899-223049921 AGGAGTTCAAGGCTGCAATGAGG - Intergenic
946843969 2:223843084-223843106 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
947013853 2:225595859-225595881 GGGAAATTAAGGCTGGAATGAGG - Intronic
947238500 2:227969345-227969367 AGGAGATCAAGGCTGCAGTGAGG + Intergenic
947562891 2:231173290-231173312 TGGAGGTCGAGGCTGCAGTGAGG + Intergenic
947581884 2:231325149-231325171 GGGAAGTTGAGGCTGCAATGGGG + Intronic
947742721 2:232492130-232492152 AGGAGATCCAGGCTGCAGGGAGG - Intergenic
947762154 2:232610803-232610825 GGGATGTCAAGGCTGCTGTGAGG + Intronic
947770263 2:232664982-232665004 GGGAGATAAGGGTTGCAGTGAGG - Intronic
948118631 2:235512639-235512661 GGGAAATCAAGGCAGGAATGGGG - Intronic
948644574 2:239396047-239396069 GGAAAGTCAAGGTTGCAGTGAGG - Intronic
948678503 2:239613414-239613436 GGGAGATGGAGGTTGCAGTGAGG - Intergenic
949051102 2:241897805-241897827 AGGCGGTCAAGGCTGCAGTGAGG - Intronic
1168779547 20:477265-477287 AAGAAGTCAAGGCTGCAGTGAGG - Intronic
1169044344 20:2524236-2524258 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1169196258 20:3683837-3683859 AGGATTTCAAGGCTGCAATGAGG - Intergenic
1169221969 20:3829158-3829180 GGGCAGTCAAGGTTGCAGTGAGG - Intergenic
1169241630 20:3986322-3986344 AGGAGGTCGAGGCTGCAGTGAGG - Intronic
1169446437 20:5675754-5675776 AGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1169763613 20:9124422-9124444 GGGAGTTCAGAGCTGCAGTGAGG + Intronic
1169875537 20:10293293-10293315 GGGAAATCAAAGCTTCAGGCAGG - Intronic
1169935794 20:10881967-10881989 GGGAGGTTGAGGCTGCAGTGAGG - Intergenic
1170877550 20:20264817-20264839 GGGAGGTCAAGGCTGCAGAGAGG + Intronic
1172100723 20:32483086-32483108 GGGCGATGAAGGCTGCACTGTGG - Intronic
1172196053 20:33092384-33092406 GGGGACTGAAGGCTGGAGTGAGG - Intronic
1172256476 20:33522668-33522690 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1172377053 20:34451994-34452016 GGGAAGTCAAGGCTGCAAGTAGG + Intronic
1172696610 20:36827434-36827456 AGGAAGTGGAGGCTGCAGTGAGG - Intronic
1172908630 20:38388850-38388872 GGGACATCAAGCCTGCAGTTAGG - Intergenic
1173416274 20:42858983-42859005 GGGTAAGCAGGGCTGCACTGAGG - Intronic
1173487755 20:43454197-43454219 TGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1173491198 20:43483645-43483667 GGGAGTTCAAAGCTGCAGTGAGG + Intergenic
1173661744 20:44739065-44739087 GGGAAATGTAGTCTCCAGTGGGG + Intergenic
1174354263 20:49987892-49987914 GCGAAGGCACGGCTGCAGTGGGG - Exonic
1174457211 20:50657824-50657846 AGGAGTTCAAGGCTGTAGTGAGG - Intronic
1174620368 20:51869665-51869687 GGGAAGTCAAGGTTGCAGTGAGG + Intergenic
1174852377 20:54007533-54007555 GGGAAATCAGGGAAGCAGAGAGG - Intronic
1175063809 20:56268164-56268186 AGGAGATGAAGGTTGCAGTGGGG - Intergenic
1175076117 20:56375195-56375217 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1175088154 20:56478420-56478442 AGGAATTCAAGGCTGCAGTGAGG + Intronic
1175675610 20:60944224-60944246 GGGAAGTGAAGGTTGCAGTGAGG + Intergenic
1175819832 20:61902944-61902966 AGGAGTTCGAGGCTGCAGTGAGG + Intronic
1175923312 20:62459997-62460019 AAGAGTTCAAGGCTGCAGTGAGG - Intergenic
1176208849 20:63907014-63907036 AGGAGGTCAAGGCTGCCGTGAGG + Intronic
1176308860 21:5139167-5139189 GGGAGGTCAAGGCTGTAGTGAGG - Intronic
1176417136 21:6483010-6483032 GGTAAGCCGAGGCTGCAGTGAGG - Intergenic
1176512061 21:7756191-7756213 AGAAGTTCAAGGCTGCAGTGAGG + Intronic
1176946966 21:14993710-14993732 AGGAAGTTGAGGCTGCAGTGAGG + Intronic
1177513471 21:22119977-22119999 TGGAGGTCCAGGCTGCAGTGAGG + Intergenic
1177579969 21:23008714-23008736 AGGAGATCAAGGCTGCAGTGAGG - Intergenic
1178426812 21:32485251-32485273 GGGAAGTGGAGGCTGCAGTGAGG - Intronic
1178549586 21:33525301-33525323 GGGAGTTTGAGGCTGCAGTGAGG + Intronic
1178646174 21:34386717-34386739 AGAAGTTCAAGGCTGCAGTGAGG + Intronic
1178991439 21:37359746-37359768 AGGATGTCGAGGCTGCAGTGAGG + Intergenic
1179360121 21:40698370-40698392 GGGAAATCAAAACTTAAGTGGGG + Intronic
1179560159 21:42210733-42210755 GGGAAATCAAGGAGGCAGGGAGG - Intronic
1179692633 21:43091343-43091365 GGTAAGCCGAGGCTGCAGTGAGG - Intergenic
1179848202 21:44122866-44122888 GGGAGGTCAAGGCTGTAGTGAGG + Intronic
1180109140 21:45639856-45639878 CGGAAATCAGGGCAGCTGTGGGG + Intergenic
1180635505 22:17260063-17260085 AGGAGTTCAATGCTGCAGTGAGG - Intergenic
1180878999 22:19190524-19190546 AGGAGTTCAAGGTTGCAGTGAGG + Intronic
1181278656 22:21703212-21703234 GGGAAGTCCAGACTCCAGTGAGG - Intronic
1181554181 22:23658172-23658194 GGCAAGTGAAGGTTGCAGTGAGG - Intergenic
1181935937 22:26438301-26438323 GGGAAATCATGGCTTCTGTCAGG + Intronic
1182030464 22:27155355-27155377 AGGAGTTCAAGGCTGCAGTAAGG - Intergenic
1182033769 22:27181467-27181489 GTGAAATCACGGCTCCAGTTTGG + Intergenic
1182105918 22:27689237-27689259 GGGCAACCAAGGCAGCAATGTGG - Intergenic
1182117713 22:27766727-27766749 GGGAAACCAAGGCCACAGAGGGG + Intronic
1182203425 22:28597862-28597884 GGGAGCTCAATGCTGCAGTGAGG - Intronic
1182227456 22:28810017-28810039 AGGAGGTCCAGGCTGCAGTGAGG + Intergenic
1182530909 22:30955932-30955954 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1182581873 22:31318516-31318538 GGGAGGTTAAGGCTGCAGTGAGG + Intergenic
1183911267 22:41081079-41081101 AGGAATTGGAGGCTGCAGTGAGG + Intergenic
1183912285 22:41089013-41089035 GGGAAGTCGAGGCTGCAGTGAGG - Intergenic
1183962531 22:41420324-41420346 GGGAGTTCCAGGCTGCAGTGAGG + Intergenic
1184059712 22:42074435-42074457 GGGAAACCAAGGCGGCAGCCAGG + Intronic
1184694056 22:46130101-46130123 GGGAAACCAAGGCTGGCGGGAGG + Intergenic
1185167861 22:49272737-49272759 GGGAAGTCCAGGCTGAAGGGCGG + Intergenic
949238509 3:1840857-1840879 GGAAAATCTAGGTTGCACTGGGG - Intergenic
949524292 3:4888151-4888173 AGGAATTCAAGGCTGCAGTGAGG + Intergenic
949554459 3:5141091-5141113 GGGAAATCGAAACTGAAGTGGGG - Intronic
949891224 3:8734789-8734811 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
949940958 3:9154112-9154134 TGGAAAGCGGGGCTGCAGTGGGG - Intronic
950209315 3:11107988-11108010 AGGAGTTCAAGGCTACAGTGAGG + Intergenic
950257054 3:11513934-11513956 GGGAGATCAAGACTGCATAGTGG - Intronic
950395899 3:12733975-12733997 AGGAGTTCAGGGCTGCAGTGAGG - Exonic
950522565 3:13505557-13505579 TGGAAATCAGGGATGCAGGGTGG + Exonic
950571938 3:13806618-13806640 AGGAGGTCAAGGCTGCAGTAAGG - Intergenic
950606039 3:14081125-14081147 AGGTGATCCAGGCTGCAGTGAGG + Intronic
950977295 3:17261593-17261615 GGGATGTCAAGGCTGCAATGAGG - Intronic
951480421 3:23155720-23155742 GGGAAATCAAAACCACAGTGAGG + Intergenic
951717519 3:25664794-25664816 AGGAAATCGGGGCTGCAGCGAGG - Intronic
951901347 3:27660697-27660719 GGGGAAACAAGGCTGCATTACGG - Intergenic
952370263 3:32715876-32715898 AGGAGATCAAGGCTGCAGTGAGG - Intronic
952787212 3:37167122-37167144 AGGAGGTCGAGGCTGCAGTGAGG + Intronic
953430316 3:42834445-42834467 AGGATGTCAAGGATGCAGTGAGG - Intronic
953948945 3:47173186-47173208 AGGAGATGGAGGCTGCAGTGAGG + Intergenic
953952532 3:47202552-47202574 AGGAGGTCGAGGCTGCAGTGAGG + Intergenic
954117917 3:48477474-48477496 GGGAGTTCAGGGCTACAGTGAGG - Intronic
954208047 3:49075254-49075276 TGGAGGTCAAAGCTGCAGTGAGG + Intronic
954597913 3:51842782-51842804 GGGAGGTGAAGGTTGCAGTGAGG - Intergenic
954844353 3:53542505-53542527 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
954982086 3:54755285-54755307 GGGAAATAAATGCTTCTGTGGGG + Intronic
955213656 3:56965180-56965202 AGGAGTTCAAGGCTGCAGTCAGG + Intronic
955314502 3:57925025-57925047 GGAAGGTCAAGGCTGAAGTGAGG - Intronic
955566481 3:60252489-60252511 GGGGGGTCAAGGCTGCACTGCGG + Intronic
956113853 3:65898992-65899014 GGGAAGTTGAGGCTTCAGTGAGG - Intronic
956193039 3:66625216-66625238 AGGAGATCGAGGCTGCAGGGAGG + Intergenic
956486458 3:69727906-69727928 AGGAAGTCGAGGCTGCACTGAGG - Intergenic
956770225 3:72519517-72519539 GGGAGGTCGAGGCTGCAGTGAGG + Intergenic
956779860 3:72595317-72595339 GGAAGGTCGAGGCTGCAGTGAGG + Intergenic
956836423 3:73099977-73099999 GGGAAATCAAGGTGGGAGGGAGG + Intergenic
957779667 3:84802329-84802351 GGGAGGTCAAGGCTGCTGTGAGG + Intergenic
958168632 3:89910348-89910370 CAGAGGTCAAGGCTGCAGTGAGG + Intergenic
959030181 3:101290434-101290456 GGGAGCACGAGGCTGCAGTGAGG + Intronic
959048859 3:101504944-101504966 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
959168391 3:102811766-102811788 GGGATGTCAAGGCTGCAGTGAGG - Intergenic
960145655 3:114198808-114198830 AGGAGTTCAAGGCTGCAATGAGG - Intronic
960960751 3:123068428-123068450 GGGAGAACCAGGCTGGAGTGGGG + Intronic
961143281 3:124573572-124573594 GGGAGGTCAAGGCTGCAGTGAGG - Intronic
961440600 3:126950770-126950792 GGGAAAGAAAGGCTGCACAGAGG + Intronic
961484712 3:127208703-127208725 GGAGAATCCAGGCTGCAGTGGGG + Intergenic
961868726 3:129973397-129973419 GGGAGGTCAAGGCTACAGTGAGG + Intergenic
962113918 3:132481506-132481528 GGGAAGTCAAGGCTGCAGTGAGG + Intronic
962402391 3:135071817-135071839 AGGAAATCAAGAGTTCAGTGTGG - Intronic
962491536 3:135898159-135898181 GGCATTTCAAGGCTGCAGTGAGG - Intergenic
962779275 3:138696253-138696275 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
963116605 3:141735674-141735696 GGGAAATGATGGTTGGAGTGAGG + Intergenic
963164339 3:142185338-142185360 AGGAAGCCGAGGCTGCAGTGAGG + Intronic
963312159 3:143721143-143721165 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
963993320 3:151678777-151678799 GGAGGATCAAGGCTGCAGTAAGG - Intergenic
964198685 3:154092907-154092929 AGGAATTCCAGGCAGCAGTGAGG + Intergenic
964334369 3:155639386-155639408 AGGAGGTTAAGGCTGCAGTGGGG + Intronic
964895300 3:161588644-161588666 GGGATATGGAGGCTGCAGTGAGG + Intergenic
965182617 3:165424129-165424151 AGGAAGTCAAGGCTACAGTGAGG - Intergenic
965366329 3:167804768-167804790 GGGGGTTCGAGGCTGCAGTGAGG + Intronic
966075172 3:175926990-175927012 GGGAAGTTAAAGCTGCGGTGAGG - Intergenic
966781386 3:183587264-183587286 GGGACTTCAAGGATGCAATGAGG + Intergenic
967966306 3:194962793-194962815 GGGAAGCGGAGGCTGCAGTGAGG - Intergenic
968020260 3:195379729-195379751 GGGAGTTCCAGGCTGTAGTGAGG + Intronic
968353006 3:198078138-198078160 AGGAGTTCCAGGCTGCAGTGAGG - Intergenic
968369876 3:198217400-198217422 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
968487966 4:873057-873079 GCGAGATCAAGGCTGCGCTGTGG - Intronic
968510808 4:994990-995012 TGGAGGTCCAGGCTGCAGTGAGG + Intronic
968565590 4:1310956-1310978 AGGAAGGCAGGGCTGCAGTGAGG - Intronic
968796324 4:2707800-2707822 GGGAAATAAAGTCCGCAGTGAGG - Intronic
968857041 4:3133421-3133443 CAGAGATCAAGGCTGCAGTAAGG + Intronic
968925315 4:3544059-3544081 GGGAGATCGAGGCTGCAGTGAGG + Intergenic
969099473 4:4757868-4757890 GGGAAATCAGGTTTGCATTGGGG + Intergenic
969256004 4:6002337-6002359 CGGAAATCAAGGTGGCAGTGGGG - Intergenic
969406492 4:6996574-6996596 GCGAAAACAGGGCTGCAGGGTGG + Intronic
969724739 4:8912338-8912360 GGGGAATGAAGGGAGCAGTGTGG + Intergenic
970149078 4:13069902-13069924 GGGAAATCATGGCTACATTGAGG - Intergenic
970586910 4:17523137-17523159 GGAAGGTCAAGGCTCCAGTGGGG - Intronic
970592747 4:17573819-17573841 GGGAGATTGAGGCTTCAGTGAGG - Intergenic
970933593 4:21541712-21541734 AGGAAGTCAAAGCTACAGTGAGG - Intronic
971009109 4:22411524-22411546 GGGAGGTAGAGGCTGCAGTGAGG + Intronic
971466019 4:26961835-26961857 AGGAATTTGAGGCTGCAGTGAGG - Intronic
971818750 4:31524625-31524647 GCCAAATCAAGGGTGGAGTGTGG - Intergenic
972074971 4:35075966-35075988 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
972230498 4:37067121-37067143 AGGATGTCGAGGCTGCAGTGAGG + Intergenic
972399515 4:38687806-38687828 GGGACATCATTGCCGCAGTGAGG + Intronic
972492028 4:39596846-39596868 GGGAAGTCAAGGCTGCAATGAGG - Intronic
972493420 4:39610061-39610083 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
972513630 4:39792918-39792940 GGGAAGTCGAGGCTGTGGTGAGG + Intergenic
973337563 4:48971906-48971928 AGGAATTCAAGGTTACAGTGAGG + Intergenic
973582263 4:52355959-52355981 GGGAACTCAAGACAGCAGTGAGG + Intergenic
973890546 4:55363359-55363381 AGGAGTTCAAAGCTGCAGTGAGG + Intronic
975127265 4:70797011-70797033 GGGAAATCGAGGCTGCAGTGAGG - Intronic
975696469 4:77019035-77019057 GGGAAAAGCAGGCTGCAGTTTGG - Intronic
976017486 4:80575396-80575418 GGGAAGTCAAGGCTGCAGTGAGG - Intronic
976267350 4:83196489-83196511 AGGAGGTCAATGCTGCAGTGAGG + Intergenic
976377442 4:84361799-84361821 AGGAGTTGAAGGCTGCAGTGAGG + Intergenic
976577045 4:86685276-86685298 TGCAAATCAAAACTGCAGTGAGG + Intronic
976577487 4:86691152-86691174 GGGAGGTCGAGGCTGTAGTGAGG + Intronic
976663877 4:87569573-87569595 AGGAGGTCAAGACTGCAGTGAGG - Intergenic
977235300 4:94501143-94501165 GGGAGGTCGAGGCTGCAGTGAGG - Intronic
979258585 4:118629367-118629389 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
979329771 4:119411191-119411213 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
979438777 4:120726280-120726302 GGTAAAACAAGGCTGAATTGAGG + Intronic
979475643 4:121154456-121154478 ACAAAATCTAGGCTGCAGTGTGG - Intronic
979535803 4:121819226-121819248 GGGAGATTAATGCTGCAGTATGG - Intronic
980140398 4:128909321-128909343 AGGAGGTCAAGACTGCAGTGAGG - Intronic
980535404 4:134114420-134114442 GGGAAATCAAAACTTAAGTGGGG + Intergenic
980608394 4:135123346-135123368 GGGAGGCCAAGGTTGCAGTGAGG + Intergenic
980912300 4:139004859-139004881 GGGAGGTGAAGGTTGCAGTGAGG + Intergenic
980984318 4:139681087-139681109 GGCAGGTCAAGGCTGCAGTGAGG - Intronic
981313921 4:143323172-143323194 TGGAAGTCGAGGCTGCAGTGAGG - Intergenic
981555048 4:145984037-145984059 GGGAGTTCAATGCTGCAGTGAGG + Intergenic
981914430 4:150018179-150018201 GGCAATTCAATGCTGAAGTGTGG - Intergenic
981967180 4:150618030-150618052 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
982710602 4:158755029-158755051 AGGAGGTCGAGGCTGCAGTGAGG + Intergenic
982741188 4:159059443-159059465 AGGAGATGGAGGCTGCAGTGAGG - Intergenic
983047800 4:163007415-163007437 AGGAGGTCAAGACTGCAGTGAGG + Intergenic
983074430 4:163308176-163308198 GGGAGGTGAAGGTTGCAGTGAGG - Intergenic
983592353 4:169427895-169427917 AGGAGATCAAGGCTGCAGTGAGG - Intronic
983789434 4:171777735-171777757 AGGAATTCAAGGCTGCAGTGAGG - Intergenic
983797736 4:171885730-171885752 GGGAGGTCGAGGCTGCAGTAAGG + Intronic
983810699 4:172057632-172057654 GGGAGGTTAAGGATGCAGTGAGG + Intronic
984017117 4:174439921-174439943 GGGAAACGGAGGTTGCAGTGAGG + Intergenic
984846778 4:184115163-184115185 GTCAACTCATGGCTGCAGTGAGG + Intronic
985200140 4:187476169-187476191 GGGAAATTGAGGGTGCAGGGAGG + Intergenic
985256945 4:188079673-188079695 AGGAATTCAAGGCTGCAGAATGG + Intergenic
985846584 5:2354111-2354133 GGGAAATCAAGGAGGCCGGGAGG - Intergenic
985914498 5:2907133-2907155 TGGAGATCAAGGCTGGAGAGTGG + Intergenic
985914524 5:2907265-2907287 TGGAATTCAAGGCTGGAGAGTGG + Intergenic
985914533 5:2907298-2907320 TGGAGATCAAGGCTGGAGAGTGG + Intergenic
985914573 5:2907496-2907518 TGGAATTCAAGGCTGGAGAGTGG + Intergenic
986783172 5:11085721-11085743 GGGAAAGAAAGGATGCAGTTTGG + Intronic
987319729 5:16757215-16757237 GGGAGTTTGAGGCTGCAGTGAGG + Intronic
987489825 5:18565058-18565080 GGGAAACCAAGGCAGGAGGGAGG + Intergenic
987832840 5:23119219-23119241 GGGAAGTGGAGGCTGCAATGAGG + Intergenic
987929324 5:24383772-24383794 AGGAGGCCAAGGCTGCAGTGGGG - Intergenic
988681832 5:33491027-33491049 GGGAGGTCAAGGCTGCAGTAAGG - Intergenic
989058121 5:37384252-37384274 GGGAAGTGGAGTCTGCAGTGAGG - Intronic
989661545 5:43804170-43804192 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
989668929 5:43891040-43891062 AGGAAAACAAGGCTGAAGAGGGG + Intergenic
990383144 5:55234571-55234593 GGGAAATTAAAGCTGGAATGGGG + Intergenic
990525498 5:56622768-56622790 GGGAAATCTAAGGTGTAGTGAGG + Intergenic
990577718 5:57139236-57139258 GGGAGGTCGAGACTGCAGTGAGG + Intergenic
990778831 5:59335004-59335026 GGGAAATCAAGGCTGCTGGAAGG - Intronic
991301262 5:65131670-65131692 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
991724122 5:69519063-69519085 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
992123849 5:73621609-73621631 TGGGAATTGAGGCTGCAGTGAGG + Intergenic
992307607 5:75459564-75459586 AGGAGTTCAAGGCTGGAGTGAGG - Intronic
992349271 5:75912418-75912440 GGGAGGTCAAGGCTGCAGTGGGG + Intergenic
992432997 5:76727958-76727980 GGGAGATCGAGGCTACAGTGAGG - Intronic
992585030 5:78229664-78229686 GGGAGGTCGAAGCTGCAGTGAGG + Intronic
992731382 5:79673006-79673028 GGCAAATCAAAACTGCAATGAGG - Intronic
992734514 5:79705197-79705219 GGGAAGCGGAGGCTGCAGTGAGG + Intronic
993077841 5:83256875-83256897 AGGAAAACAAGGCTTCAGAGAGG - Intronic
993353253 5:86875911-86875933 GGGAGGTCAAGGCTGCAGTAAGG + Intergenic
993487316 5:88502827-88502849 GGGAAATGAAGGCTAGAGAGAGG - Intergenic
993860415 5:93129749-93129771 GGGAAATAAAGGATGCAATGGGG + Intergenic
993997141 5:94736408-94736430 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
994142114 5:96353370-96353392 AGGAAATCAAGAGTGCAGTTAGG - Intergenic
994183520 5:96794259-96794281 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
994400327 5:99271780-99271802 GGAAAATAGAGGCAGCAGTGTGG - Intergenic
994427562 5:99611433-99611455 GAGTAATCAAGGCACCAGTGAGG - Intergenic
994506314 5:100646783-100646805 GGGAAATCAAAACTTAAGTGGGG - Intergenic
994620187 5:102154007-102154029 GGGAATTTAAGGCAGCAGAGTGG - Intergenic
994822649 5:104674037-104674059 AAGAAATTGAGGCTGCAGTGAGG - Intergenic
995114227 5:108460878-108460900 GGGAAGTCAAGGTTGCAGCGAGG + Intergenic
995260163 5:110094558-110094580 AGGAAAACAAGGCTGGAGTGTGG - Intergenic
995488666 5:112666194-112666216 GGGAGAGCGAGGCTGCAGTGAGG - Intergenic
995728821 5:115213697-115213719 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
996720275 5:126623213-126623235 AGGAATTCGAGGCTGCAGTGAGG + Intronic
997100717 5:130966027-130966049 AGGAGCTCAAGGCTGCAGTGAGG - Intergenic
997103148 5:130990691-130990713 GGGAAGTCGAGGCTGAACTGTGG - Intergenic
997542434 5:134674462-134674484 AGGAGGTTAAGGCTGCAGTGAGG + Intronic
997638850 5:135435398-135435420 AGGAAATGAAGGCTGAACTGGGG + Intergenic
997802807 5:136883709-136883731 GGGAAGCCAAGGCTTCAGTGAGG + Intergenic
998020040 5:138761825-138761847 GGGAGGTCAAGGCTGCAGTGAGG - Intronic
998354969 5:141527341-141527363 AAGAGGTCAAGGCTGCAGTGAGG + Intronic
998557989 5:143144476-143144498 GGGAGTTCAAGGCTGTGGTGAGG - Intronic
999212918 5:149905928-149905950 AGGAGTTCCAGGCTGCAGTGAGG - Intronic
999435016 5:151556934-151556956 GGGAAAGCAAGGGGGAAGTGAGG + Intronic
999453763 5:151697936-151697958 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
999638650 5:153648905-153648927 GGAAAATGAAGGCTGCAGTTGGG + Intronic
999738765 5:154533109-154533131 AGGAGTTCAAGGCTTCAGTGAGG + Intergenic
1000333485 5:160224348-160224370 GGGAGGTTGAGGCTGCAGTGAGG + Intronic
1000507394 5:162138054-162138076 GTGTTATCAAGACTGCAGTGAGG - Intronic
1000637664 5:163662174-163662196 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1000757212 5:165175978-165176000 GGGAGGTTGAGGCTGCAGTGGGG + Intergenic
1001194573 5:169660259-169660281 AGGAGTTCGAGGCTGCAGTGAGG + Intronic
1001496659 5:172192662-172192684 TGGGATTCAAGGCTGCAGTGAGG + Intergenic
1001579006 5:172785631-172785653 AGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1001967273 5:175919970-175919992 GGGAAATGAAGGGGTCAGTGGGG - Intronic
1002147240 5:177194330-177194352 TGGAGATCAAGGCTTCAGTGAGG - Intronic
1002647966 5:180671500-180671522 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1002663850 5:180808845-180808867 GGGCACTGAAGTCTGCAGTGGGG - Exonic
1002729154 5:181322978-181323000 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1002802263 6:535290-535312 AGGAGATCGAGGCTGCAGCGTGG + Intronic
1002919041 6:1553021-1553043 AGGAGTTGAAGGCTGCAGTGAGG + Intergenic
1003307162 6:4940006-4940028 GGGAATTCAACGCTGGAGGGAGG - Intronic
1003466281 6:6383046-6383068 GGGAAACCATGGCTTTAGTGAGG + Intergenic
1003515540 6:6815423-6815445 AGGAATTAGAGGCTGCAGTGAGG - Intergenic
1003588874 6:7420024-7420046 GGGAGATGAAGGTTGCAGTGAGG - Intergenic
1004035640 6:11920414-11920436 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1004209053 6:13618816-13618838 AGGAGGTCGAGGCTGCAGTGAGG + Intronic
1004446183 6:15700938-15700960 AGAAAGTCAAGGCTGCAGTGAGG + Intergenic
1004546840 6:16606054-16606076 AGGAGTTCAAGGCTGCTGTGAGG + Intronic
1004649741 6:17598040-17598062 GGGAGGTCAAAGCTACAGTGAGG + Intergenic
1004916635 6:20338903-20338925 GGGAAGTCAAGGCTGCAGTGAGG + Intergenic
1005255710 6:24000950-24000972 AGGAATTTGAGGCTGCAGTGAGG - Intergenic
1005414207 6:25584098-25584120 AAGAGTTCAAGGCTGCAGTGAGG - Intronic
1005447103 6:25935374-25935396 GGGAGGTCGAGGTTGCAGTGAGG + Intergenic
1005636517 6:27758071-27758093 GGGAAGTCGAGGCTTCAGTGAGG + Intergenic
1005673575 6:28131689-28131711 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1006058667 6:31403850-31403872 GGGGAAGCAGGGCTGAAGTGTGG - Intronic
1006071097 6:31498412-31498434 GGGAAAGCAGGGCTGAGGTGTGG - Intronic
1006682833 6:35809574-35809596 GGGAGGTCAAGGCTGCAATGAGG - Intronic
1006699960 6:35964134-35964156 GGGAGATGGAGGCTGCAGTGAGG + Intronic
1007453170 6:41955877-41955899 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1007490668 6:42219103-42219125 GGGAAGTGGAGGTTGCAGTGAGG + Intergenic
1007564151 6:42835856-42835878 GGAACGTCAAGGCTGCACTGAGG + Intronic
1007718397 6:43870407-43870429 GGGAAGTCAACCCTGCAGGGAGG - Intergenic
1007725591 6:43913878-43913900 GGCAAGACAAGGCTGCAGAGAGG + Intergenic
1007735347 6:43978856-43978878 GGGACAGCAGGGCTGCTGTGCGG - Intergenic
1008273593 6:49518092-49518114 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1008809958 6:55484434-55484456 GGGATATGAAGTCTTCAGTGAGG - Intronic
1009689099 6:67003530-67003552 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1010217481 6:73416964-73416986 GGGAAGTGGAGGTTGCAGTGAGG + Intronic
1010286842 6:74088715-74088737 AGGATGTCAAGGCTGTAGTGAGG - Intergenic
1010394836 6:75379075-75379097 GAGAAATCTAGGCTGAAGTAAGG + Intronic
1010436020 6:75831815-75831837 AGGAGATCGAGGCTGCAGTGAGG + Intronic
1010696995 6:78988500-78988522 AGGAGTTCAAGGCTGCAGGGAGG + Intronic
1011112034 6:83849447-83849469 GGGAAGTTGGGGCTGCAGTGGGG - Intergenic
1011202979 6:84858056-84858078 GGGAAATAAAGCCTTAAGTGTGG + Intergenic
1011441053 6:87387818-87387840 AGGAAAAGAAGGGTGCAGTGGGG + Intronic
1011581810 6:88876440-88876462 GGGAGGTCGAGGCTGCAGTGAGG + Intronic
1011665837 6:89632489-89632511 GAGAGGCCAAGGCTGCAGTGAGG - Exonic
1012252960 6:96999321-96999343 GGGAAGTCGAGGCTGCAGTGAGG + Intronic
1012474996 6:99607990-99608012 GGGAAATGAAGGCAGAAGTCTGG + Intronic
1013011635 6:106125817-106125839 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1013055332 6:106577373-106577395 AGGAGGTCAAGGCTGCAGCGAGG + Intronic
1013319454 6:108972734-108972756 GGGACATTGAGGCTGCAGTGGGG - Intronic
1013519861 6:110923322-110923344 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1013767526 6:113592327-113592349 AGGAAAGCCAGGCTGCAGTCAGG + Intergenic
1014149224 6:118034483-118034505 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1014591121 6:123272049-123272071 AGGAAAGCAGGGCTGGAGTGTGG - Intronic
1014695388 6:124614319-124614341 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1015003054 6:128243619-128243641 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1015855174 6:137616631-137616653 GGGAAATCACTGATACAGTGAGG + Intergenic
1016036859 6:139392179-139392201 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1016413695 6:143810757-143810779 AGGAAATGGAGGCTGCAGTGAGG + Intronic
1016587403 6:145705480-145705502 GAGAGGTCTAGGCTGCAGTGAGG + Intronic
1017090539 6:150755046-150755068 AGGAGATCAAGGCTGCAGCGAGG - Intronic
1017333946 6:153233065-153233087 GGGAGACCGAGGTTGCAGTGAGG + Intergenic
1017431655 6:154377112-154377134 AGGAAGTCGAGGCTGCAGTGAGG + Intronic
1017435290 6:154409972-154409994 AGGAGCTCAAGGCTGTAGTGAGG + Intronic
1017651567 6:156588131-156588153 GGGAAAAGAAGGTTACAGTGTGG + Intergenic
1018151430 6:160943679-160943701 GGGGAGTTGAGGCTGCAGTGAGG - Intergenic
1018419917 6:163632072-163632094 GGAAAATCAAGCCAGCAGGGAGG + Intergenic
1018693595 6:166370756-166370778 AGGAGTTCAAGTCTGCAGTGAGG + Intronic
1018779978 6:167054550-167054572 GGGAAGCAGAGGCTGCAGTGAGG - Intergenic
1019124594 6:169829879-169829901 GGCAAAACAAGGGGGCAGTGGGG + Intergenic
1019507302 7:1398562-1398584 TGGAGGTTAAGGCTGCAGTGAGG + Intergenic
1019692016 7:2420710-2420732 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1019867052 7:3722009-3722031 AAGAGGTCAAGGCTGCAGTGAGG - Intronic
1020183073 7:5937183-5937205 AGGAGGTCAAGGCTACAGTGAGG + Intronic
1020199421 7:6067866-6067888 GGGAGATGCAGGCTGAAGTGAGG + Intergenic
1020235270 7:6350064-6350086 AGGAGTTCAAGGCTGCAATGTGG + Intergenic
1020299839 7:6787574-6787596 AGGAGGTCAAGGCTACAGTGAGG - Intronic
1020305078 7:6827722-6827744 CGGAGTTCCAGGCTGCAGTGAGG - Intergenic
1021577214 7:22115543-22115565 GGGAGGTTGAGGCTGCAGTGAGG + Intergenic
1022390443 7:29939284-29939306 AGGAGTTCAAGGCTGCGGTGAGG - Intronic
1022772009 7:33483701-33483723 AGGAATTCAAAGCTGCAGTGAGG - Intronic
1023400557 7:39790671-39790693 GGGAGGTCAAGGCTGCAGTCAGG - Intergenic
1024073490 7:45806420-45806442 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1024649843 7:51393782-51393804 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1024904285 7:54359005-54359027 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1025053928 7:55749114-55749136 GGGAGGTCAAGGCTGCGGTGAGG + Intergenic
1025086526 7:56027984-56028006 AGGAGTTCAAGGGTGCAGTGAGG + Intronic
1025111359 7:56219076-56219098 AGGAATTAAAGGCTGCAGTGAGG - Intergenic
1025132035 7:56379587-56379609 GGGAGGTCAAGGCTGCGGTGAGG + Intergenic
1025202115 7:56968838-56968860 GGGACATCTAGGCTGCAGTGAGG + Intergenic
1025669832 7:63608090-63608112 GGGACATCTAGGCTGCAGTGAGG - Intergenic
1025706494 7:63870108-63870130 GGGAGGTCAAGGCTGCAATAAGG + Intergenic
1026040057 7:66860634-66860656 GAGCAAGGAAGGCTGCAGTGGGG + Intergenic
1026193205 7:68148698-68148720 TGAAAATCAAGGCTGCCCTGGGG - Intergenic
1026196036 7:68174692-68174714 AGGAGTTCCAGGCTGCAGTGAGG - Intergenic
1026320958 7:69267277-69267299 GGGAAGTCATAGCTGGAGTGAGG - Intergenic
1026323669 7:69289378-69289400 AGGAATTCAAGGTTGCAGGGAGG - Intergenic
1026350186 7:69508819-69508841 AGGAAGTCAAGGCTACAGTGAGG - Intergenic
1026377432 7:69765872-69765894 AGGAGGACAAGGCTGCAGTGAGG + Intronic
1026409641 7:70106645-70106667 AGGAGTTCAAGGCTGCAGTGGGG + Intronic
1026503442 7:70962259-70962281 AGGAGGTCAAGGCTACAGTGAGG + Intergenic
1026546366 7:71326384-71326406 AGTAGCTCAAGGCTGCAGTGAGG + Intronic
1026560558 7:71444752-71444774 GGGAGGTGGAGGCTGCAGTGAGG + Intronic
1026645984 7:72169390-72169412 AGGAGCTCGAGGCTGCAGTGAGG - Intronic
1026712994 7:72759260-72759282 GGGAGGTGGAGGCTGCAGTGAGG + Intronic
1026731013 7:72911962-72911984 AGGAAGTCAACGCTGCAGTGAGG - Intronic
1026907944 7:74073774-74073796 GGGAAGTAGAGGTTGCAGTGAGG - Intergenic
1026948574 7:74332438-74332460 GAGAATTCTAGGCTGCAGTGAGG - Intronic
1026955727 7:74375478-74375500 GGGAAGTAGAGGTTGCAGTGAGG + Intronic
1027113071 7:75456164-75456186 AGGAAGTCAACGCTGCAGTGAGG + Intronic
1027156365 7:75771155-75771177 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1027285318 7:76640775-76640797 AGGAAGTCAACGCTGCAGTGAGG + Intergenic
1027796324 7:82698203-82698225 TGGAGTTCCAGGCTGCAGTGAGG + Intergenic
1028130168 7:87162144-87162166 AGGAGATCAAGGCCGCAGTCTGG - Intronic
1028213223 7:88100998-88101020 GGGGAATCTAGGATGCAGTAGGG + Intronic
1028447096 7:90937004-90937026 AGGATTTCAAGGCTTCAGTGAGG + Intronic
1029114441 7:98230067-98230089 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1029149017 7:98467062-98467084 GGGAGGTCAAGGTTGCAGTGAGG - Intergenic
1029153563 7:98498981-98499003 AGGGGTTCAAGGCTGCAGTGAGG + Intergenic
1029199258 7:98827603-98827625 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1029410849 7:100409481-100409503 GGGAAATGGAGGCGGCTGTGTGG - Exonic
1029431945 7:100536980-100537002 GGGAGGTTGAGGCTGCAGTGAGG + Intergenic
1030001406 7:105067897-105067919 GTGAGTTCGAGGCTGCAGTGAGG + Intronic
1030404420 7:109092469-109092491 GGGAACTGAAGAATGCAGTGAGG - Intergenic
1030483770 7:110139722-110139744 AGGAGATCAAGACTTCAGTGAGG + Intergenic
1030873805 7:114788869-114788891 GGGAAATGCAGTCTCCAGTGGGG + Intergenic
1031522402 7:122782536-122782558 GGGATGTTGAGGCTGCAGTGAGG + Intronic
1031998171 7:128246524-128246546 AGGATGTCGAGGCTGCAGTGAGG - Intronic
1032050883 7:128650115-128650137 GGGAGGTCAAGGCTGCAGTGTGG - Intergenic
1032057504 7:128695611-128695633 GGGAGGACGAGGCTGCAGTGAGG - Intergenic
1032069248 7:128793680-128793702 GGGAACTGGAGGTTGCAGTGAGG - Intronic
1032303491 7:130711091-130711113 GGGACGTTGAGGCTGCAGTGAGG - Intergenic
1032400743 7:131622701-131622723 GGGAGGTTGAGGCTGCAGTGAGG + Intergenic
1032658098 7:133953576-133953598 GGGATGTCAAGGCTGCGGTGAGG + Intronic
1033630462 7:143152722-143152744 TGGAGGTCAAGGCTGCAGTAAGG + Intergenic
1033834069 7:145287214-145287236 AGGAAGTCAAGGCAGCAGTGAGG + Intergenic
1033957189 7:146864923-146864945 AGGAGTTCAAGGTTGCAGTGAGG + Intronic
1034209844 7:149353810-149353832 AGGAATTAGAGGCTGCAGTGAGG + Intergenic
1034259066 7:149742906-149742928 AGGAGTTCCAGGCTGCAGTGAGG - Intergenic
1034615511 7:152413185-152413207 AGGAGGTCGAGGCTGCAGTGAGG - Intronic
1034691044 7:153013861-153013883 AAGAAGTCAAGGTTGCAGTGAGG + Intergenic
1034905313 7:154939566-154939588 GTGAAATTAAGGCTGCAATTTGG - Intronic
1034991955 7:155553457-155553479 AGGAAGTCGAGGCTGCAATGAGG - Intergenic
1035155206 7:156906630-156906652 AGGAGATCAGGGCTGCAGTGAGG - Intergenic
1035331278 7:158098814-158098836 GAGAAAGCAAGGAAGCAGTGGGG + Intronic
1035706083 8:1676297-1676319 CTGAACTCAAGGCTGCAGTTTGG - Intronic
1036917551 8:12819465-12819487 GGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1037096830 8:14995974-14995996 GGGAGATAGAGGTTGCAGTGAGG - Intronic
1037520755 8:19678625-19678647 GGGACCTCAAGGCAGCAGAGTGG + Intronic
1037640560 8:20738284-20738306 AGGAGGTCAAGGCTGCAGGGAGG + Intergenic
1037785271 8:21899229-21899251 GGGAAGTGGAGGTTGCAGTGAGG + Intergenic
1037873061 8:22518133-22518155 AGGAGTTCAAGGTTGCAGTGAGG - Intronic
1037943245 8:22970526-22970548 AGGAGTTCCAGGCTGCAGTGAGG + Intronic
1038285761 8:26205134-26205156 GGGAGGTGAAGGCTGCAGTGAGG - Intergenic
1038288484 8:26227287-26227309 GGGAAATACAGGCTGGAGTCTGG - Intergenic
1038300078 8:26336354-26336376 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1038530317 8:28313380-28313402 GGGAAGTTGAGGCTGCAGTGAGG - Intergenic
1038571713 8:28668192-28668214 AGGAGTTCAAGGCTGCAGTGAGG + Intronic
1038616075 8:29096370-29096392 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
1038636265 8:29289883-29289905 GGGAGGTTGAGGCTGCAGTGAGG - Intergenic
1038759707 8:30375189-30375211 AAGAGTTCAAGGCTGCAGTGAGG + Intergenic
1038971364 8:32639331-32639353 GGGAGGTGGAGGCTGCAGTGAGG + Intronic
1039046531 8:33455449-33455471 AGGAGTTCAAGGCTGCAGTGCGG + Intronic
1039175051 8:34794028-34794050 AGGAGTTCGAGGCTGCAGTGAGG + Intergenic
1039340487 8:36644045-36644067 GGGAGATGAAGGTTGCAGCGAGG - Intergenic
1039474462 8:37832407-37832429 AGGAATTCGAGACTGCAGTGAGG - Intronic
1039512581 8:38103757-38103779 GGGAACTTGAGGCGGCAGTGAGG + Intergenic
1039717029 8:40120744-40120766 GGGAACTCAAGGCTGCAGGGAGG - Intergenic
1040290148 8:46120084-46120106 GGGAAAGCAGGGCAGCAGGGTGG - Intergenic
1040291485 8:46127820-46127842 GAGAAAACAAGGCCGCAGGGTGG - Intergenic
1040293448 8:46137136-46137158 GCGAAAACAGGGCTGCAGTGTGG - Intergenic
1040294877 8:46143996-46144018 GAGAAAACAAGGTTGCAGGGTGG - Intergenic
1040300508 8:46185555-46185577 GTGAAAACGGGGCTGCAGTGTGG - Intergenic
1040301015 8:46188047-46188069 GAGAAAACAGGGCTTCAGTGTGG - Intergenic
1040301496 8:46190356-46190378 GTGAAAACAGGGCTGCAGCGTGG + Intergenic
1040301902 8:46192381-46192403 GTGAAAACAGAGCTGCAGTGTGG + Intergenic
1040302483 8:46195205-46195227 GGGAAAACAGGGCTGCAGTGTGG + Intergenic
1040302669 8:46196039-46196061 GGGAAATCAGGGACTCAGTGTGG + Intergenic
1040305769 8:46211017-46211039 GCGAAAACAGGGCTGCAGGGTGG + Intergenic
1040309567 8:46229732-46229754 GCGAATACAAGGCTGCAGGGTGG + Intergenic
1040309878 8:46231357-46231379 GTGAAAACAGGGCTGCAGGGTGG + Intergenic
1040311532 8:46239301-46239323 GTGAAAACAGGGCTGCAGAGTGG + Intergenic
1040311746 8:46240380-46240402 GCGAAAACGTGGCTGCAGTGTGG + Intergenic
1040314574 8:46254252-46254274 GCGAAAACAAGGCCGCAGGGTGG + Intergenic
1040315379 8:46258145-46258167 TGCAAATCATGGCCGCAGTGTGG + Intergenic
1040317967 8:46274973-46274995 GTGAAAACAAGGCTGCAGGGTGG + Intergenic
1040324869 8:46336609-46336631 GGGAAATCGGGGCAGCAGGGTGG + Intergenic
1040325709 8:46340498-46340520 GCGAAATCAAAGCTGCAGAATGG + Intergenic
1040331268 8:46386980-46387002 GTGAAAACAGGGCTGCAGGGTGG + Intergenic
1040333581 8:46404756-46404778 GCGAAAACAAGGCTGCAGGGTGG + Intergenic
1040333619 8:46404949-46404971 GCAAAAACAAGGCAGCAGTGTGG + Intergenic
1040334118 8:46407495-46407517 GCGAAAACGAGGCTGCAGTATGG + Intergenic
1040334476 8:46409089-46409111 GTGAAAACAAGGCCGCAGAGTGG + Intergenic
1040336848 8:46420434-46420456 GCAAAAACAAGGCTGCAGTGTGG + Intergenic
1040337819 8:46425043-46425065 GAGAAAACAGGGCTGCAGAGTGG + Intergenic
1040338338 8:46427417-46427439 GAGAAATCAGGGCCGCAGGGTGG + Intergenic
1040339240 8:46432089-46432111 GCGAAAACAAGGCTGCAGGGTGG + Intergenic
1040340647 8:46438822-46438844 GAGAAAACGAGGCTGCAGGGTGG - Intergenic
1040340856 8:46439890-46439912 GCGAAAACAAGGCTGCAGGGTGG - Intergenic
1040879618 8:52191104-52191126 AGCAAGTCCAGGCTGCAGTGTGG + Intronic
1041009558 8:53528740-53528762 AGGAGTTCAAGGTTGCAGTGAGG + Intergenic
1041022145 8:53648697-53648719 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1041069804 8:54116746-54116768 GGGAGGTGGAGGCTGCAGTGAGG - Intergenic
1041367096 8:57118267-57118289 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1041368623 8:57135367-57135389 GGGAAAAGAAGGCTGCACTCTGG - Intergenic
1041659272 8:60385333-60385355 AGGAACTCAAAGCTGCAGTGAGG + Intergenic
1041843023 8:62293955-62293977 GGAACTGCAAGGCTGCAGTGAGG - Intronic
1042222654 8:66488852-66488874 GGGAGGTCAAGGCTGCAATGGGG - Intronic
1042564127 8:70095932-70095954 AGGAGTTCTAGGCTGCAGTGAGG - Intergenic
1043921533 8:85989237-85989259 AGGAGGTCCAGGCTGCAGTGAGG - Intronic
1044724507 8:95182062-95182084 GGTAGGTCACGGCTGCAGTGAGG - Intergenic
1044754112 8:95444106-95444128 GGGAACACCAGGCTACAGTGTGG - Intergenic
1045099212 8:98827725-98827747 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
1045309749 8:100990844-100990866 AGGAAGTCAAGGCTGCATTAAGG - Intergenic
1045345038 8:101286346-101286368 GGGACACAAAGGATGCAGTGTGG + Intergenic
1045353683 8:101365551-101365573 AGGAGTTCGAGGCTGCAGTGAGG + Intergenic
1046761828 8:118029351-118029373 AGGAGTTCAAGGCTGCAATGAGG + Intronic
1046783582 8:118241982-118242004 GGGAGGTCAAGGCTTCGGTGAGG - Intronic
1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG + Intronic
1047088607 8:121547754-121547776 AGGAAGTCAAGGCAGCAGTGAGG + Intergenic
1047334298 8:123921435-123921457 AGAAGTTCAAGGCTGCAGTGAGG - Intronic
1047421838 8:124713818-124713840 GGGAAGTCGAGGCAGCAATGAGG - Intronic
1047896589 8:129373230-129373252 AAGCAATAAAGGCTGCAGTGAGG - Intergenic
1048110985 8:131468559-131468581 GGGAAATGATAGCTGTAGTGAGG + Intergenic
1048291708 8:133186187-133186209 GGGAAACCAAGGCAGCAGTCAGG + Intergenic
1048389444 8:133947683-133947705 GGGAGGTCAAGGCTGCAGTGAGG + Intergenic
1048964918 8:139608428-139608450 GGGAAACGAAGGCTCTAGTGGGG + Intronic
1049132632 8:140861274-140861296 AGAAGTTCAAGGCTGCAGTGAGG + Intronic
1049193575 8:141303068-141303090 AGGAGGTCCAGGCTGCAGTGAGG - Intronic
1049915247 9:311310-311332 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1050371695 9:4928635-4928657 AGGAATTCGAGGTTGCAGTGAGG - Intergenic
1050547475 9:6721144-6721166 GGGATGTTGAGGCTGCAGTGAGG - Intronic
1050594140 9:7188966-7188988 GGGAAATGAGGGCAGAAGTGAGG + Intergenic
1050629794 9:7546290-7546312 GTCAAAGCAAGGCAGCAGTGAGG + Intergenic
1051629935 9:19131583-19131605 GGGTGGTCAAGGCTGCAGTTGGG + Intronic
1052357323 9:27518455-27518477 GGGAAATCAACACTGAAATGAGG + Intronic
1052699521 9:31921131-31921153 GGGAGGTGGAGGCTGCAGTGAGG - Intergenic
1053023907 9:34715110-34715132 GGGAAATGAAGGAAGCAGTAGGG + Intergenic
1053081429 9:35181023-35181045 GGGAAGTGAAGGCTACACTGAGG + Intronic
1053183085 9:35991369-35991391 AGGAAGTGAAGGCTGCTGTGAGG - Intergenic
1053365589 9:37520405-37520427 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1053437659 9:38087485-38087507 GGGAAGTCAAAGCTGCAGTGAGG - Intergenic
1053460506 9:38266249-38266271 AGGAGTTCAAGGCTTCAGTGAGG + Intergenic
1053800204 9:41759241-41759263 GGGAGATCGAGGCTGCAGTGAGG + Intergenic
1054144989 9:61555594-61555616 GGGAGATCGAGGCTGCAGTGAGG - Intergenic
1054188632 9:61971393-61971415 GGGAGATCGAGGCTGCAGTGAGG + Intergenic
1054464685 9:65486551-65486573 GGGAGATCGAGGCTGCAGTGAGG - Intergenic
1054649889 9:67617224-67617246 GGGAGATCGAGGCTGCAGTGAGG - Intergenic
1054799815 9:69335909-69335931 AGAAAGTCAAGGCTGCAGTGAGG + Intronic
1055493259 9:76827665-76827687 GGGAAATAAAGCATCCAGTGAGG + Intronic
1055535160 9:77234247-77234269 AGGAGTTCAAGGCTGCAGTGAGG - Intronic
1055997698 9:82179331-82179353 AGGACTTCAAGGCTGCTGTGAGG - Intergenic
1057038493 9:91830397-91830419 AGGAGTTCAATGCTGCAGTGAGG + Intronic
1057051122 9:91924915-91924937 GGGAGGTTGAGGCTGCAGTGAGG - Intronic
1057299652 9:93870521-93870543 CGGAACCCAGGGCTGCAGTGCGG - Intergenic
1057468845 9:95339774-95339796 AGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1057683389 9:97211965-97211987 GCGAGTTCCAGGCTGCAGTGAGG - Intergenic
1058650166 9:107168174-107168196 GGGAGGTCGAGGCTGCAGTGGGG - Intergenic
1058686621 9:107486939-107486961 GGGAAGTCAAGGAGGCACTGAGG + Intronic
1058724330 9:107787583-107787605 GGGAAATCCAGGCAGGTGTGGGG + Intergenic
1059183166 9:112239656-112239678 AGGAGTTCCAGGCTGCAGTGAGG + Intronic
1059308358 9:113372040-113372062 GTGGAATGAAGGCTGCTGTGAGG - Intergenic
1059582887 9:115570766-115570788 GGGAGATAGAGGCTGCAGTGAGG + Intergenic
1060341518 9:122781221-122781243 TGTAAATTAAGGCTACAGTGAGG + Intergenic
1060632986 9:125176582-125176604 GGGAGGTCAAAGCTGCAGTGAGG + Intronic
1060678327 9:125537552-125537574 AGGAGGTCAAGGCTACAGTGAGG - Intronic
1060759888 9:126238231-126238253 AGGTGATCAAGGCTGCAGTGAGG + Intergenic
1060819716 9:126654316-126654338 GTGAAATCAGGGCTGGAGTGGGG - Intronic
1061211314 9:129195004-129195026 GGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1061493323 9:130958066-130958088 GGGAAACTAAGGCTGGAGAGGGG - Intergenic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1061985638 9:134128774-134128796 GGGGGATCGAGGCTGCAGTGAGG + Intergenic
1062588031 9:137259116-137259138 CGGATATTGAGGCTGCAGTGAGG + Intronic
1203576733 Un_KI270745v1:14858-14880 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1203577132 Un_KI270745v1:18280-18302 GGGAGGTCAAGGCTGCAGTGAGG - Intergenic
1185488371 X:500032-500054 CGGAAAGCAAGTCTGCTGTGGGG + Intergenic
1185496549 X:558302-558324 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1185555631 X:1018914-1018936 AGGAAGTTGAGGCTGCAGTGAGG - Intergenic
1185932387 X:4217384-4217406 GGGAGGTGGAGGCTGCAGTGAGG + Intergenic
1186050283 X:5584911-5584933 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1186127643 X:6431373-6431395 AGGAAATTGAGGCTGTAGTGAGG + Intergenic
1186334924 X:8576034-8576056 GGGAGTTCAAGGCTACAGTGAGG + Intronic
1186364252 X:8874746-8874768 AGGATTCCAAGGCTGCAGTGAGG - Intergenic
1186467488 X:9795195-9795217 AGGAGTTCAAGGCTGTAGTGTGG - Intronic
1186470407 X:9817042-9817064 AGGAATTGAAGGCTGCAGTGAGG - Intronic
1186514083 X:10153029-10153051 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1186567839 X:10683467-10683489 AGGAGGTCAAGGCTGCAGTGAGG + Intronic
1187064445 X:15819502-15819524 AGGAGGTCGAGGCTGCAGTGAGG + Intronic
1187174942 X:16887881-16887903 AGGAGATTGAGGCTGCAGTGAGG - Intergenic
1187289709 X:17941423-17941445 GGTAATTCAATGTTGCAGTGAGG + Intergenic
1187365755 X:18664785-18664807 AGGAGGTCGAGGCTGCAGTGAGG - Intronic
1187375331 X:18747547-18747569 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1187447126 X:19369835-19369857 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1187710973 X:22054205-22054227 GGGAAGTGGAGGTTGCAGTGAGG - Intronic
1189383747 X:40520185-40520207 GGAAAGTCGAGGCTGCAGTGAGG + Intergenic
1189766685 X:44379150-44379172 GGGAGGTGAAGGTTGCAGTGAGG + Intergenic
1189778925 X:44495412-44495434 AGGAGATCAAGGCTGTAGTGAGG - Intergenic
1190164636 X:48062865-48062887 GGGAGGTCAAGACTGCAGTGAGG + Intronic
1190164914 X:48065360-48065382 GGGAGGTCAAGGCTGCAGTGAGG + Intronic
1190177049 X:48158997-48159019 AGGACTTCGAGGCTGCAGTGAGG - Intergenic
1190195957 X:48318770-48318792 GGGAGGTGAAGGTTGCAGTGAGG - Intergenic
1190237374 X:48626843-48626865 AGGAATTTGAGGCTGCAGTGAGG - Intergenic
1190629131 X:52368169-52368191 AGGAGATCCAGGCTGCAGTGAGG + Intergenic
1190882245 X:54499951-54499973 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1190953581 X:55170473-55170495 AGGAGATCGAGGTTGCAGTGAGG + Intronic
1191729869 X:64322114-64322136 AGGAGATCAAGGTTGCAGTGAGG - Intronic
1191885520 X:65883991-65884013 GAGAAATCTAGGTTTCAGTGTGG + Intergenic
1192059464 X:67808597-67808619 GGGAAGTCTAGGCTGCTGAGTGG - Intergenic
1193097645 X:77569039-77569061 AGGAGTTCGAGGCTGCAGTGAGG + Intronic
1193648022 X:84092320-84092342 TGGAAATCAAAACTGCAGTGAGG + Intronic
1194576516 X:95620283-95620305 AGGAGGTCGAGGCTGCAGTGAGG - Intergenic
1194671300 X:96736477-96736499 GGGAAGTGGAGGTTGCAGTGAGG - Intronic
1194700170 X:97104459-97104481 AGGAGTTCGAGGCTGCAGTGAGG - Intronic
1194895878 X:99438590-99438612 AGGAGTTCAATGCTGCAGTGAGG + Intergenic
1195323374 X:103739085-103739107 GGGAAACAAAGGCTGCAAGGTGG - Intergenic
1195549447 X:106150514-106150536 GGGAAATTGAGGCTGCAGTGAGG + Intergenic
1195781192 X:108466670-108466692 AGGAGTTAAAGGCTGCAGTGAGG - Intronic
1195852362 X:109296651-109296673 GGGAAATTAAGGAACCAGTGGGG + Intergenic
1195909695 X:109876461-109876483 GAGAGGTCGAGGCTGCAGTGAGG + Intergenic
1195916882 X:109944534-109944556 GGGAGGTTAAGGCTGCAGTGAGG + Intergenic
1196690151 X:118550364-118550386 GGGAGGTCGAGGCTGTAGTGAGG + Intronic
1196715681 X:118808854-118808876 AGGAATTGAAGGCTGCAGTGAGG - Intergenic
1196843055 X:119876130-119876152 GGGAGATGCAGGTTGCAGTGAGG + Intronic
1197820783 X:130538889-130538911 GAGAAATCAGAGCTGCAGCGGGG + Intergenic
1198167947 X:134075681-134075703 GGGAGATTGAGGCTGCAGTGAGG + Intergenic
1198242000 X:134796502-134796524 GGGAAAACAAGGATGGAGGGAGG + Intronic
1198309782 X:135419745-135419767 GTGAAATCAGGCCTGCAGTCTGG + Intergenic
1198337353 X:135679628-135679650 GAGAGTTCCAGGCTGCAGTGAGG + Intergenic
1198343387 X:135736493-135736515 GGGAGGCCAAGGCTGCAGTGAGG - Intergenic
1198361841 X:135903186-135903208 GAGAGTTCCAGGCTGCAGTGAGG - Intronic
1198407557 X:136329743-136329765 AGGAGGTCAAGGCTGCAGTGAGG - Intronic
1198515598 X:137403608-137403630 AGGAATTCGAGACTGCAGTGAGG + Intergenic
1199411138 X:147524859-147524881 AGGACTTCAAGGCTGCAATGAGG - Intergenic
1200460604 Y:3449635-3449657 AGGAAAGCAGGGCTGGAGTGTGG + Intergenic
1200613268 Y:5349053-5349075 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1200711836 Y:6491524-6491546 AGGAGTTCAAGGCTGCAGTGAGG + Intergenic
1201022100 Y:9670461-9670483 AGGAGTTCAAGGCTGCAGTGAGG - Intergenic
1201062104 Y:10055415-10055437 GGGAGTTCAAGGTTGCAATGAGG - Intergenic
1201154405 Y:11116546-11116568 AGGAGGTCAAGGCTGCAGTTAGG + Intergenic
1201303102 Y:12527210-12527232 GGGAAGTGGAGGCTGTAGTGAGG - Intergenic
1201713325 Y:17015904-17015926 GGGAGGTGGAGGCTGCAGTGAGG + Intergenic
1201918009 Y:19203462-19203484 GGGATGTCAAAGCTGCGGTGAGG + Intergenic
1201954730 Y:19610434-19610456 AGGAGGTCAAGGCTGCAGTGTGG - Intergenic
1202012813 Y:20365935-20365957 ATGAGATCAAAGCTGCAGTGAGG + Intergenic