ID: 1094079810

View in Genome Browser
Species Human (GRCh38)
Location 12:26521482-26521504
Sequence CAGATTCATTATATGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094079808_1094079810 3 Left 1094079808 12:26521456-26521478 CCCTGTTATTAACTGTCAATATT 0: 1
1: 0
2: 1
3: 23
4: 300
Right 1094079810 12:26521482-26521504 CAGATTCATTATATGCAGTCAGG 0: 1
1: 0
2: 1
3: 5
4: 104
1094079809_1094079810 2 Left 1094079809 12:26521457-26521479 CCTGTTATTAACTGTCAATATTT 0: 1
1: 0
2: 6
3: 33
4: 319
Right 1094079810 12:26521482-26521504 CAGATTCATTATATGCAGTCAGG 0: 1
1: 0
2: 1
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094079810 Original CRISPR CAGATTCATTATATGCAGTC AGG Intronic
900863217 1:5247712-5247734 CAGATTTATGATTTGCAGGCTGG + Intergenic
906469424 1:46115534-46115556 CAGATAAAATATATGCAGTATGG - Intronic
912168768 1:107071809-107071831 TAGATTCATGATATGAAGTCTGG - Intergenic
917101482 1:171450361-171450383 CAGATTCAGGTTATGCATTCTGG + Intergenic
921666537 1:217879441-217879463 CAGTTTCATAATATGCCTTCTGG + Intergenic
924084778 1:240439677-240439699 CAGTTACATTATATGCAGGTGGG + Intronic
1068111875 10:52689675-52689697 CTGATTAATTATGTGCAATCTGG - Intergenic
1069127267 10:64651794-64651816 CTGATTTATGATATGCACTCAGG - Intergenic
1071048519 10:81415868-81415890 GTTATTCTTTATATGCAGTCAGG + Intergenic
1074838513 10:117324574-117324596 AAGATTCATTATAAGTACTCTGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080875787 11:36273208-36273230 CAGATTAAGAATATGCTGTCAGG - Intergenic
1085352641 11:75809672-75809694 CAGCCTCATTCTATGCCGTCAGG + Intergenic
1087210745 11:95444232-95444254 CAGCTTCACTATATGAACTCGGG + Intergenic
1087705318 11:101483846-101483868 CAGATTCTTTATATGAAATACGG + Intronic
1088712457 11:112520904-112520926 CAAAGTCAGTATCTGCAGTCAGG + Intergenic
1094079810 12:26521482-26521504 CAGATTCATTATATGCAGTCAGG + Intronic
1096123787 12:49105384-49105406 CATCTTCAATATATGCAGCCCGG - Intronic
1099560713 12:84171152-84171174 CAGATTCAATATATGGAGAAAGG + Intergenic
1100365966 12:93921014-93921036 CAGTTTCCTTACCTGCAGTCAGG - Intergenic
1100773328 12:97948149-97948171 CAGATTTTTTATCTCCAGTCTGG - Intergenic
1102593285 12:113973616-113973638 CACATTTATGATCTGCAGTCTGG + Intergenic
1105911993 13:24877825-24877847 CATTTACATTAAATGCAGTCTGG - Intronic
1116492781 14:45526252-45526274 GAGATTCATACTATGAAGTCAGG + Intergenic
1117136443 14:52739012-52739034 CAGATTCATTATGTGCATGGGGG - Intronic
1118874768 14:69774370-69774392 CAGATAGATTATTTGGAGTCAGG - Intergenic
1120333397 14:83122815-83122837 CAGAATTAATATATTCAGTCAGG + Intergenic
1122281148 14:100623177-100623199 CAGATTGATTATTTGCTGCCGGG + Intergenic
1122354886 14:101116955-101116977 CAGCTTCCTTTTGTGCAGTCTGG - Intergenic
1127389603 15:58494772-58494794 CAGATTCCTTATGTGCATTCAGG - Intronic
1129148409 15:73670755-73670777 CAGATTCAATAGATGAAGGCTGG - Intergenic
1135566520 16:23515367-23515389 CAGATGGATTATATGAGGTCAGG + Intronic
1141082954 16:81069332-81069354 CAGGTTCATTGTATGATGTCTGG + Intronic
1144377341 17:14657436-14657458 CAGCTTCAGGATTTGCAGTCAGG + Intergenic
1149747999 17:59118035-59118057 CAGATTCATCATCTGAGGTCAGG + Intronic
1156072481 18:33229452-33229474 AAGATACATTATATGCTTTCTGG + Intronic
1156417821 18:36916721-36916743 CACATTCATTAACTGCTGTCAGG - Intronic
1159604555 18:70461588-70461610 CAGTTTCATTATAATCACTCAGG - Intergenic
1159805016 18:72945935-72945957 GAAATTCATTATAAGCAGGCTGG + Intergenic
926635903 2:15179245-15179267 CATATTCAGTATATCCAGTGCGG - Intronic
926814535 2:16787194-16787216 CATACTCACCATATGCAGTCTGG - Intergenic
927388480 2:22564485-22564507 CAGATTAAGTAAATGCAGCCAGG - Intergenic
928698797 2:33877933-33877955 AAGATTCATTATATTTAGCCAGG - Intergenic
930386841 2:50707620-50707642 CATTTTCATTATATCCAGACTGG + Intronic
932801991 2:74749016-74749038 CAGAATGTTTATATGCACTCTGG + Intergenic
943437771 2:187887806-187887828 CACATTTATTATAAACAGTCAGG + Intergenic
945636507 2:212359610-212359632 CAGATTCCTTATCTGCTATCAGG - Intronic
946273962 2:218616865-218616887 AACATTCATTAAATGCATTCTGG - Intronic
946682443 2:222231215-222231237 CAGATTCTTAATTTGCAGGCTGG - Intronic
947890735 2:233617008-233617030 CAGATACATCACATGCAGTGGGG - Intergenic
1170148811 20:13206279-13206301 CAGATCCCTGATATACAGTCAGG - Intergenic
1181940400 22:26471353-26471375 CACATTCCTTGTATGGAGTCAGG + Intronic
951946222 3:28139661-28139683 CAGATTTATTATAGGCAGCAAGG - Intergenic
955625399 3:60913123-60913145 CAGAGTCATTATATGCCCTTAGG - Intronic
958873347 3:99588088-99588110 AACATTCATTACATGCAGCCAGG - Intergenic
959896096 3:111608133-111608155 CAGATTCTTTAGTTCCAGTCAGG - Intronic
962385602 3:134929954-134929976 CAGATTGTTTCTCTGCAGTCAGG + Intronic
963748131 3:149146617-149146639 CAGATTGGTTCTATGCAGTTTGG - Intronic
965310310 3:167118681-167118703 CAAATTCATCATATGAATTCTGG - Intergenic
967510387 3:190304381-190304403 CAGCCTCATTAAATGCAGGCAGG - Intergenic
970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG + Intergenic
974868327 4:67607045-67607067 TTGATTCAGTAGATGCAGTCTGG - Intronic
975266519 4:72375548-72375570 CTGATTCAGTGTATGGAGTCAGG + Intronic
979098658 4:116586157-116586179 CAGTTTCATTATATGTAGATTGG - Intergenic
984135988 4:175939926-175939948 CAGAAATATTATATGTAGTCTGG - Intronic
987227419 5:15857372-15857394 CAGCTTCCTTATCTGCAATCTGG - Intronic
987841185 5:23224553-23224575 CAGATTTATTATATGTAATTTGG - Intergenic
988493778 5:31727380-31727402 CAGCTTCATTATATGCAGGCTGG - Intronic
988906013 5:35789826-35789848 CTGGTTCATAATGTGCAGTCAGG - Intronic
992671341 5:79063979-79064001 CAGAATCATTATATGGAATGGGG - Intronic
992874786 5:81043329-81043351 CAGTTTCCTTATCTGCAGACAGG - Intronic
998765452 5:145481885-145481907 CAAATTCATTAATTGCAGTTAGG - Intronic
999093797 5:148959891-148959913 CAGAATCATTTGATGCAGACTGG - Intronic
999313677 5:150570142-150570164 CAGATACATTATAGGCATTTAGG + Intergenic
1001361821 5:171093668-171093690 CAGTTTAGTTTTATGCAGTCTGG + Intronic
1008023131 6:46602881-46602903 CAGTGTCAATATATCCAGTCAGG - Intronic
1010063571 6:71653820-71653842 CATATTCATTATTTGAAGTATGG + Intergenic
1015974934 6:138780507-138780529 CAGATTTTTCATGTGCAGTCTGG + Intronic
1016446021 6:144132643-144132665 CAGTTTCATTATCTGCATTATGG - Intergenic
1020595618 7:10203778-10203800 CACATTCATAATTTGGAGTCTGG - Intergenic
1021095633 7:16532473-16532495 CAGATTAATTATATGTTATCAGG + Exonic
1021480721 7:21112984-21113006 CAGCTTCATTGTATGCATTCAGG - Intergenic
1022652082 7:32286829-32286851 CATATTCATTTTAGGCACTCAGG - Intronic
1023654412 7:42405233-42405255 CAGATTCATCATCTGCTGGCAGG - Intergenic
1024117877 7:46210148-46210170 CAGATTCATTATGTGCACTGGGG + Intergenic
1028631837 7:92943480-92943502 CAGATTTATTATTTTCAGTTTGG + Intergenic
1031323099 7:120357927-120357949 CAGCTTCATCATATGAAGTTTGG + Intronic
1038303808 8:26381462-26381484 CAGATTCTGTAACTGCAGTCAGG + Intergenic
1040034355 8:42854668-42854690 GAGCTTCACTATATGCAGACTGG - Exonic
1041643135 8:60224503-60224525 AAAATTCATTTTATGCAATCAGG + Intronic
1042342831 8:67698228-67698250 CAGGTTATTTTTATGCAGTCAGG - Intronic
1044599086 8:93985762-93985784 CAGACTCATTAAGTGCAGTGTGG + Intergenic
1046766990 8:118080369-118080391 TAGATTCAATATATCAAGTCTGG + Intronic
1051921473 9:22271697-22271719 CAGATTCAATATATTCATTGTGG - Intergenic
1052034389 9:23663323-23663345 CAGTCACATTTTATGCAGTCAGG - Intergenic
1053400845 9:37820434-37820456 CAGAATCACTACATGAAGTCCGG + Intronic
1053793893 9:41707241-41707263 CAGATGGATTATCTGCAGTTGGG - Intergenic
1054151279 9:61607545-61607567 CAGATGGATTATCTGCAGTTGGG + Intergenic
1054182303 9:61919256-61919278 CAGATGGATTATCTGCAGTTGGG - Intergenic
1054471059 9:65538724-65538746 CAGATGGATTATCTGCAGTTGGG + Intergenic
1054656207 9:67669223-67669245 CAGATGGATTATCTGCAGTTGGG + Intergenic
1056123005 9:83508035-83508057 TAGATTCTATAAATGCAGTCAGG - Intronic
1056361406 9:85861310-85861332 CAGATTCAGTATATGCCCTTGGG + Intergenic
1059646967 9:116277212-116277234 CTGATTGAATACATGCAGTCTGG - Intronic
1059924413 9:119193965-119193987 GAGATCCATTCTAAGCAGTCTGG + Intronic
1061372764 9:130207087-130207109 CAGATTCAGGATCTGCTGTCTGG - Intronic
1188081174 X:25842661-25842683 CAAACTCATTATATGAAGTCAGG + Intergenic
1189113050 X:38313693-38313715 GAGATTCCATATATGCAGGCAGG - Intronic
1190035781 X:47022447-47022469 CAGGTTCATTATTTGGAATCAGG + Intronic
1190773253 X:53532612-53532634 CAGAGTCAGTTTCTGCAGTCAGG - Exonic
1198196510 X:134368320-134368342 CTGATACATTGTCTGCAGTCAGG + Intergenic