ID: 1094083503

View in Genome Browser
Species Human (GRCh38)
Location 12:26563644-26563666
Sequence CAGTAAATGTTAAGTAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094083503 Original CRISPR CAGTAAATGTTAAGTAAGGA GGG (reversed) Intronic
903289327 1:22297853-22297875 CAGTAAATGTTTGGTGAGAAGGG - Intergenic
904965153 1:34366528-34366550 CAGTAAATGCTCAGGAGGGAAGG - Intergenic
907132188 1:52106956-52106978 CTGTAAATGTTAAATAACAATGG - Intergenic
907988287 1:59554384-59554406 CAGCAAATGTTAAGCAAGGGAGG - Intronic
908032639 1:60017613-60017635 CAATAAATGGTAATTAAGGAGGG - Intronic
908448879 1:64230143-64230165 CAGCAAATGTTATGAAAGGGAGG - Intronic
908573015 1:65428977-65428999 AAATAAATTTTAAGTACGGAAGG - Intronic
908940511 1:69427018-69427040 CAGTTAAGGTTTAGGAAGGATGG - Intergenic
909246920 1:73298345-73298367 CAATAATTGTTAAGTAGGGAGGG + Intergenic
909533997 1:76713483-76713505 GAGTAAATATTAATTACGGAAGG + Intergenic
910026986 1:82667170-82667192 TAAAAAATGTTAAGTCAGGAGGG + Intergenic
910371543 1:86521820-86521842 CAATAGATGTTAGGAAAGGAGGG - Intergenic
911433178 1:97819501-97819523 CTGAAAATGTTATGTAATGATGG - Intronic
912321970 1:108721661-108721683 CGGTAACTCTTAAGAAAGGAAGG + Intronic
915035132 1:152916317-152916339 CAATAAATGTTAAAAGAGGAAGG - Intergenic
917236828 1:172901804-172901826 CAGTCACTTTTAAGAAAGGAAGG + Intergenic
918621124 1:186606923-186606945 CAAAAAATGTTTAGTAAGGCTGG - Intergenic
918725153 1:187912134-187912156 CCACAGATGTTAAGTAAGGAAGG + Intergenic
923849125 1:237773917-237773939 TAGTAAATATTAAGGAAGGAAGG + Intronic
924092656 1:240517638-240517660 CATAAACTGTTAAGTAAGGTTGG - Intronic
924534365 1:244921724-244921746 CAATAAATGTTTATTAAGGAAGG - Intergenic
924871377 1:248049780-248049802 CAGTAAATCTGAAATAAGGCTGG - Intronic
1064381730 10:14848645-14848667 AAGTAAATGTTTAGTGAGTATGG + Exonic
1064382611 10:14860031-14860053 CAGTAAATATTAAGAAAACAAGG - Intronic
1067462609 10:46468761-46468783 CAGCAAATTTACAGTAAGGAGGG - Intergenic
1067624586 10:47915876-47915898 CAGCAAATTTACAGTAAGGAGGG + Intergenic
1068079589 10:52303371-52303393 CAGTAAAATTTCAGCAAGGATGG - Intergenic
1069027455 10:63558401-63558423 CATAAGATGTGAAGTAAGGATGG - Intronic
1070666255 10:78346757-78346779 CATTAAATATGAAGTAAGGATGG + Intergenic
1071729776 10:88235951-88235973 AAGTAAATGTTAATTAAGGGAGG - Intergenic
1071903097 10:90141634-90141656 TAGTAAATGTTCAGTAAATAAGG + Intergenic
1072154090 10:92707991-92708013 CATTAAATGTAAAATAATGAGGG - Intergenic
1073128692 10:101170681-101170703 CAGAAAATGTAAAGTATGTAGGG - Intergenic
1073821382 10:107268284-107268306 GAGGAAATGTGAATTAAGGAGGG - Intergenic
1074604914 10:114952443-114952465 CAATAAATAATAAGTAAGGTAGG + Intronic
1075796893 10:125126994-125127016 CAGGTACTATTAAGTAAGGAAGG + Intronic
1077186586 11:1238232-1238254 CAGTGAATGTGCACTAAGGAAGG - Intronic
1077642020 11:3889916-3889938 TAGTAAATATTAAGCAAAGACGG + Intronic
1078343540 11:10521641-10521663 TAGTAAGTGCTAAGTAAAGAAGG + Intronic
1079524691 11:21371246-21371268 CAGTAGATGATAAGTGAGGCAGG - Intronic
1081880243 11:46443828-46443850 AAGTAAATGTTAAGTAACAATGG - Intronic
1082900036 11:58238382-58238404 TAATAAATGTAAAGCAAGGATGG - Intergenic
1084290505 11:68162630-68162652 CAGTGAATGTTTTGGAAGGAGGG - Intronic
1085352457 11:75808240-75808262 TAATAAATGTTTAGTAAGAAAGG - Intergenic
1086225730 11:84506393-84506415 CAGTAAAAGATATGTGAGGACGG + Intronic
1086330181 11:85746145-85746167 CAGTAAATGCTTGGTAATGATGG - Intronic
1087606082 11:100380054-100380076 CAGAAAATGATAAGTATGAAGGG + Intergenic
1087627827 11:100617104-100617126 CAGAAAAAGTTAAGAAAGCAAGG + Intergenic
1087889586 11:103521872-103521894 GAGTAATTTTTAAGTAAGAAAGG - Intergenic
1087955556 11:104282622-104282644 CAGAAAATGATATGTAAGCAAGG - Intergenic
1089206120 11:116764397-116764419 CAGTAAATCTGAAGGAAGCAAGG + Intronic
1089573972 11:119428335-119428357 CAGGCAATTTCAAGTAAGGAGGG + Intergenic
1089747736 11:120628820-120628842 AAATAAATGTGAAGTAAAGAGGG + Intronic
1090641270 11:128730861-128730883 CAGCAAAGGCTAAGAAAGGATGG - Intronic
1091278032 11:134365358-134365380 CAGGAAATGCCAAGAAAGGAAGG - Intronic
1091975722 12:4823050-4823072 CAGGAAATGTTCAGTCAGGTTGG + Intronic
1092836372 12:12492910-12492932 AAGTAAATATTGAGGAAGGAAGG - Intronic
1093203071 12:16213251-16213273 TAGTAAGTGTTCAGTAAAGATGG - Intronic
1094083503 12:26563644-26563666 CAGTAAATGTTAAGTAAGGAGGG - Intronic
1094589075 12:31804412-31804434 CAGTAAATGGGAGGGAAGGAGGG - Intergenic
1094687807 12:32736025-32736047 CTGTAGATGTTAATTAATGATGG - Intronic
1094787578 12:33867248-33867270 AAGTAAATATTAAGTAAATATGG - Intergenic
1097183474 12:57184075-57184097 CAGTAGATGTTGCCTAAGGAGGG - Exonic
1097585733 12:61513938-61513960 AAGAAAATGTTAAGTGAGGAGGG - Intergenic
1098461024 12:70733037-70733059 CAGGAAATGAAAAGTAAGGCAGG + Intronic
1099509727 12:83518600-83518622 CAGTAAATGTCAACTATAGAAGG - Intergenic
1100425265 12:94478950-94478972 CAGTAACTTTTATGTAAGAAAGG + Intergenic
1101995435 12:109522164-109522186 CCGTTAATGGTAAGTGAGGAGGG + Intronic
1103214801 12:119193780-119193802 CTCCAAATGTTGAGTAAGGAGGG - Exonic
1104569722 12:129914607-129914629 CAGTATTTGTTAAATCAGGATGG - Intergenic
1105299980 13:19124756-19124778 CAGTAAAAGTATAGTAAAGACGG + Intergenic
1105915855 13:24915205-24915227 CAGGAAATTTTAAGAAATGAGGG - Intronic
1106745759 13:32704710-32704732 CAATAAATTTTACGGAAGGAGGG - Intronic
1107152454 13:37127951-37127973 GAGTAAGTTTTAAGTAAGGCTGG - Intergenic
1107571788 13:41668395-41668417 CAGCAAGTGTTAAGTAAGCAGGG + Intronic
1109138588 13:58683716-58683738 CTTTAAATGATAAGGAAGGAGGG - Intergenic
1110352701 13:74528236-74528258 CAGAAACTGTTAAGTGTGGAAGG - Intergenic
1111117150 13:83794148-83794170 CATTTAATATTAATTAAGGATGG - Intergenic
1111291223 13:86172451-86172473 CAGAAAATGCTGAGTAGGGATGG - Intergenic
1112634115 13:101196098-101196120 CAATTAATGGAAAGTAAGGAAGG - Intronic
1114251906 14:20968956-20968978 CAGTTCATGTGAAGTATGGAGGG - Intergenic
1114809470 14:25880559-25880581 CAGTGCATGTGAAGTAAAGATGG - Intergenic
1116599441 14:46901134-46901156 TAGTAAATTTTAAGAATGGAAGG + Intronic
1117174739 14:53134520-53134542 CAGTAACTGTTTGTTAAGGAAGG - Intronic
1117269965 14:54133666-54133688 CAGTAAGAGTTAAGTAGAGATGG + Intergenic
1118099998 14:62587332-62587354 CACTAAATGTTATATTAGGAAGG - Intergenic
1118894121 14:69931642-69931664 CATTAGATGTTTAGAAAGGATGG + Intronic
1119153738 14:72389298-72389320 GAGTAGATGCTAAGTAAAGAAGG - Intronic
1119474502 14:74919357-74919379 CAGTAAGTGTTCAGTGAGGGTGG - Intronic
1120028332 14:79611233-79611255 TAGTACATGTTAAGTGAGAAAGG + Intronic
1120115549 14:80613184-80613206 AAGTACTTGTTAAGTAATGATGG + Intronic
1124836095 15:33197388-33197410 CAGTAACTGTTTATTAAGCAAGG - Intergenic
1126545062 15:49864157-49864179 CAGTACATATTAAGTAAGAGTGG + Intronic
1127492566 15:59479129-59479151 CAGTCAATGCTAAGTAACCAAGG + Intronic
1130351835 15:83099701-83099723 CAATTAATGTTAACTGAGGAGGG - Intergenic
1134012857 16:10868223-10868245 CTTTAAGTGTTAAATAAGGATGG - Intergenic
1134246818 16:12546180-12546202 CAGGGAATGTAAAGTAACGAGGG + Intronic
1134672029 16:16062914-16062936 CAGAAAATGTTAAATATTGACGG - Intronic
1136291241 16:29272799-29272821 CAGCAAATGTTAAATAAAGAAGG - Intergenic
1138910344 16:61389419-61389441 CAGGAAAATTTAAGGAAGGAGGG + Intergenic
1140055478 16:71521940-71521962 CTGGAAATGTTTAGGAAGGAGGG - Intronic
1141398422 16:83725151-83725173 CAGTCAAAGTCAAGGAAGGAAGG + Intronic
1142097114 16:88246265-88246287 CAGCAAATGTTAAATACAGAAGG - Intergenic
1142158264 16:88542885-88542907 CTGTAAATGTTCATTAATGAGGG + Intergenic
1142682096 17:1556082-1556104 TAGAAACTGTTAAGTCAGGATGG + Intronic
1143285222 17:5784181-5784203 CAGTTGATGTTAAGGAAGGGAGG - Intronic
1146131188 17:30277137-30277159 CAGTAAATCTTAATAAAGGAAGG - Intronic
1146927102 17:36752761-36752783 CAGCAAATGTTAACTAAGGTTGG - Intergenic
1148915779 17:50977216-50977238 CAGTACCTGTAAAGAAAGGAGGG + Exonic
1148981747 17:51582624-51582646 AAGGAAATGTTAAGTATGTAAGG - Intergenic
1150297078 17:64017128-64017150 CAGTAAAAGGAAAGGAAGGAAGG + Intronic
1151039143 17:70838231-70838253 CAGTAATTGTTAAGGAAAAATGG + Intergenic
1151094674 17:71482858-71482880 CAATAAATGTTCAGTAATTATGG + Intergenic
1152428386 17:80232064-80232086 CAATAACTGGTAAGTAAGAAAGG - Intronic
1152918549 17:83053963-83053985 CAGGAAATGTACAGGAAGGAAGG - Intergenic
1153140507 18:1967130-1967152 TGCTAATTGTTAAGTAAGGAGGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1156916359 18:42467602-42467624 CAGCAATTGTTCACTAAGGAGGG - Intergenic
1157556163 18:48614079-48614101 CAGTGAAAGTCAAGAAAGGATGG - Intronic
1159206292 18:65257124-65257146 GAGTAAATGTTCTGTAAAGAGGG - Intergenic
1159309014 18:66683910-66683932 CACTAAATGGTAACTTAGGATGG + Intergenic
1159314319 18:66751784-66751806 AAGTAAATCTTAATTAAGCAAGG - Intergenic
1159358371 18:67366646-67366668 CAGTAAATGTTCTGTAAGTAAGG - Intergenic
1159570702 18:70109327-70109349 TATTAATAGTTAAGTAAGGAAGG - Intronic
1159758535 18:72395680-72395702 CAGTAAATGTGAACTAAAAAAGG - Intergenic
1159982198 18:74796912-74796934 CAGCAAATGTTAAGAAAGTACGG + Intronic
1162262856 19:9546673-9546695 CAGCAATTGTTCACTAAGGAGGG - Intergenic
1165564708 19:36714537-36714559 AAGGAAATGTTAAGTAAGTAAGG - Intronic
1165660432 19:37574778-37574800 CAGTAAAAGTGAGATAAGGAAGG - Intronic
1165991444 19:39817192-39817214 TAGTAAATGTAAAGAAATGAGGG + Intergenic
1167038057 19:47005793-47005815 CAGTCAGGGGTAAGTAAGGAGGG - Intergenic
927193084 2:20530377-20530399 CAGTAAATGTTGATTGAGGCCGG - Intergenic
927335275 2:21915539-21915561 CAGTAAATATTTAGTAGGCACGG + Intergenic
929797424 2:45071011-45071033 CAGCCTATGTTAAATAAGGAGGG - Intergenic
931532701 2:63234122-63234144 CAGTAAATACTAAATAAGGGTGG + Intronic
932484440 2:72074606-72074628 CAGTTTAGGTTAAGTCAGGAAGG - Intergenic
932907748 2:75771904-75771926 CAAAAAATGTTATGTAAGTAAGG + Intergenic
934227354 2:90145758-90145780 CAGCAATTGTTCACTAAGGAGGG + Intergenic
935680032 2:105628068-105628090 CAGTAAATGCTAGGGGAGGAGGG - Intergenic
936480550 2:112880912-112880934 CAGGAAATCATAAGTCAGGAGGG + Intergenic
936718057 2:115213485-115213507 CAGTATATGATCAGTCAGGATGG - Intronic
937855682 2:126670711-126670733 CAGTAAATGTTAACCAGGGAGGG + Intronic
940468029 2:154057835-154057857 CACTAAATGTTTATTAGGGAAGG + Intronic
941201095 2:162511788-162511810 CAGTGAATTCTAAGTAATGACGG + Intronic
941700952 2:168604150-168604172 AAGTATATCTTAATTAAGGATGG - Intronic
942385971 2:175443373-175443395 TAATAAATGTTAATTAATGATGG + Intergenic
944504037 2:200391279-200391301 CAGTAAGTTTGAAGTAATGACGG - Intronic
945448499 2:209966135-209966157 CAGTACATGTTGAGTTAGGCAGG - Intronic
945702017 2:213183440-213183462 AAGTAAATGTTGAGTATAGAGGG + Intergenic
947649341 2:231771822-231771844 AAGTACTTGTTAAGTAAGAAAGG + Intronic
947771380 2:232673054-232673076 GAATCAATGTTAAGTCAGGAAGG - Intronic
947877326 2:233476471-233476493 AAGAAAATGTAAACTAAGGAAGG - Exonic
1172056368 20:32157247-32157269 CAGAAAATGTTCAGGAAGGCCGG - Intronic
1173199130 20:40941307-40941329 CAGCAGATGTTTAGTGAGGAAGG - Intergenic
1173409356 20:42795864-42795886 CAGTGAATATTAAGTAAAAACGG + Intronic
1183134646 22:35874913-35874935 TAATTAATGTTAAGTAAGGTGGG + Intronic
949183979 3:1168316-1168338 CAGTAAATGGTAAGTGAGACAGG + Intronic
950916868 3:16654994-16655016 TTATAAATGTTATGTAAGGATGG + Intronic
953731784 3:45456157-45456179 CAAAAAATGTTAAGTAAGTGAGG + Intronic
955012769 3:55035882-55035904 CAGTAACTGATGAGTGAGGATGG + Intronic
956242590 3:67147157-67147179 CAATAAATATGAAGGAAGGAAGG - Intergenic
956499968 3:69871664-69871686 CAGTAATTGTTAAGTGATGGTGG + Intronic
956502087 3:69897794-69897816 CAATAAATGTTAATTTATGAGGG - Intronic
956510321 3:69986106-69986128 CAGCAAAATTTAAGTTAGGAAGG + Intergenic
956555213 3:70513917-70513939 CAATAAATATTTATTAAGGAAGG + Intergenic
957729931 3:84121022-84121044 CAGCAAAAGTTACATAAGGAAGG - Intergenic
960078679 3:113516724-113516746 TAGTAAGTGTAAAGTAGGGATGG - Intergenic
961973086 3:130990934-130990956 GAGGAAATGTGAAGTAGGGATGG + Intronic
962596637 3:136953006-136953028 CAGTAATCATTGAGTAAGGATGG + Intronic
965335690 3:167429036-167429058 CAGCAATTGTTCACTAAGGAGGG - Intergenic
965653701 3:170961131-170961153 CAATAAATGTTAAGTAAAATGGG + Intergenic
966051585 3:175622825-175622847 CAGTAAATTTTAAGAAATGATGG + Intronic
966646877 3:182255908-182255930 CAGTGAATGTTAGGTGAGGTGGG + Intergenic
966913703 3:184573330-184573352 CAGAGAATGTTGTGTAAGGAGGG + Intronic
967008294 3:185406277-185406299 CAGTACAATTTAATTAAGGAAGG - Intronic
970360696 4:15305934-15305956 AAGAAACTGTTAACTAAGGAAGG + Intergenic
970538315 4:17052665-17052687 GAGTAAGAGTTAACTAAGGAAGG + Intergenic
970625602 4:17875546-17875568 CAGTAACTGTTATTTACGGAAGG - Intronic
973025386 4:45262627-45262649 CTGTAAATATTGAGTTAGGAAGG + Intergenic
974393810 4:61309149-61309171 CAGAAAATGTTAAGAAAGAAGGG + Intronic
975067977 4:70093501-70093523 CAGTCAATGTTTACTGAGGAAGG + Intergenic
975166450 4:71183180-71183202 CAGTTAATGTCAAGGAAGGCAGG - Intergenic
975242780 4:72081411-72081433 CAGTGAAGGTTCAGTCAGGAAGG - Intronic
975640152 4:76492221-76492243 CAGCAAATGTCAAGGAAGGTGGG - Intronic
975691731 4:76971954-76971976 AAGTAATTGTTAACTAAAGATGG + Intronic
976172972 4:82323785-82323807 CAGTATAAGTTAAGTAGGAAAGG - Intergenic
976510946 4:85909632-85909654 CATTAAGTGTTAATTAATGATGG + Intronic
976953141 4:90858824-90858846 CAGTAAATGATAAGCAAATATGG - Intronic
977693403 4:99941282-99941304 AACTAAATGTTAACTAAGCATGG + Intronic
978839229 4:113190120-113190142 AAGTAAATGCTAAGTAAAAATGG - Intronic
979311603 4:119210452-119210474 CTGTAATTGCTAAATAAGGAAGG + Intronic
979353350 4:119672211-119672233 CAGTAAATGGTACATAAAGAAGG - Intergenic
979592966 4:122501571-122501593 CAGTAAGAGTTGATTAAGGAGGG + Intergenic
980200366 4:129649595-129649617 AAGTAAATGTAATGTAAGGAAGG + Intergenic
983997438 4:174201768-174201790 CAGTAAATGTGAACTTAGCATGG + Intergenic
984511864 4:180688745-180688767 CAGTATATGTTAAGCAATGTGGG + Intergenic
984631650 4:182067101-182067123 CAGCAAATGTAAAGGAAGGATGG - Intergenic
985946523 5:3188992-3189014 CAGTTAATGCTGTGTAAGGATGG + Intergenic
987213434 5:15708231-15708253 CAGACAATGTTGAGAAAGGATGG - Intronic
989807986 5:45635531-45635553 AAGTAGACGTTGAGTAAGGAAGG - Intronic
990992630 5:61700603-61700625 TAGCAAAGGTTAGGTAAGGAAGG - Intronic
991647608 5:68817000-68817022 CAGCTAATGATAAGTAATGATGG + Intergenic
993913724 5:93715051-93715073 TAGTAAAAGTTAATTAAGGGAGG - Intronic
994400423 5:99272978-99273000 CAGAAAAAGTTAAATAAAGAAGG - Intergenic
995252793 5:110013724-110013746 CAGTAAATGGCAAATGAGGAAGG - Intergenic
996453021 5:123648531-123648553 CAGAGAATGTAAAGTGAGGAGGG + Intergenic
997844740 5:137276284-137276306 GAGTAAATGTTAACAAAAGAAGG - Intronic
998490900 5:142545479-142545501 CAGTAAATGACAGGTAAGGCTGG + Intergenic
998830614 5:146154367-146154389 CAGAAAATGGTAAGTACGTAAGG + Intronic
998849881 5:146342509-146342531 CATTAAATTTTAAATCAGGAAGG - Intergenic
1000313559 5:160067828-160067850 AAGTAAGTGTTAAGGAAGGAAGG + Intronic
1002965251 6:1958906-1958928 CAGTAAATCAGAAGTAATGATGG + Intronic
1003552930 6:7115020-7115042 CATTAACTGTTAAGCAAGTAAGG - Intronic
1005245834 6:23883913-23883935 CAGCAAATCTTAAGCAAGCAGGG + Intergenic
1005639644 6:27783750-27783772 CAAAAACTGTTAAGTAAGGATGG + Intergenic
1006969962 6:38032547-38032569 CAGTACATTTTAAGTAAAGTAGG - Intronic
1009425345 6:63507469-63507491 CAGTAAGTGATAAGTTTGGATGG - Intergenic
1009636766 6:66276349-66276371 CACTAATTTTTAAATAAGGATGG + Intergenic
1010682649 6:78814920-78814942 GAGAAAATGATAAGTATGGAAGG + Intergenic
1011074864 6:83428357-83428379 AAGAAAATGTTAATTAATGAAGG + Intronic
1011767744 6:90641877-90641899 CAGGAAAGGTTAAGTAGAGATGG + Intergenic
1013219117 6:108061370-108061392 AAGAAAATGTGAAGTAGGGAGGG - Intronic
1013280268 6:108629687-108629709 CAGGAGATATTAAGTAAGAAAGG + Intronic
1015037556 6:128675224-128675246 CAGGAAGTGTCAGGTAAGGAAGG - Intergenic
1016033814 6:139364486-139364508 CAGGAAATGGTAAGTGGGGATGG + Intergenic
1017313021 6:152996594-152996616 AAGAATATGTTAGGTAAGGAAGG - Intronic
1018279912 6:162174039-162174061 GAGTAAATGTTAAGGAAGAGAGG + Intronic
1018503300 6:164436913-164436935 CAGTAAGTGTGAAATTAGGAAGG + Intergenic
1020777667 7:12474816-12474838 CAGTGAATGTTCAGAGAGGAAGG - Intergenic
1021485436 7:21163056-21163078 CAGTAAAAGATAAGTAACTATGG - Intergenic
1026002537 7:66572607-66572629 CAGTGAATGTGAAATAATGAGGG - Intergenic
1027208916 7:76127862-76127884 CAGTCAATGTGAAATAATGAGGG - Intergenic
1027634005 7:80646206-80646228 CATTAAATGATAAGCAAGTATGG - Intronic
1027980858 7:85219964-85219986 TAGGAAATGTTAAATAAGCAAGG + Intergenic
1028214827 7:88118860-88118882 CAGTAAATCATAAGTAATGTTGG - Intronic
1028733644 7:94181646-94181668 CATAAAATGTTAAATGAGGAGGG - Intergenic
1030066220 7:105661265-105661287 CATTAAATGTTGAGTAAAGATGG + Intronic
1030519654 7:110582038-110582060 CATTAAATGTTAGGAAAGAATGG + Intergenic
1038322569 8:26541377-26541399 AAGTAAATGATAAGTAAGTTAGG - Intronic
1038943538 8:32331977-32331999 CAGTAAAGGATAAAGAAGGATGG + Intronic
1039197513 8:35048867-35048889 TAGTAAATGTTAAGAAAACAGGG + Intergenic
1039197693 8:35050654-35050676 AAGGAAATGTTAGGCAAGGAAGG - Intergenic
1041172716 8:55161383-55161405 CAGTCACTGTGATGTAAGGAGGG - Intronic
1041491847 8:58441438-58441460 CAATAAATATTAAGTAAAAATGG - Intronic
1043854869 8:85253628-85253650 GAGGAAATGCCAAGTAAGGAGGG + Intronic
1044040490 8:87362074-87362096 AAGTAGATTTTAAGTAAGCATGG - Intronic
1046592142 8:116219594-116219616 CAGTAATTGTTTTTTAAGGATGG + Intergenic
1046952663 8:120032991-120033013 CAGTAAAAGAGAAGTGAGGATGG + Intronic
1047678674 8:127231031-127231053 CAGCAAGTGTTTAGTAAGGGAGG + Intergenic
1049294885 8:141827273-141827295 CTGTAAATGTTTATCAAGGAAGG + Intergenic
1049948045 9:617273-617295 AAATAAATGTTAAACAAGGAAGG - Intronic
1050361475 9:4835264-4835286 AAGCAAGAGTTAAGTAAGGAGGG + Intronic
1050667878 9:7961836-7961858 CAGTAAATGATCAGTAAACATGG + Intergenic
1051110885 9:13634397-13634419 CAGTAAATGATAAAAATGGAGGG + Intergenic
1052779777 9:32769333-32769355 CAAAAAATGTTAAGTATGGGAGG + Intergenic
1053682151 9:40492735-40492757 CAGTACATGATATGCAAGGATGG - Intergenic
1055443896 9:76363771-76363793 CAGTAAATGGTAAGGAGGGGAGG + Intergenic
1055444013 9:76364903-76364925 CAGTAAATGGTAAGGAGGGGAGG - Intergenic
1055628609 9:78200235-78200257 CAGTAAATGTTTGGAAATGAGGG + Intergenic
1058707175 9:107647119-107647141 CTGTACATGTTCAGTAAAGATGG - Intergenic
1059420511 9:114187673-114187695 CAATAATTGTTAAGTGAGGAAGG - Intronic
1185826036 X:3250590-3250612 CAGTAAATAAAAAGTATGGATGG - Intergenic
1188952474 X:36393091-36393113 CAGTGAATATTAAGAAAGTATGG + Intergenic
1189264668 X:39704932-39704954 CAGAAAATGATAGGTAAGCAAGG + Intergenic
1190790564 X:53696197-53696219 CAGAAATTGTTAAGAAAGGCAGG - Intergenic
1194381753 X:93200814-93200836 AAGTAAATATTAAGTCAAGATGG - Intergenic
1194584599 X:95717163-95717185 CAGTGACTGATAAGGAAGGAAGG + Intergenic
1195613886 X:106897542-106897564 CAGCAAGTGTGCAGTAAGGAGGG + Intronic
1197314490 X:124947941-124947963 CAGTAAATGCTTAGTTAGGAAGG + Intronic
1198509260 X:137333012-137333034 CAATAACTGTCAAGTAAAGAGGG - Intergenic
1201624149 Y:15995523-15995545 CTGTCAATGGTATGTAAGGATGG + Intergenic
1201888349 Y:18912832-18912854 CAGCAAATATAAACTAAGGATGG + Intergenic