ID: 1094084168

View in Genome Browser
Species Human (GRCh38)
Location 12:26571201-26571223
Sequence AAAATCTAACATGATATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 420}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094084167_1094084168 6 Left 1094084167 12:26571172-26571194 CCTTTAAAAGTTTAAAACATTTT 0: 1
1: 0
2: 13
3: 137
4: 1510
Right 1094084168 12:26571201-26571223 AAAATCTAACATGATATACATGG 0: 1
1: 0
2: 0
3: 36
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094084168 Original CRISPR AAAATCTAACATGATATACA TGG Intronic
900012009 1:121815-121837 AAAATATAAAATTATATACGAGG + Intergenic
900042069 1:477828-477850 AAAATATAAAATTATATACGAGG + Intergenic
900063507 1:712774-712796 AAAATATAAAATTATATACGAGG + Intergenic
901619778 1:10574490-10574512 AAAAGCTGAGATGATATACATGG - Intronic
902763061 1:18597037-18597059 AAAAACTAAAAAGATAAACAAGG + Intergenic
905902036 1:41588119-41588141 AAAATCAGACATGGTAGACATGG + Intronic
908178706 1:61582278-61582300 AAAATGTAAAATTACATACATGG + Intergenic
908582726 1:65533132-65533154 AACATCTAACAAGATGTTCAGGG + Intronic
908815281 1:68025665-68025687 GAAATTTAAAATTATATACATGG - Intergenic
909317678 1:74245090-74245112 AAAATCTCACATAATATCTACGG + Intronic
909731611 1:78899054-78899076 GAGATCTAACATCATATAGATGG - Intronic
910781801 1:90945201-90945223 AAAATCTTAATTGATATATAAGG - Intronic
911572135 1:99530338-99530360 AAAATTAATAATGATATACATGG - Intergenic
911653151 1:100412328-100412350 TAGATCTGAAATGATATACAAGG + Intronic
911775584 1:101807334-101807356 AGAAAATAACATGATATAAATGG - Intronic
912937528 1:114016697-114016719 AAAATTCAAAATGATATTCAGGG + Intergenic
914956315 1:152165782-152165804 AAACTTTAACATGCTATTCAAGG + Intergenic
915159132 1:153904342-153904364 AAACTCTAATATGATAGAAATGG + Intronic
915485501 1:156217328-156217350 AAAATATAACATATTTTACAAGG - Intronic
915846104 1:159266803-159266825 AAAGCCTAACATGTTAGACAAGG + Intergenic
916269855 1:162928808-162928830 ATAATCTAACAGGAGACACATGG + Intergenic
916516956 1:165527416-165527438 AAGATCTAACATTATAAAGAAGG - Intergenic
916605352 1:166337192-166337214 AAATTGTGACATCATATACAGGG + Intergenic
917774042 1:178314466-178314488 TAAATAAAACATGATCTACAGGG + Intronic
918055733 1:181020453-181020475 AAAATGTAAAATGACATACATGG + Intronic
919016209 1:192040418-192040440 AAAATCATAAATGATTTACATGG + Intergenic
919183881 1:194119076-194119098 AAAATCAAAAATAATAGACATGG - Intergenic
919243049 1:194939388-194939410 AAAATCAAACATGTTGTATAGGG - Intergenic
919313474 1:195942121-195942143 AAAATGTAACTTCATATACTAGG - Intergenic
919498349 1:198305943-198305965 AAATTCTAACTTGATCTGCAGGG - Intronic
919554981 1:199040069-199040091 AAAATGTAATCTGATATGCAGGG - Intergenic
919715082 1:200767896-200767918 TTACTCTAACATGATAAACATGG - Intronic
919729216 1:200902182-200902204 AAAAGCCAACACGATATGCAGGG - Intronic
920192504 1:204202544-204202566 GAGATATAACATGACATACATGG - Intronic
920780532 1:208986838-208986860 AAAATCAAACATCAAATTCAAGG - Intergenic
920780543 1:208986982-208987004 AAAATCAAACATCAAATTCAAGG - Intergenic
921517829 1:216119432-216119454 ATAATATAACATTATATATATGG + Intronic
921635439 1:217487073-217487095 AAAATAAAATATGAAATACAGGG - Intronic
921676384 1:217981037-217981059 AAAATCTAACTTGAAAGCCAGGG + Intergenic
922260436 1:223938297-223938319 AAAATATAAAATTATATACGAGG + Intergenic
922733237 1:227964634-227964656 AAAATATAAAATTATATACGAGG - Intergenic
923230371 1:231980941-231980963 AAAATTTAACCTAATATAAAAGG - Intronic
923482680 1:234398329-234398351 AAAATCTAACCAGATCAACAAGG + Intronic
923809057 1:237292312-237292334 AATTTGTAACATGATATAAATGG - Intronic
924160381 1:241225453-241225475 AAAATGGAACAAGATATACTAGG + Intronic
924341611 1:243040487-243040509 AAAATATAAAATTATATACGAGG + Intergenic
924836656 1:247655087-247655109 AAAATGTAACATGATATATTAGG - Intergenic
924951528 1:248889083-248889105 AAAATAAAAAATGAAATACATGG + Intergenic
1063110115 10:3028302-3028324 CAAATTTAACCTTATATACAAGG - Intergenic
1063135342 10:3211732-3211754 AAAATCTAAAATGATAATAATGG - Intergenic
1063521956 10:6749071-6749093 AAAATCCAACATGAGATTAAAGG - Intergenic
1063929420 10:11014364-11014386 GAAATGTCACAAGATATACAAGG + Intronic
1064823787 10:19371614-19371636 AAAATCTAGCAATATATAGAAGG - Intronic
1064891042 10:20174074-20174096 AAAGTGTAACATGAAATAAAAGG + Intronic
1065040204 10:21686197-21686219 AAAACCAAACATGAAATACAAGG + Intronic
1065416548 10:25494166-25494188 AAAATCTAACATGATACCTGAGG + Intronic
1065648072 10:27857550-27857572 AAAATTTAATATTACATACATGG + Intronic
1066734866 10:38465064-38465086 AAAATATAAAATTATATACGAGG - Intergenic
1068267327 10:54669305-54669327 AAAATATAATATGATCTAGAAGG - Intronic
1068624446 10:59226295-59226317 AAAATAAATGATGATATACATGG + Intronic
1068909480 10:62363497-62363519 AATAGCAAACATCATATACATGG + Intergenic
1069287795 10:66738029-66738051 AAAATCTAACAGTATATTCTAGG + Intronic
1070114820 10:73518153-73518175 AAAATCCAGGATGCTATACAGGG + Intronic
1070701876 10:78609435-78609457 AAAATCTAGCAATATATAAAAGG - Intergenic
1070905378 10:80067720-80067742 AAAATAAATCATGATATATAGGG - Intergenic
1071010857 10:80938575-80938597 AAAAGCAAATATGATATAAATGG - Intergenic
1071148901 10:82609821-82609843 GAAAACTAATATTATATACAAGG - Intronic
1071186426 10:83051386-83051408 AAAATGTAACTTGATTTATATGG + Intergenic
1071551296 10:86568255-86568277 AAAATAAATCATGATATATAGGG + Intergenic
1074690514 10:116000151-116000173 AAAATTTAAAATTACATACATGG + Intergenic
1075553848 10:123414528-123414550 AAAATATTACATAACATACATGG + Intergenic
1076018328 10:127047375-127047397 AATATGTAGCATTATATACAAGG - Intronic
1076968340 11:114035-114057 AAAATATAAAATTATATACGAGG + Intergenic
1077650922 11:3971566-3971588 AAGATGTAACGTGATATCCATGG + Intronic
1077941147 11:6844913-6844935 AGAATCTTAAATGATATAAAAGG - Intergenic
1078952567 11:16151175-16151197 AACATCTAAGATGATTTAAAAGG + Intronic
1079491457 11:20993118-20993140 AAACTCTTACATGATATTCATGG + Intronic
1079550375 11:21689287-21689309 AATTTCTAATATAATATACATGG + Intergenic
1080302130 11:30796533-30796555 TAAATTTCACATGATATAAATGG + Intergenic
1080913558 11:36630659-36630681 AAAATCAAAGATGTTCTACAAGG - Intronic
1081779201 11:45698432-45698454 ATAATCTAAGATCATATAAAAGG + Intergenic
1086368947 11:86137017-86137039 AAATTCTAGCATGCTATTCAAGG + Intergenic
1087209312 11:95430406-95430428 AAAATTTAAAATTACATACATGG - Intergenic
1088465897 11:110138397-110138419 AAAATTTAATATGACATACATGG - Intronic
1088769609 11:113020500-113020522 AAAATATAACAAAATATATAAGG - Intronic
1089119189 11:116120474-116120496 AAAATATAAAATTATATACGTGG + Intergenic
1089228093 11:116943869-116943891 AAAATCTGAAATTATATAAATGG - Intronic
1089763278 11:120744365-120744387 AAAGGCTAACATGATTGACAAGG - Intronic
1090087202 11:123661229-123661251 AAAATCTAAGAAAATAGACATGG + Intergenic
1090595172 11:128313366-128313388 AAAATTTAAAATTATATACATGG + Intergenic
1092521313 12:9276240-9276262 AAAATATAACATTTAATACATGG + Intergenic
1094084168 12:26571201-26571223 AAAATCTAACATGATATACATGG + Intronic
1094463582 12:30725928-30725950 AAAATCTTAAATGATATTCATGG - Intronic
1094464365 12:30736235-30736257 AAAGTCTGACATAATATTCATGG + Intronic
1095248672 12:39952975-39952997 AAAAAAAATCATGATATACAAGG - Intronic
1095435800 12:42186387-42186409 AAAATCAAATATGGTATATAAGG + Intronic
1097407298 12:59205166-59205188 ACAATCTAACATTATATGTAAGG + Intergenic
1097523028 12:60691926-60691948 AAACTTTAAAATGATAAACATGG + Intergenic
1097618887 12:61915974-61915996 AAACTCTGACTTGATTTACATGG - Intronic
1097674975 12:62590476-62590498 AAACTGTAAAATGATATACAGGG + Intronic
1097743839 12:63277326-63277348 AAAAGGTAACATCACATACATGG + Intergenic
1098860582 12:75705613-75705635 AAAATCCAAAATCATAGACAAGG - Intergenic
1099141237 12:78978180-78978202 GAAAGCAAACATGTTATACAAGG - Intronic
1099141646 12:78984167-78984189 AAAATCTAAGATGTAATAAAGGG - Intronic
1099567346 12:84269474-84269496 CAACTCTAAGATGGTATACAAGG - Intergenic
1099639447 12:85267214-85267236 AAAATGTAAAATTACATACATGG - Intergenic
1100113911 12:91279553-91279575 AAGATCTAAGCTGAGATACATGG + Intergenic
1100124491 12:91407217-91407239 AAAATGTAACATGATCAAGAGGG - Intergenic
1100591299 12:96032683-96032705 ATAATGTTACATGTTATACAAGG - Intronic
1102813557 12:115844209-115844231 AAGTTCTACCATGACATACAAGG + Intergenic
1104118062 12:125769393-125769415 AAAATGTAACATAAGATACTTGG - Intergenic
1105872882 13:24523610-24523632 AAAATATTACATGATATGCAGGG - Intergenic
1106280818 13:28268233-28268255 AAGATGTAATATGATATAAAAGG - Intronic
1106429075 13:29662304-29662326 AAAATAAATCACGATATACAAGG - Intergenic
1106668516 13:31879621-31879643 AAAATTTAAAATTATATATATGG - Intergenic
1106781910 13:33067307-33067329 AAAATTTAAAATGAAATACATGG - Intergenic
1106977155 13:35233303-35233325 AAAAGCAAAAAAGATATACAAGG - Intronic
1108908507 13:55510834-55510856 AAAATCTAACATAATATGTTTGG - Intergenic
1109005542 13:56870693-56870715 AAAATCTAAAATGAAATAATTGG + Intergenic
1109034441 13:57236706-57236728 AAAGTCTAAAATAATATATAAGG + Intergenic
1109118573 13:58424126-58424148 AAAGTAAAACAAGATATACATGG - Intergenic
1109625795 13:64972436-64972458 AAAAACTACAATGATATACCAGG - Intergenic
1109638609 13:65156094-65156116 AAAATATAAAATGATTTAAATGG + Intergenic
1110078066 13:71275152-71275174 AATGTCCATCATGATATACAAGG - Intergenic
1110346615 13:74455442-74455464 AATAACTAACATGATATTGAAGG + Intergenic
1110988566 13:82007611-82007633 AAAATCTAACATTTGATTCAGGG + Intergenic
1111179795 13:84649473-84649495 AAAATTTTACATGAATTACATGG + Intergenic
1111235481 13:85402596-85402618 AAAATATAAGATAATAGACAAGG - Intergenic
1111271991 13:85897621-85897643 AAAATCAAACATGAATTGCAAGG + Intergenic
1111523928 13:89442040-89442062 AAAATTTAAAATTATATATATGG - Intergenic
1111651971 13:91103155-91103177 AAAAACTAACATATTAGACATGG + Intergenic
1114229406 14:20766976-20766998 AAAGTAAAACATGATATACAGGG - Intergenic
1114832882 14:26165959-26165981 AAAATCTAAGATGCTTTAAAAGG + Intergenic
1114995633 14:28348546-28348568 AGAATCTTACATGTTATACTAGG - Intergenic
1115011300 14:28549026-28549048 AAAATGCAAGATAATATACAAGG - Intergenic
1115325081 14:32128740-32128762 AAAATCTAACAGCATATTAAAGG - Intronic
1116565646 14:46440869-46440891 AAAATCTAAAAAGACAGACAAGG + Intergenic
1116970292 14:51057664-51057686 AAAATAAAACATGATTTTCATGG - Intronic
1117209690 14:53482625-53482647 AAAGTAAATCATGATATACAGGG + Intergenic
1119425846 14:74534249-74534271 AAACCCTAACATGGTATCCAAGG + Intronic
1120026285 14:79588439-79588461 AAAAACTAACAGGATATAGCTGG - Intronic
1120621394 14:86769250-86769272 ACAATTTAACATGTTATAAAAGG + Intergenic
1120640767 14:87009764-87009786 AAAATATAAAATGCTAGACAAGG + Intergenic
1123161009 14:106277875-106277897 AAAACCCAACATAATCTACAGGG + Intergenic
1123168680 14:106350147-106350169 AAAACCCAACATAATCTACAGGG + Intergenic
1202888623 14_KI270722v1_random:133533-133555 AAAATCTATCATGACTTTCATGG - Intergenic
1125180328 15:36875838-36875860 CAAATCTGACATGACATAAATGG - Intergenic
1125221542 15:37342436-37342458 TAAATGTAACATGATATCCTTGG - Intergenic
1125786967 15:42327430-42327452 AAAAACCAACCTGATAAACAGGG - Exonic
1126068715 15:44847000-44847022 AAAATCAAACATTATATCCAAGG + Intergenic
1126090110 15:45043797-45043819 AAAAGCAAACATTATATCCAAGG - Intronic
1126829345 15:52584113-52584135 AAAATATAAAATGATTTATATGG + Intronic
1126830164 15:52594150-52594172 AAAACCTAACAGGTTATATATGG + Intronic
1127340599 15:58039412-58039434 AATTTGTAACATGATTTACATGG - Intronic
1128435381 15:67642755-67642777 AAACTCTAGCATGACATTCAAGG - Intronic
1129564938 15:76611684-76611706 AAAATCCAAAATGAAATACTGGG + Intronic
1130345688 15:83042784-83042806 AGTATCTTAGATGATATACATGG + Intronic
1130861568 15:87895457-87895479 AAAATAAGTCATGATATACAAGG - Intronic
1131042432 15:89283705-89283727 AAAATATAAAATTACATACATGG + Intronic
1133926470 16:10196997-10197019 TAAATCCAACATGATTTAGAGGG + Intergenic
1134464868 16:14466572-14466594 AAAATGTTACCTGATAAACATGG - Intronic
1137299680 16:47136709-47136731 AGAATTTATTATGATATACATGG + Intronic
1137515445 16:49139489-49139511 CAAATCTAGCATGTTATAAATGG + Intergenic
1138192705 16:55029091-55029113 AAAAAATAACATTACATACAGGG - Intergenic
1139291094 16:65858535-65858557 AAAATTTAACATTATAGACATGG - Intergenic
1139338465 16:66250637-66250659 AAAATTCAAAATTATATACATGG + Intergenic
1140543460 16:75782631-75782653 AAAATTGAGCATGAAATACAGGG + Intergenic
1140954295 16:79847831-79847853 GAAAACTCACATGATATAAAGGG - Intergenic
1141292560 16:82733727-82733749 AAACTCTACCAGGATATAAATGG + Intronic
1141808096 16:86355316-86355338 ATAATGTAACATGATATGGATGG - Intergenic
1142452338 16:90185099-90185121 AAAATATAAAATTATATACGAGG - Intergenic
1148201901 17:45754925-45754947 AAAATTTAAAATTATATACACGG + Intergenic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1148576699 17:48717119-48717141 ATAATCTAACATTAAATAAAAGG + Intergenic
1149052083 17:52317477-52317499 AAAATCCAACATGAAATAGGGGG - Intergenic
1150146358 17:62772998-62773020 AAAACATAAAATGAGATACACGG - Intronic
1150572510 17:66399807-66399829 ATAATATAACATTATATATATGG + Intronic
1152053364 17:78000300-78000322 AAAATCTAAAAGGAAAGACAAGG - Intergenic
1152834846 17:82522742-82522764 ACATGCTAACATGATAAACATGG + Intronic
1154345138 18:13536996-13537018 AGAATCTAACAATATATAAAAGG - Intronic
1155063581 18:22249844-22249866 AAAATTTAAAATTTTATACAGGG + Intergenic
1155788714 18:29935658-29935680 AAAATCTGACATTTAATACATGG + Intergenic
1155874031 18:31062922-31062944 TAAATTTTACATGATAGACATGG - Exonic
1156214668 18:34984003-34984025 AAATACTAAAAGGATATACACGG + Intronic
1156575926 18:38315005-38315027 TACATCTAACAGGATATAGAAGG - Intergenic
1157647297 18:49288106-49288128 AAAATTTAAAATTACATACATGG + Intronic
1158161445 18:54489089-54489111 GAAATCTAAGATTATATATATGG + Intergenic
1158333474 18:56388872-56388894 AAAATTTAAAATGACATATATGG - Intergenic
1158671770 18:59481574-59481596 AAAATTACACATGATATACAGGG + Intronic
1159181387 18:64910240-64910262 AATATATACCATGATATTCAGGG + Intergenic
1160645148 19:183969-183991 AAAATATAAAATTATATACGAGG + Intergenic
1165665989 19:37628949-37628971 AAAATCCAACAAGATGTTCAGGG + Intronic
1166081990 19:40449762-40449784 AAAATCTAACTATATATTCATGG + Intronic
1166286019 19:41829067-41829089 AAAATTTCAAATCATATACAAGG - Intergenic
1166683146 19:44780451-44780473 AAAATTAAAAACGATATACATGG - Intronic
1202664021 1_KI270708v1_random:100328-100350 AAAATCTATCATGACTTTCATGG - Intergenic
926895303 2:17680618-17680640 AAGAGCTGATATGATATACAAGG - Intronic
927815738 2:26215790-26215812 AAAGTCTAAGATGGTACACAAGG + Intronic
928012209 2:27620069-27620091 AAAATTTTAAATTATATACATGG - Intronic
928679439 2:33684815-33684837 CACATCTAACATCATATAAATGG - Intergenic
930559744 2:52946533-52946555 AAAATTTAAAATTATATATATGG + Intergenic
931190363 2:59994479-59994501 AAAATTGAATGTGATATACAAGG - Intergenic
931596777 2:63954781-63954803 AAAAAATAACATGCTAAACATGG + Intronic
931669395 2:64633216-64633238 AAAGTCTAACAAGAAAGACATGG - Exonic
932146061 2:69318417-69318439 AAAATCCAAAATGATACACATGG - Intergenic
932506677 2:72239859-72239881 TAAATTTAACATGAAGTACAAGG - Intronic
932546308 2:72714239-72714261 AAAATCTAAAATAAAAGACATGG + Intronic
932708028 2:74041892-74041914 AAAATCTAAAAGGGTAAACAGGG - Intronic
932878716 2:75479336-75479358 AAAATAAAATATTATATACAGGG + Intronic
933442870 2:82335354-82335376 AAAATCTTACTTGTTATTCAAGG + Intergenic
933458852 2:82552979-82553001 AAAATTTACTCTGATATACATGG - Intergenic
934757865 2:96837394-96837416 TAAATCTAACAAAATATGCAAGG - Intronic
935987251 2:108687121-108687143 ACAATCTAAAACGAAATACAAGG - Exonic
936139304 2:109925500-109925522 ACAATCTAAAACGAAATACAAGG - Intergenic
936205392 2:110445986-110446008 ACAATCTAAAACGAAATACAAGG + Intronic
936741383 2:115514146-115514168 AAAACATAACATCACATACAAGG - Intronic
937595073 2:123662394-123662416 AAAATAAGTCATGATATACAGGG - Intergenic
937622821 2:124008599-124008621 AAAATAAAAAATTATATACATGG - Intergenic
937710572 2:124976067-124976089 AAAATATAGGATGATATTCAGGG + Intergenic
938994828 2:136667273-136667295 AAATTTTAAAATGATACACAAGG + Intergenic
939326050 2:140689883-140689905 AATTTCTAACATGATGTACTGGG + Intronic
939362080 2:141185546-141185568 AAAATCTAAAATTAAAAACAAGG + Intronic
939506596 2:143053931-143053953 CAATTCTGACATGATATACCTGG - Exonic
939608140 2:144277231-144277253 AAAATTTAAAATTATACACATGG + Intronic
939910482 2:147977174-147977196 AAAATCAAACAGTATATAAATGG + Intronic
940130162 2:150371993-150372015 AAAATCTAAAATGAAAAAAAGGG + Intergenic
940347610 2:152643623-152643645 AAAATATAACATGATGGAGATGG - Intronic
940688755 2:156887125-156887147 AACATTTAACCTGAAATACAAGG - Intergenic
941130679 2:161646589-161646611 AAATTTTAACAGGCTATACAAGG - Intronic
941178377 2:162228321-162228343 AAAATCTAGCATGGTATAGCTGG - Intronic
942205541 2:173616914-173616936 AAAATCTATAAGGATATTCATGG + Intergenic
942694279 2:178621945-178621967 AAAATATGACATCATATCCAAGG - Exonic
943742775 2:191428477-191428499 AAAATCTAACTTTATAACCAAGG + Intergenic
943856701 2:192803433-192803455 TAAATCTAACAATATATCCAAGG + Intergenic
945368292 2:208983889-208983911 AAAAGTTAAAATGATATAGAAGG - Intergenic
945458596 2:210078134-210078156 CAACTGTAACATGATAGACATGG + Intronic
945514393 2:210745005-210745027 AAAATCAAACAAAAAATACAAGG + Intergenic
945719471 2:213401560-213401582 AAATACTAACATGAAATGCAAGG - Intronic
946030629 2:216701326-216701348 AAGCACTAACAAGATATACACGG - Intergenic
949030032 2:241790588-241790610 AAAGTAAATCATGATATACAGGG - Intronic
949083780 2:242129742-242129764 AAAATATAAAATTATATACGAGG - Intergenic
1169320501 20:4629398-4629420 AAGATCTAACATGCCATCCAGGG + Intergenic
1169597494 20:7217409-7217431 AAAAAATAACATGAAATAGATGG - Intergenic
1170243924 20:14199827-14199849 AAAAACAAAAATGAGATACAGGG + Intronic
1171950808 20:31420040-31420062 AAAATCTAGTATATTATACAAGG + Intergenic
1176280365 20:64302273-64302295 AAAATATAAAATTATATACGAGG - Intergenic
1177442878 21:21150088-21150110 AAAATTTCACATAATATATAAGG - Intronic
1177614419 21:23499074-23499096 AAAATCTACCTTGATATCTAGGG + Intergenic
1177668656 21:24195676-24195698 AGAATCTAACAAGATATTGAGGG - Intergenic
1178208894 21:30504557-30504579 AAAACCAAACAAGATATAAATGG + Intergenic
1178277346 21:31251260-31251282 AAAATCAAACATCATTTGCAGGG + Intronic
1178403274 21:32305281-32305303 AAAATGTAACATTAAAAACAGGG - Intronic
1178570891 21:33736139-33736161 AAAATCTAACATCTGATTCATGG + Intronic
1179073239 21:38092961-38092983 AAAATCTAACTTTATATGAATGG + Intronic
1180330749 22:11477212-11477234 AAAATCTATCATGACTTTCATGG - Intergenic
1182655667 22:31887915-31887937 AAAAAATAACATGATTTATAGGG + Intronic
1182933238 22:34194869-34194891 AGAATCTAACATCATAAACAAGG - Intergenic
949760357 3:7463808-7463830 AAAATGTATCATGACATACAAGG - Intronic
949854042 3:8443819-8443841 AAAATTTAAGATGACATATATGG + Intergenic
950369683 3:12518569-12518591 AAAATCTGAAATTATACACATGG - Intronic
951229659 3:20162571-20162593 AAAAAGTTACAAGATATACAAGG + Intronic
953815945 3:46156507-46156529 AAAATCTAACAAAATATGTAAGG - Intergenic
957091930 3:75739289-75739311 AAAATCTATCATGACTTTCATGG + Exonic
957320910 3:78629108-78629130 GAAAACTAACATGAAACACACGG - Intronic
957898655 3:86458003-86458025 AAAAAATAAAATGAGATACATGG - Intergenic
958922050 3:100118289-100118311 AAAATTTAACATAACATACACGG + Intronic
959792323 3:110377213-110377235 AAAATCTAACACAATAAAAATGG + Intergenic
959812794 3:110638447-110638469 AAAAGGTAACATTATATGCAAGG - Intergenic
959923288 3:111893719-111893741 AAAATTTAAAATGACATTCATGG - Intronic
960022250 3:112967918-112967940 AAAATCTTTCATTTTATACATGG - Intronic
961488811 3:127236638-127236660 AAAATCTAACAGATTCTACAAGG - Intergenic
962085421 3:132186280-132186302 AAAATGTTAAATTATATACATGG - Intronic
962479276 3:135784840-135784862 AACATCTAACATCATGTACATGG - Intergenic
963334547 3:143958395-143958417 AAAATAGCACATGTTATACAAGG - Intergenic
964138745 3:153373560-153373582 AAAATTTAAAATTATATACCGGG + Intergenic
964155346 3:153578343-153578365 TAATTCTAACATCATTTACAGGG + Intergenic
964785700 3:160393742-160393764 AAAATTTTAGATGATAAACAGGG + Intronic
965348842 3:167587955-167587977 AATATCTAACATAATATAATTGG - Intronic
966409034 3:179629924-179629946 AAAATCTAACATGCTCCATAGGG + Intergenic
966778021 3:183559957-183559979 AAAAATTAACAGGATAAACAGGG - Intergenic
967045083 3:185728910-185728932 AAATACTAACACGATAAACAAGG - Intronic
967887008 3:194340378-194340400 AAAATAAGTCATGATATACAGGG + Exonic
970106415 4:12591070-12591092 AATATCCAACATGAAAAACAAGG + Intergenic
970621883 4:17830592-17830614 AAAATTTAACATGACATATGTGG + Intronic
971189038 4:24409602-24409624 GAAATTTAACATCATTTACATGG - Intergenic
971970583 4:33614167-33614189 AAATTGTAACATGATCCACAAGG + Intergenic
972167824 4:36309044-36309066 AAAATATAAAATAAAATACATGG - Intronic
973125314 4:46576128-46576150 AAAATTGAACATGATTTTCATGG + Intergenic
973545711 4:51979635-51979657 AAAATAACACATGATATACTTGG + Intergenic
974816336 4:67009125-67009147 AAAATCTGACATGGTTGACAAGG - Intergenic
976009463 4:80469547-80469569 AAAAACTAACAATATATAGAAGG + Intronic
976216970 4:82724602-82724624 ATAATATAAAAAGATATACATGG + Intronic
976838374 4:89402127-89402149 AAAATTTTAAATGACATACATGG + Intergenic
977237162 4:94522361-94522383 AAAAAATAAAATGATAAACATGG - Intronic
977492079 4:97727966-97727988 AAAACCAAAGATGATATAAATGG - Intronic
977546881 4:98393907-98393929 AAAATCTAAAATTATATATATGG + Intronic
977767381 4:100815533-100815555 AAAATCTAACTTGATGTCTATGG - Intronic
978158614 4:105518033-105518055 AATATCTACCATTAAATACAGGG + Intergenic
978662187 4:111139720-111139742 AACATATAACATGATAGACTTGG - Intergenic
979187224 4:117812082-117812104 AAAATATAAAATTACATACATGG - Intergenic
979261220 4:118648026-118648048 AAAATATAAAATTATATACGAGG - Intergenic
979884730 4:126012695-126012717 AAAATTTTATATGATATACTAGG + Intergenic
979904126 4:126263034-126263056 AGATTCTAGCATCATATACAAGG + Intergenic
980211810 4:129798320-129798342 AATATTTAACATAATACACATGG - Intergenic
980263857 4:130490755-130490777 AATATCTAACATGAGATATTTGG + Intergenic
982811605 4:159832239-159832261 AAAAACTAACAGGATTTCCACGG + Intergenic
983150623 4:164275233-164275255 AAAATATAAAATTATATACGAGG + Intronic
983258051 4:165424419-165424441 AAAATCAAACATGATAATTATGG - Intronic
984478098 4:180263000-180263022 AAATTCTAACTTGATATAGTTGG - Intergenic
984617156 4:181911785-181911807 AGGATATAACATGATATAGAAGG + Intergenic
986122211 5:4850662-4850684 AAGATCCAACATTATATAAATGG + Intergenic
986686230 5:10277625-10277647 AAAATTTAAAATTACATACATGG + Intronic
987749802 5:22024867-22024889 AAAATCTAAATTGATATATATGG - Intronic
988653465 5:33180245-33180267 AAAATATTAAATGATTTACAAGG - Intergenic
993282358 5:85940977-85940999 AAAATTTAAAATTATATACGTGG - Intergenic
993495970 5:88609310-88609332 AAAATTTAAAATTGTATACATGG - Intergenic
993935880 5:94001872-94001894 ATAACCAAACATGATGTACATGG + Intronic
994025544 5:95077792-95077814 AAAAACTAACATGAAATAGGAGG + Intronic
994025910 5:95083297-95083319 AGAATGAAACATGTTATACATGG - Intronic
994337504 5:98585317-98585339 AAAATCTAAAATGTTTTCCATGG - Intergenic
994584767 5:101692858-101692880 AAAATATAAAATGCTTTACATGG - Intergenic
995693548 5:114854665-114854687 ATAATCTAACATGATAAAGTGGG + Intergenic
995763541 5:115589995-115590017 AAAATCTAACAAAATATATTTGG - Intronic
996380716 5:122860238-122860260 AAAGTAAATCATGATATACAGGG + Intronic
996978740 5:129463451-129463473 AAAGTCCAACATGATAAACAGGG - Intronic
997310693 5:132878544-132878566 AACATCTAAGAAGATAGACATGG + Exonic
997764726 5:136489734-136489756 TAAATGTAACAACATATACATGG - Intergenic
1000272623 5:159701040-159701062 AAAATTTAAAATCACATACATGG - Intergenic
1000845056 5:166269390-166269412 AAAATCTAAAAAGATATTAATGG - Intergenic
1002463968 5:179394801-179394823 AACATGTACCATGATATTCAAGG + Intergenic
1002731774 5:181341101-181341123 AAAATATAAAATTATATACGAGG - Intergenic
1002752755 6:132976-132998 AAAATATAAAATTATATACGAGG + Intergenic
1004763423 6:18696839-18696861 AAAATCTAATGAAATATACATGG - Intergenic
1006261522 6:32876777-32876799 AAAATCTAACATGAATCATATGG + Intergenic
1006413613 6:33890433-33890455 AAAGTCAGTCATGATATACAGGG - Intergenic
1006759155 6:36443845-36443867 ACAAACTAACATGATAAACAAGG + Intronic
1007070265 6:39031933-39031955 AAAACCTATCGTGATATCCAGGG - Intergenic
1007688098 6:43679393-43679415 AAAAACTAACACGATACAGATGG + Intronic
1007939382 6:45764157-45764179 AACATGTAAAAAGATATACAAGG + Intergenic
1008059909 6:46985858-46985880 AAAAACTACCTTGATGTACATGG - Intergenic
1008362868 6:50642647-50642669 AATATCTATCATGTTATTCAAGG + Intergenic
1008775624 6:55034007-55034029 AAAATAAAACTTGAAATACAAGG - Intergenic
1009531142 6:64817381-64817403 AAAAATATACATGATATACATGG + Intronic
1010288613 6:74109320-74109342 AAAATCAAACATGAAATAAATGG + Intergenic
1011208006 6:84922360-84922382 GAAATCACACATGATATAAAGGG - Intergenic
1012638320 6:101576573-101576595 AATATCTAAGGTGATACACATGG + Intronic
1014322715 6:119951412-119951434 AATATCTAAAATCATATAAAAGG + Intergenic
1016130614 6:140463938-140463960 AAGATCTAAAATGATTCACAAGG + Intergenic
1016144455 6:140650854-140650876 AAAATATGAGAAGATATACAAGG + Intergenic
1016569856 6:145499183-145499205 AAAAATTAACATGGCATACATGG + Intergenic
1017628825 6:156375855-156375877 AAAATCAAACATGAAATAAAGGG - Intergenic
1018022962 6:159779617-159779639 AAAATCTAAAATGGTAAGCATGG - Exonic
1018414091 6:163586464-163586486 AAAACCAAACATCATATATAGGG - Intergenic
1019236026 6:170613414-170613436 AAAATATAAAATTATATACGAGG - Intergenic
1020870166 7:13619574-13619596 AAAATTCAACATGACATAAATGG - Intergenic
1021055218 7:16038394-16038416 AAAAGTTAAAGTGATATACAAGG - Intergenic
1021152722 7:17171199-17171221 AAAATATAACAACATATTCAGGG + Intergenic
1021568968 7:22045101-22045123 TAAATGTAACATGGTATACTGGG + Intergenic
1021916740 7:25441628-25441650 AAAATCAACCAAGATATTCAGGG - Intergenic
1027836456 7:83250439-83250461 AAAAACTAACAGGATATAATTGG - Intergenic
1028210629 7:88069754-88069776 AAAAGATAACCTGAAATACAGGG + Intronic
1028284902 7:88983746-88983768 AAAATATAAAATTATATATATGG + Intronic
1028412153 7:90541609-90541631 AAAGTCTAACAACAAATACATGG + Intronic
1029206843 7:98874526-98874548 AAAATTTAAAATTACATACATGG - Intergenic
1030375726 7:108751214-108751236 AAAATATAACATAATATGCACGG - Intergenic
1030740077 7:113098977-113098999 AAAATTTAAAATTACATACATGG - Intergenic
1030977983 7:116151220-116151242 AAAATCTGACATAATATCAAAGG - Intronic
1031148736 7:118027843-118027865 AAAAAATAACATGATGTAAAAGG + Intergenic
1031569210 7:123337320-123337342 AAAATATGAAAAGATATACAAGG - Intergenic
1031851006 7:126863943-126863965 AAAATGAAAAATGATATACCAGG - Intronic
1031964097 7:128014958-128014980 AATATCTGACAAGATATAGAGGG - Intronic
1032301886 7:130695210-130695232 AAAATCTCACATAGTGTACATGG - Intergenic
1033653256 7:143357534-143357556 AAAATTTAAAATGATATAAGTGG - Intronic
1035063378 7:156086772-156086794 AAAATCTAAAATTGCATACATGG + Intergenic
1035134386 7:156686645-156686667 AAAACATAACCTGATATAAAAGG - Intronic
1035511742 8:193158-193180 AAAATATAAAATTATATACGAGG + Intronic
1036593303 8:10189098-10189120 AACATATAACATGAAATACTAGG - Intronic
1036911783 8:12763568-12763590 AAAAGTTAACAAGATATAAAAGG + Intergenic
1038459787 8:27706122-27706144 AAACTCAAGCATGCTATACAAGG - Intergenic
1040402006 8:47060740-47060762 AAAATATGTCATGATATATAGGG - Intergenic
1040731982 8:50458520-50458542 AAAATATTACATGAAATAAAAGG + Intronic
1041783263 8:61602225-61602247 CAAATCCAACAAGATATATAAGG + Intronic
1041908647 8:63063050-63063072 AAAATATAACATCTTATACCTGG - Intronic
1042090778 8:65156989-65157011 AAGATCTAATATGATAAAAAAGG + Intergenic
1042819282 8:72912522-72912544 AATATATAATATGATATATAGGG + Intronic
1042885243 8:73542231-73542253 AAAACACAACATGACATACATGG + Intronic
1042892327 8:73626472-73626494 ACAATCTGACATGATTTAAAAGG + Intronic
1043002177 8:74772276-74772298 AATATCTAACATAATAAAGAAGG - Intronic
1044035388 8:87296841-87296863 AAAATTTAAAATGATATATGTGG - Intronic
1044454177 8:92373159-92373181 AAAATTTAACATAATATGTATGG + Intergenic
1044763070 8:95542842-95542864 CAAAACAAACATGATATCCAGGG + Intergenic
1045276933 8:100715597-100715619 CAAATCTAATAAGATATACAAGG + Exonic
1048109043 8:131446547-131446569 AAAATCTAAAAACATATTCAAGG - Intergenic
1048246804 8:132812570-132812592 AAAATCTAAAATAATTTACAAGG - Intronic
1048798378 8:138172621-138172643 AAAAGCTAACAAGGTAGACAAGG - Intronic
1048942217 8:139410843-139410865 AAAATCTAACAAAATATGCAAGG - Intergenic
1049281354 8:141748268-141748290 AACATCAAACATGATAGAAAGGG + Intergenic
1050083610 9:1941031-1941053 AAACTCTCGCATGACATACATGG + Intergenic
1050306582 9:4311447-4311469 AAGGTCTAAAATGAAATACATGG - Intronic
1050559299 9:6818289-6818311 AAAATCCACCATGTAATACAAGG - Intronic
1051015651 9:12472752-12472774 AATATTTAAAATGACATACATGG - Intergenic
1052404647 9:28044357-28044379 GAAATCTAACATGATTTAATGGG - Intronic
1052560271 9:30076455-30076477 AAAATAAGTCATGATATACAGGG - Intergenic
1054835874 9:69673723-69673745 AAAATTTAAAATTATATACTAGG + Intergenic
1054957885 9:70934188-70934210 AAAATGCAACATGATGTAGATGG - Intronic
1055063256 9:72092435-72092457 AAAAGCTCACATGATAGACCAGG - Intergenic
1056005809 9:82269769-82269791 AAAAACTAACATGGTTTACCTGG + Intergenic
1057455920 9:95210341-95210363 AAATTATAAAATGATATACTTGG + Intronic
1057506458 9:95637714-95637736 AAAATCTAAAATTACATCCAGGG + Intergenic
1058474789 9:105321760-105321782 AAAATCTAACAGGATATATGTGG + Intronic
1058622151 9:106894951-106894973 AAAATTTAAAATTACATACATGG + Intronic
1058780559 9:108330036-108330058 AAAATTTAAAAAGATATAAAAGG + Intergenic
1059371383 9:113842039-113842061 AAAATCAAAAATGACATAAATGG + Intergenic
1059896072 9:118867111-118867133 AAAACCCAATATGATATAAAAGG - Intergenic
1060500210 9:124147644-124147666 ACAATCGAACATGATATATCAGG + Intergenic
1062756180 9:138293613-138293635 AAAATATAAAATTATATACGAGG - Intergenic
1203485819 Un_GL000224v1:53456-53478 AAAATCTATCATGACTTTCATGG - Intergenic
1186317500 X:8386675-8386697 AATATCTAACATGTTACAAATGG - Intergenic
1186616589 X:11194921-11194943 AAATTCTATCATTATATAAAAGG + Intronic
1186676222 X:11820177-11820199 AAAATGGAAAATGATCTACAGGG - Intergenic
1186696681 X:12041537-12041559 AAAATGACTCATGATATACACGG - Intergenic
1186737666 X:12482637-12482659 AAAATTTAAAATAACATACATGG - Intronic
1186761052 X:12722120-12722142 AAAATTTCACATCATATACCTGG - Exonic
1187535682 X:20139880-20139902 TACAGCTAACATGATATACCTGG - Intronic
1187744808 X:22397415-22397437 AAAATCTAAAATTATATATGTGG + Intergenic
1188108900 X:26174210-26174232 AAAACCAAACATAATATACTGGG - Intergenic
1189047391 X:37608008-37608030 AAAATCTGACATGAAAAAAATGG + Intronic
1189523273 X:41792636-41792658 AAAATTTAAAATTATATGCATGG - Intronic
1189835764 X:45020393-45020415 ATAATCTAATTTGATATAAAGGG - Intronic
1191868521 X:65725549-65725571 TAGATCTAGGATGATATACAAGG + Intronic
1192674283 X:73178881-73178903 AAAATCTAACATGTTTTTCATGG - Intergenic
1193327256 X:80193140-80193162 AATATTTAACCAGATATACAAGG + Intergenic
1194371613 X:93079961-93079983 AAAATCTAAAATCATACACTTGG - Intergenic
1194376686 X:93143404-93143426 AAAATAATTCATGATATACAAGG + Intergenic
1194640140 X:96393921-96393943 CAAATATAATATGATATATAAGG + Intergenic
1194806562 X:98336106-98336128 AAAATTAAACATGGTATAAAGGG + Intergenic
1195033625 X:100950486-100950508 AAAATCAAAAAGGATATAGAAGG + Intergenic
1195491473 X:105475342-105475364 AAAATATAATATGATACCCAAGG - Intronic
1195619381 X:106937853-106937875 ACAATGTATCATGATATATATGG - Intronic
1196327983 X:114431118-114431140 AAAATCTAAGAACATTTACAAGG + Intergenic
1196637131 X:118014914-118014936 AAAATCTAATAAGAAAAACAGGG + Intronic
1196832543 X:119787396-119787418 AAAATCAAAAATGATTAACACGG + Intronic
1197310068 X:124893950-124893972 CAAATCTACCATGTTTTACATGG - Intronic
1197605994 X:128586139-128586161 AAAATCAAGCATGATAAATAAGG + Intergenic
1198188498 X:134279961-134279983 GAAATCTAACAAAATATGCATGG - Intergenic
1198195402 X:134355695-134355717 AAAATCTAATAGGATATCCAAGG + Intergenic
1198248923 X:134860442-134860464 AAAATTTTAAATAATATACAAGG + Intergenic
1199146054 X:144368328-144368350 AAAATATAACAAGATACATATGG - Intergenic
1199232416 X:145451847-145451869 AAAATCTAGCATACTATATATGG + Intergenic
1199238597 X:145519512-145519534 AAATTCCAACATGATATATAGGG - Intergenic
1199293942 X:146136179-146136201 TAAATCTAACATCATAGACAGGG + Intergenic
1200679404 Y:6191853-6191875 AAAATCTAAAATCATACACTTGG - Intergenic
1201369778 Y:13250846-13250868 AAAAACTAACGTGAAATACGAGG + Intronic
1201606829 Y:15795409-15795431 AAAAGCTACCATGAGATAAAAGG + Intergenic
1202382689 Y:24290461-24290483 AAAATATAAAATTATATACGAGG - Intergenic
1202488095 Y:25379663-25379685 AAAATATAAAATTATATACGAGG + Intergenic