ID: 1094087190

View in Genome Browser
Species Human (GRCh38)
Location 12:26607165-26607187
Sequence CAGTACAGATGGTGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094087190_1094087193 -9 Left 1094087190 12:26607165-26607187 CCTTCTGCTCACCATCTGTACTG 0: 1
1: 0
2: 2
3: 16
4: 224
Right 1094087193 12:26607179-26607201 TCTGTACTGGTAGCCTTCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094087190 Original CRISPR CAGTACAGATGGTGAGCAGA AGG (reversed) Intronic
900816578 1:4851797-4851819 CAGCACAGCTGAGGAGCAGAAGG - Intergenic
902583531 1:17424241-17424263 CAGTGCAGTTGGTGAGGACAGGG - Intronic
904027624 1:27514317-27514339 CAGGACAGAGGGTGAGGAGCAGG + Intergenic
904879757 1:33686675-33686697 CAGCACTGAGGGTGACCAGAGGG - Intronic
906641981 1:47446373-47446395 CATTTTAGATGGTCAGCAGATGG - Intergenic
906713969 1:47953208-47953230 CAGTGCAGATGATGCACAGAGGG + Intronic
907339424 1:53724161-53724183 CAGTTGAGAGGGTGGGCAGATGG - Intronic
908767594 1:67568568-67568590 CAGGCCAAATGATGAGCAGATGG - Intergenic
911272204 1:95815778-95815800 CAGTACAGGAGTTGTGCAGATGG + Intergenic
913094991 1:115507776-115507798 CACTGCAGGTGGTGAGAAGATGG + Intergenic
915783370 1:158579200-158579222 CAGTCAGGATGATGAGCAGAAGG + Exonic
916115236 1:161480375-161480397 CAGCACAGAGGGATAGCAGAGGG - Intergenic
916489065 1:165285615-165285637 CAGTGGAGATGGTGAACAGCTGG - Intronic
917205602 1:172567942-172567964 CACGACAGGTGGTGAGCAGCAGG + Intronic
920535471 1:206734010-206734032 CAGCACAGATGAGGAGCAGCTGG + Exonic
921273706 1:213495633-213495655 TTTTACAGATGGGGAGCAGAAGG + Intergenic
921543386 1:216446383-216446405 AATTAGAGATGGTAAGCAGATGG - Intergenic
922468169 1:225859145-225859167 CAGGATAGCTGGTGAGAAGAGGG - Intronic
922885151 1:229014254-229014276 CAGTCCATATCGTCAGCAGAAGG - Intergenic
1064683476 10:17835039-17835061 TAGTACAGATGTTCAGCAGGTGG - Intronic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1067764581 10:49075413-49075435 CAGGACAGATGCTCAGCACATGG - Intronic
1069573235 10:69507065-69507087 CAGTACTGAGTGTGGGCAGAGGG - Exonic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1074447281 10:113530839-113530861 CAGTGCAGATGGGGAGCTCAGGG - Intergenic
1076438743 10:130464620-130464642 CAACACAGATGAAGAGCAGATGG - Intergenic
1076591319 10:131585819-131585841 TAGAAGAGATGCTGAGCAGAGGG + Intergenic
1076689406 10:132213770-132213792 AAGAACAGATGGGGAACAGAAGG + Intronic
1077012105 11:383698-383720 CAGGACAGCTGGTCAGCACATGG - Intergenic
1078160176 11:8833102-8833124 CAGCAAAGCTGGTGAGCAGATGG + Intronic
1081870120 11:46379558-46379580 CAGACCAGCAGGTGAGCAGACGG + Exonic
1084947528 11:72646588-72646610 CAGTGAAGATTATGAGCAGAGGG - Intronic
1085553745 11:77400487-77400509 CAGTGCAGATGGGTAGCAGATGG - Intronic
1086498888 11:87431979-87432001 CGGGACACAAGGTGAGCAGACGG + Intergenic
1087288977 11:96299342-96299364 CAATACAGTTGGCAAGCAGAAGG + Intronic
1087309230 11:96521135-96521157 CAATACAGATGGGGGGCAGGGGG + Intergenic
1089730419 11:120515512-120515534 CCATACAGAGGGAGAGCAGAAGG - Intronic
1089742680 11:120595757-120595779 CAGGGCACATGGTCAGCAGAGGG - Intronic
1089878495 11:121749830-121749852 CAGTTTTGATTGTGAGCAGATGG - Intergenic
1092080207 12:5709782-5709804 CAGAACAGCTGATGAGGAGAAGG - Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094450993 12:30582942-30582964 CTGGACAGATGGTGAGCATCCGG - Intergenic
1097177368 12:57151236-57151258 GAGTGCAGATGCTGAGCAGTGGG + Intronic
1097973910 12:65664557-65664579 CACAACAGAAGGTGAGCAGCAGG - Intergenic
1099352822 12:81593920-81593942 CAGAACAGAAGGTGAGCAGTGGG + Intronic
1099970398 12:89494369-89494391 CACCACAGCTGGTGACCAGAAGG - Intronic
1101059885 12:100959755-100959777 CAGAAGAGAAGGTGAGCAAAGGG - Intronic
1103480846 12:121248854-121248876 CAAAACAGCTGGCGAGCAGAGGG + Intronic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105263518 13:18797170-18797192 CAGTACAGAAGGAGAGTATAGGG - Intergenic
1106672273 13:31918857-31918879 GAGAACAGAAGGTGAGCAGTTGG + Intergenic
1109133587 13:58619584-58619606 CAGTACAGATGGTCAACAAAAGG + Intergenic
1109325624 13:60864205-60864227 GAGAACAGATGGTGAGAGGAGGG - Intergenic
1110288036 13:73772769-73772791 CAGTACAGAGGGTGGTCTGAGGG + Intronic
1112542788 13:100333348-100333370 CTGAACAGATGGGAAGCAGATGG - Intronic
1112807487 13:103179194-103179216 CAGAACATAAGGCGAGCAGATGG - Intergenic
1113745938 13:112744570-112744592 GAGGGCAGGTGGTGAGCAGAGGG - Intronic
1113787732 13:113011462-113011484 CAGTGCAGATGGTGGACAGGCGG + Intronic
1114476606 14:22999449-22999471 CAGTAAAGATGGTGAGGAGGAGG - Intronic
1114788464 14:25628294-25628316 CAGAAAAGATGGTATGCAGAAGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1116424922 14:44779230-44779252 CAGTGCAGCTGCTGAGCAGAGGG - Intergenic
1117535851 14:56702751-56702773 CACTGCAGGAGGTGAGCAGAGGG - Intronic
1119951228 14:78747797-78747819 CAGAAAAGATCTTGAGCAGAAGG - Intronic
1120663601 14:87279506-87279528 AAGAACAAGTGGTGAGCAGAGGG - Intergenic
1121391151 14:93576018-93576040 AAGTACAGATGGTTAGCAGCTGG - Intronic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1125734069 15:41911556-41911578 AAGGACAGCTGGTGAGCAGCTGG - Intronic
1127222644 15:56896500-56896522 CAGTTCAGATGCTGGGCAGCTGG + Intronic
1128234719 15:66059668-66059690 GAGTGGAGAGGGTGAGCAGAGGG + Intronic
1128259442 15:66222302-66222324 CAGTATAGTTGGGGAGCAGCTGG - Intronic
1131546736 15:93322069-93322091 CAGCCTAGAGGGTGAGCAGAGGG - Intergenic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1137522269 16:49204458-49204480 CAGGAGAGATGGTGTGAAGAGGG + Intergenic
1138123325 16:54418376-54418398 CAGTACAGATGGTGAGACGAGGG - Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140548321 16:75834595-75834617 CAGTAAAGATGCTGCTCAGAGGG - Intergenic
1140918191 16:79512538-79512560 CAGCTCAGATGGTGAGCTGGGGG - Intergenic
1142012421 16:87722639-87722661 CAGGGAGGATGGTGAGCAGAAGG + Intronic
1146069536 17:29667418-29667440 CAGAACAGGAGGTGAGCAGCGGG + Intronic
1150320163 17:64206886-64206908 CAGTACAGCTGCTGATCAAATGG + Intronic
1150339838 17:64357515-64357537 GAGAGCAGATGGTCAGCAGATGG + Intronic
1150345815 17:64403882-64403904 TATTACAGATGGGGAGCTGAGGG + Intronic
1152816278 17:82410018-82410040 CAGGAGAGATGGGGAGCAGTGGG - Intronic
1154061352 18:11063571-11063593 CAGACCAAATGGTGGGCAGAGGG + Intronic
1154130531 18:11733311-11733333 CAGTTTAAAGGGTGAGCAGAGGG - Intronic
1154430244 18:14303104-14303126 CAGTACAGAAGGAGAGTATAGGG + Intergenic
1155092395 18:22524552-22524574 CAGTCCAGATAGTGAACAGGTGG - Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1156851564 18:41734001-41734023 CAGTTCAGCATGTGAGCAGAGGG + Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1158650243 18:59277689-59277711 TAGCACACATGGTGGGCAGAAGG - Intronic
1159236127 18:65675001-65675023 CAGTACAGATGTTATGCAAATGG + Intergenic
1159973752 18:74685350-74685372 CAGGATAGATGGTGAGCAGCTGG - Intronic
1161346667 19:3771767-3771789 CGGGACAGATGGTGGGGAGACGG + Exonic
1165319671 19:35077421-35077443 AAGGACACATGGCGAGCAGATGG + Intergenic
1168199389 19:54804001-54804023 CAGCACAGAGGGTGGGCTGATGG + Intronic
1168493600 19:56832334-56832356 AGGTACAGATGGTGACCACAGGG - Intronic
925301781 2:2820579-2820601 GACTACAGACGGTGAGCAGGTGG + Intergenic
927683660 2:25156244-25156266 CAGCAGAGATGGTGACCACAAGG - Exonic
927705208 2:25292556-25292578 CAGCACAGCTGGGGGGCAGAGGG - Intronic
928150293 2:28821531-28821553 CAGTAAAGTTGTTGTGCAGAAGG + Intronic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933540626 2:83637241-83637263 CATAACAGATGGTGAGGAGATGG - Intergenic
933656645 2:84894143-84894165 CAGTATACAGGGAGAGCAGAAGG + Intronic
933674092 2:85037839-85037861 CAGAGCAGAAGGTGAGCAGTGGG + Intronic
936527175 2:113249198-113249220 GAGCCCAGATGGTGGGCAGAGGG + Intronic
937363253 2:121243474-121243496 CACAACAGAAGGTGAGCAGCAGG + Intronic
937381056 2:121376674-121376696 CAGCACAGCAGGTGAGCAGTGGG + Intronic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
939189102 2:138895488-138895510 CATTCCAGCTGGTGAGAAGATGG + Intergenic
941887033 2:170538655-170538677 CAGGACAGATGCCCAGCAGAAGG + Intronic
941941327 2:171041472-171041494 CACAACAGGTGGTGAGCAGCGGG + Intronic
942468704 2:176236926-176236948 CAGTACAGAAGATGAGGAAAAGG - Intergenic
942530208 2:176901880-176901902 CAGTTTTGGTGGTGAGCAGAGGG + Intergenic
945025097 2:205612940-205612962 CAGTACAGTCGGCGAGCACATGG - Intronic
946146402 2:217734457-217734479 CAGAACAGATGCTCAGAAGAAGG - Intronic
946171327 2:217897730-217897752 ATGTAGAGGTGGTGAGCAGATGG + Intronic
946351368 2:219156400-219156422 AAGTATAGATTGTTAGCAGAGGG - Intronic
946480593 2:220052136-220052158 CATTACAAATGGTGAGAGGAAGG - Intergenic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
946540069 2:220674783-220674805 CAGTACAGATGAAAAGGAGAGGG + Intergenic
946867924 2:224059186-224059208 CAGTATAGATGCTGAGAAGTGGG + Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
949081514 2:242104268-242104290 CAGAGCAGGAGGTGAGCAGAGGG + Intergenic
1170742015 20:19066443-19066465 CAGTGCAGGAGGTGAGCAGCAGG + Intergenic
1170743996 20:19081916-19081938 GAGTGCAGGTGGTGAGGAGAAGG - Intergenic
1170891031 20:20375525-20375547 CAGTGTATATGCTGAGCAGATGG + Intergenic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1172593762 20:36135448-36135470 AAACACAGATGGTGAGCAGAGGG - Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172870917 20:38135044-38135066 CACCACAGAGGGTGAGCAGCAGG - Intronic
1173862352 20:46292309-46292331 CAGCTCAGCTGGAGAGCAGAGGG - Intronic
1175734806 20:61377756-61377778 GAGTCCAGATGGGGAACAGATGG - Intronic
1175745811 20:61456203-61456225 CAGTACAAATGCTGGGCAGCAGG - Intronic
1176688789 21:9880080-9880102 CACTACTGGTGATGAGCAGAGGG + Intergenic
1179251368 21:39673957-39673979 CAGTACTGATGGCGAGCGGGAGG - Intergenic
1180235602 21:46457910-46457932 CATTAAAGCTGGTGAGAAGATGG - Intergenic
1183876707 22:40789062-40789084 AAGTAGAGATGGTCAGAAGATGG - Intronic
1184175534 22:42786812-42786834 CAGTTCAAATGGTGGGAAGAAGG + Intergenic
1185274947 22:49946734-49946756 CAGGGCAGATTCTGAGCAGACGG - Intergenic
1185369464 22:50454357-50454379 CAGTTCACATGGTGGGGAGACGG + Intronic
952351842 3:32546793-32546815 CAGGAGAGATGGTGAGAAAATGG + Intronic
952564577 3:34640037-34640059 AATTACAGATGGTGAGCAAAGGG - Intergenic
952622025 3:35356468-35356490 CAGGAAAGATGCTGAGCAAAGGG + Intergenic
953696864 3:45166631-45166653 CATTTCAGTGGGTGAGCAGATGG + Intergenic
953849839 3:46457113-46457135 CAGACCAGGAGGTGAGCAGAGGG - Intronic
956853907 3:73257280-73257302 GAGTACAGATCCTGAGCACATGG - Intergenic
961671172 3:128532569-128532591 CAGGACAGGGGGTGAGCAGTAGG + Intergenic
961735205 3:128997086-128997108 CTGTACATCTGGTAAGCAGAGGG + Intronic
962053222 3:131841428-131841450 CAGAGCAGGAGGTGAGCAGAGGG + Intronic
962283943 3:134071406-134071428 TAATTCAGGTGGTGAGCAGAAGG - Intronic
962286549 3:134091139-134091161 CAGAGCAGGTGGTGAGCAGCAGG - Intronic
963376634 3:144474896-144474918 GAGTCAAGATGGTGAGCAGTGGG - Intergenic
963757888 3:149255220-149255242 CATTCCAGATGGAGAGAAGAGGG + Intergenic
965537030 3:169833789-169833811 CAGTGCAACTGCTGAGCAGAAGG - Intronic
965779794 3:172272898-172272920 AACCACAGCTGGTGAGCAGATGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967355703 3:188568561-188568583 CAGTACTCAGGGTCAGCAGAGGG + Intronic
968073543 3:195802974-195802996 GTGTACAGACGGTGAGAAGAGGG - Intronic
968205133 3:196793061-196793083 CACTACACATGCTGAGGAGAAGG + Intronic
970573995 4:17409678-17409700 AAGTTCCAATGGTGAGCAGAGGG - Intergenic
971467273 4:26977023-26977045 CAGTATAGTTAGTGAGCAGATGG + Intronic
976540443 4:86268289-86268311 CAGTAAAGATGGTGAGAAGATGG - Intronic
977027816 4:91842587-91842609 CAGGACAGAGGGTGGGAAGAGGG + Intergenic
977796507 4:101172062-101172084 AAGTACTGATGGAGAGCAGTGGG + Intronic
979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG + Intergenic
980352174 4:131697894-131697916 CACTACTGGTGATGAGCAGAGGG + Intergenic
981228041 4:142319771-142319793 CAGTAGTGATGGTTGGCAGATGG - Intronic
982403516 4:154995403-154995425 CAGTGAAAAGGGTGAGCAGAGGG - Intergenic
982885149 4:160769692-160769714 AAGTACACATGGCAAGCAGATGG + Intergenic
984348130 4:178557940-178557962 CAGTACAGCCTGTGACCAGAAGG + Intergenic
984579024 4:181488305-181488327 CAGTACAATTGGTGAGAAGTCGG + Intergenic
987240026 5:15986775-15986797 CAGTAAAGATGGGGGGAAGACGG - Intergenic
988078640 5:26387348-26387370 CACAACAGAGGGTGAGCAGTGGG + Intergenic
991994581 5:72374688-72374710 AAGTCCAGATGGTGAGGAGCTGG + Intergenic
993028225 5:82671093-82671115 CATTGCAGATGGTAAGCTGAGGG + Intergenic
993382828 5:87227294-87227316 TAATACAGATGGTTACCAGAGGG + Intergenic
995730026 5:115229081-115229103 TAGTATAGATGGTGATGAGAAGG + Intronic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
998679931 5:144455670-144455692 CAGTCCAGAAGGTTAGCAGGAGG + Intronic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001567131 5:172707007-172707029 CAGGATGGATGGTGAGAAGAGGG + Intergenic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1004825114 6:19411516-19411538 CAGTAGTGGTGGGGAGCAGAGGG - Intergenic
1008587714 6:52964352-52964374 CAATACAGATGGTGCCCAGAGGG - Intergenic
1010116174 6:72315273-72315295 TAGTGAAGATGGTGAGAAGAGGG + Intronic
1010364836 6:75038637-75038659 CAGTAAAGATGGTCAGAAAAAGG + Intergenic
1012701932 6:102469221-102469243 CAGTACATGTGTGGAGCAGAGGG - Intergenic
1013921753 6:115414145-115414167 CTGCACAGATGGTGACCAAATGG - Intergenic
1019127131 6:169848222-169848244 CACTACAGGTGATGGGCAGAGGG - Intergenic
1020022993 7:4880156-4880178 CAGTACAGGTCATAAGCAGATGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023037238 7:36142826-36142848 ATGTACAGATGGTGCTCAGAGGG - Intergenic
1023454330 7:40322075-40322097 AAGAACAGATGGTGAGGACATGG - Intronic
1029358741 7:100072603-100072625 CAGGACAGTTGGTGAGAAAAGGG + Intronic
1029881380 7:103814618-103814640 TGGAACAGATGGAGAGCAGAAGG + Intronic
1034259518 7:149746075-149746097 AAATACTGATGGTTAGCAGAGGG - Intergenic
1034714209 7:153224428-153224450 CAGCACAGCTGGTGAGTAGCAGG + Intergenic
1035539425 8:421066-421088 CAGAGCAGGAGGTGAGCAGAGGG + Intronic
1035914968 8:3608887-3608909 CATTGCATATGCTGAGCAGAAGG - Intronic
1038873386 8:31520596-31520618 CAGTAGAAATGGTGAGCCCAGGG - Intergenic
1044582794 8:93838948-93838970 CAGTACAGCCTATGAGCAGAAGG + Intergenic
1045064685 8:98435012-98435034 CAGTCCAGGTGGAGAGCAGTGGG - Intronic
1046265458 8:111823730-111823752 CAGTGCAGTTGGTGGGCTGAAGG + Intergenic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048456572 8:134583820-134583842 CACTGCAGATGGTGAGTAAATGG - Exonic
1048604797 8:135956511-135956533 CAGCACAGAAGGGGAGCCGAAGG - Intergenic
1048723766 8:137358464-137358486 CACAGCAGAAGGTGAGCAGAGGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049695859 8:143984020-143984042 CAGTACAGGTGGTGACCAGGAGG - Exonic
1050220794 9:3387458-3387480 CAGTAGAGATGGTCAACAAAAGG + Intronic
1051672391 9:19524016-19524038 CAGTAAAGATGATGGGCACATGG + Intronic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053467130 9:38316727-38316749 CAGTGAAGATGGTAAGCTGATGG + Intergenic
1053780536 9:41601820-41601842 CACTACTGGTGATGAGCAGAGGG - Intergenic
1054168479 9:61811977-61811999 CACTACTGGTGATGAGCAGAGGG - Intergenic
1054669050 9:67768841-67768863 CACTACTGGTGATGAGCAGAGGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055304061 9:74910468-74910490 CAGTCCAGAGGGTAGGCAGAGGG - Intergenic
1058645358 9:107127081-107127103 CAGTACAGGTGGGGAAGAGAAGG + Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059254381 9:112915828-112915850 CAGGAAAGATTGTGGGCAGAAGG - Intergenic
1059475408 9:114542687-114542709 GTGGGCAGATGGTGAGCAGATGG - Intergenic
1060028906 9:120197427-120197449 CCGCACAGCTGGTGAGCAGCTGG + Intergenic
1060565113 9:124583813-124583835 GAGTACAGAAGTTGTGCAGAGGG - Intronic
1060565115 9:124583852-124583874 GAGTACAGAAGCTGTGCAGAGGG - Intronic
1061516802 9:131094887-131094909 CAGTCCAGCAGCTGAGCAGAAGG + Intergenic
1061661227 9:132131537-132131559 CCCTACAGATGGTGAGGGGACGG + Intergenic
1061863049 9:133477874-133477896 CAGGACAGATTGTGGGCTGATGG - Intronic
1062436519 9:136548811-136548833 AAGCACAGCTGGTGAGCACACGG + Intergenic
1186182636 X:6987861-6987883 CATAACAGATGGTCAACAGATGG - Intergenic
1186401948 X:9268372-9268394 CAGTTCAGATGGGGTGAAGATGG - Intergenic
1186839557 X:13471468-13471490 CAGAGCAGATGGTGAGAGGAAGG + Intergenic
1187365942 X:18665923-18665945 CAGAGCAAATGGTGAGCTGAGGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1196759598 X:119189684-119189706 CAGCACAGATGGTTACCAAATGG + Intergenic
1197181522 X:123541994-123542016 CATCAGAGATGGTGAGCTGATGG + Intergenic
1197663539 X:129198919-129198941 AAGTACAGGTGGGGAGGAGATGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199286460 X:146059874-146059896 GAGTCCAGCTGATGAGCAGAAGG - Intergenic