ID: 1094090600

View in Genome Browser
Species Human (GRCh38)
Location 12:26644950-26644972
Sequence CCCCGTAGGCAGCTCTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094090600_1094090605 8 Left 1094090600 12:26644950-26644972 CCATTCCAGAGCTGCCTACGGGG 0: 1
1: 0
2: 1
3: 10
4: 91
Right 1094090605 12:26644981-26645003 GCTCAGCCCCCTCACCCTAATGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094090600 Original CRISPR CCCCGTAGGCAGCTCTGGAA TGG (reversed) Intronic
900399651 1:2467704-2467726 CCCCGTAGGGAGCCCAGGACCGG + Intronic
900589165 1:3452135-3452157 GCCCGTAGGCAGCTGGGAAAGGG - Intergenic
901190119 1:7404714-7404736 TCCCGTAGGCGGCTCTGGTGAGG - Intronic
903573325 1:24322119-24322141 CCCCGTTGACAGCCCAGGAAGGG + Intronic
904701952 1:32362969-32362991 GCCCGATGGCAGCTCTGGAGTGG + Intronic
914410316 1:147421123-147421145 CGCCGTAGGCAGCTCCTGGAAGG - Intergenic
916629118 1:166592931-166592953 CCCAGTAGGCAGGACTGGCATGG - Intergenic
916845261 1:168643935-168643957 CTCCGTAGGCATATGTGGAATGG + Intergenic
920253615 1:204639041-204639063 CCCCCTGGGTAGCTCTGGAGAGG + Intronic
920720777 1:208384839-208384861 CCAGGCAGGAAGCTCTGGAAAGG - Intergenic
1067113948 10:43420555-43420577 CGCCGCCGGCAGCGCTGGAAGGG - Intergenic
1072590839 10:96827250-96827272 CACCGCAGGCAGCTCTGTGAAGG + Intergenic
1074054215 10:109907562-109907584 CCCCATAGCAAGCCCTGGAAGGG + Intronic
1075287738 10:121201794-121201816 CCAGGTAGGCAGCTCTGGGAAGG - Intergenic
1075567479 10:123515148-123515170 CCCCCGAGGCTGCTCTGGAGAGG + Intergenic
1076734479 10:132452597-132452619 CTCCCCAGGCAGCTCTGGAAAGG + Intergenic
1077248105 11:1548825-1548847 CCCAGGAGGAAGCTCTGGGAAGG - Intergenic
1083656136 11:64230618-64230640 CCCCGAAGCCAGCGCTGGGAAGG + Exonic
1089931740 11:122319847-122319869 CCCCTTTGTGAGCTCTGGAATGG + Intergenic
1090201755 11:124862725-124862747 CCCCATAGGCAGTTCTGAAAGGG - Intergenic
1094090600 12:26644950-26644972 CCCCGTAGGCAGCTCTGGAATGG - Intronic
1096456613 12:51792689-51792711 CCCAGTGGGAAGCTCTTGAAAGG + Intronic
1101312651 12:103597275-103597297 CCACGTCAGCAGCTCTGAAATGG - Intronic
1102467429 12:113138047-113138069 CCCCGTGGGGAGCTGGGGAAGGG - Intergenic
1104722520 12:131052814-131052836 AGCCGTAGGTAGCTCTGGAGGGG + Intronic
1104987023 12:132603035-132603057 CCCAGAAGGCCGCTCTGGCACGG + Intergenic
1111078364 13:83268601-83268623 CCCCGTGCTCAGCTCTGGAATGG - Intergenic
1114670694 14:24409329-24409351 CCCTGTTGGCAGCACTGGAGCGG - Exonic
1117042593 14:51780391-51780413 CCAGGTAGAAAGCTCTGGAAAGG + Intergenic
1118017523 14:61675228-61675250 TCCGGCAGGCAGCTCTGGAATGG + Intergenic
1120506185 14:85355730-85355752 CCCCCTAGGCAGCTTTGGGATGG + Intergenic
1120759783 14:88274993-88275015 CCCCTGAGGCATCTTTGGAATGG - Intronic
1120921634 14:89760893-89760915 CCACGCAGGCAGATCTGGGATGG + Intergenic
1121946431 14:98127051-98127073 CACAGTGGGCAGCTATGGAACGG + Intergenic
1122115914 14:99527172-99527194 GCCTGTGGGCTGCTCTGGAAGGG + Intronic
1122898226 14:104770995-104771017 CCACAGAGGCAGCTCTGGGAGGG + Intronic
1130088317 15:80797139-80797161 TCCCGTAGGCAGTTCTGGCCAGG - Intronic
1130109400 15:80952264-80952286 CACCTCAGGCAGCACTGGAAGGG + Intronic
1132407097 15:101549851-101549873 TCCCGTAGGCTGCCCTGGAAAGG + Intergenic
1137584941 16:49658714-49658736 CCCTGAAGGCAGCTGTGGCAGGG + Intronic
1138491970 16:57382296-57382318 GCCCGTCGGCAGCTCTGGGGAGG - Exonic
1139916910 16:70433986-70434008 CCCCATAGGGAGCTCAGAAAAGG - Intronic
1142298618 16:89243200-89243222 TCCTGTAGGCAGCAGTGGAAAGG + Intergenic
1142959506 17:3543691-3543713 CCCCGTAGGCAGCTCTGGCGGGG - Intronic
1144207958 17:12992695-12992717 CCCAGGAGGCAGCTCAGGATAGG - Exonic
1152697849 17:81805414-81805436 CCCGGCAGGCAGCTGTGGGAGGG + Intronic
1157243851 18:46036590-46036612 CTCCGTGTGCTGCTCTGGAAGGG - Intronic
1157973308 18:52296340-52296362 CCATGTACACAGCTCTGGAATGG - Intergenic
1161726802 19:5933994-5934016 CTCCGCAGGCACATCTGGAAAGG - Intronic
1162736355 19:12749039-12749061 CCCCCTAGCCAGCTCTGGCTTGG - Intergenic
1163138771 19:15332345-15332367 CCGCGCAGGCAGCTCGGGGAGGG - Intronic
1164596036 19:29531056-29531078 CCTGGTAGGCAGCTCTGGGGCGG + Intronic
1164817605 19:31217097-31217119 CCCAGGAGGCAGCTTTTGAATGG + Intergenic
925063562 2:911965-911987 CACCGAAGGCCGCTGTGGAAGGG + Intergenic
926213749 2:10890814-10890836 CCCCCTGGGGAGCTCTGGAGTGG - Intergenic
928933733 2:36652178-36652200 TCTAGTAGGCACCTCTGGAAGGG - Intergenic
929133689 2:38602817-38602839 CCCGGGAGGAAGCTCTGGAGCGG + Exonic
937349862 2:121153917-121153939 GCCAGTGGGCAGCTCTGGAGGGG + Intergenic
940954406 2:159712333-159712355 CCCCGGGGGCAGCTCTTCAACGG + Intergenic
942552239 2:177131500-177131522 CCCCGTAGTCACTTCTGGACTGG - Intergenic
944200831 2:197105819-197105841 CACCGTGGGCAGCTCTGATATGG - Intronic
947925940 2:233922611-233922633 AACTTTAGGCAGCTCTGGAAAGG - Intronic
948679696 2:239625516-239625538 CCCCTTAGGCGGCCTTGGAATGG - Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1169140416 20:3224459-3224481 GCCCACAGGCAGCTCTGGAGAGG + Intergenic
1169457816 20:5767877-5767899 TCCTGTAGCCAGCTCTGGGAAGG - Intronic
1173136731 20:40445287-40445309 CCCTTTAGGCACCTCTGAAACGG + Intergenic
1176252902 20:64134058-64134080 CCCCCAAGGCAGCTCAGGGAGGG + Intergenic
1180255861 21:46627017-46627039 CTCCCGAGGCAGCTCAGGAAAGG - Intergenic
1184856463 22:47149162-47149184 CCCTGACTGCAGCTCTGGAAGGG - Intronic
949560344 3:5195775-5195797 CCACGTTGGCAGCTCAGGCATGG - Intronic
955331461 3:58050791-58050813 CCCCAGAGGAAGCTGTGGAAGGG - Intronic
956162788 3:66372535-66372557 CCCCATTGTCAGCTCTGTAAAGG + Intronic
960997785 3:123351146-123351168 CCACCGAGGCAGCGCTGGAAGGG + Intronic
961103626 3:124222511-124222533 CCTCTGAGGCAACTCTGGAATGG + Intronic
961718047 3:128872391-128872413 CCCTGTAGGCAGCACAGGAAAGG - Intergenic
961907764 3:130280297-130280319 CCCCATAAGCAGCTGTGGGATGG - Intergenic
964110147 3:153079130-153079152 CCCCCTAGGCAGCGCTGGAGGGG - Intergenic
964227638 3:154426684-154426706 CACTGTAGGGAGTTCTGGAAGGG + Intronic
967253445 3:187566232-187566254 CACCGCAGGAAGCTCTGGGAAGG - Intergenic
967820009 3:193831666-193831688 CCGCGTTGGCAGTTCTGAAATGG - Intergenic
969685437 4:8671526-8671548 CCCCAGAGACTGCTCTGGAAAGG - Intergenic
982356463 4:154474487-154474509 TCCTGTAGGGAGCTCTGGGATGG - Intronic
995335806 5:110998217-110998239 CCCAGTAGGCTGCTCTGTAACGG + Intergenic
995458538 5:112377793-112377815 TCTGGAAGGCAGCTCTGGAAAGG - Intronic
998443572 5:142181428-142181450 CCCCGCAAGCAGCCCTGGCAGGG - Intergenic
1001115879 5:168939062-168939084 CCCTGTAGGCAGCAAAGGAATGG + Intronic
1001380974 5:171306524-171306546 GCTCTTAGGCAGCTCAGGAATGG - Exonic
1002437217 5:179238922-179238944 CCCAGTAGGCAGATCTAGAGAGG + Intronic
1003175852 6:3751826-3751848 CGCCGCGGGCCGCTCTGGAAAGG + Exonic
1010419422 6:75655161-75655183 CCCAGTGTGCAGCTTTGGAAGGG + Intronic
1014085110 6:117333317-117333339 ACCAGTAGCAAGCTCTGGAATGG + Intronic
1018898676 6:168039504-168039526 CCCCGGAGGCAGCAAGGGAAGGG + Intronic
1019501832 7:1368680-1368702 CACCGGAGGCCGCTCAGGAACGG - Intergenic
1033999499 7:147394532-147394554 CCCAGTAGGCAGATTTGGTATGG + Intronic
1035078829 7:156199429-156199451 CCCAGGAACCAGCTCTGGAAGGG - Intergenic
1045328703 8:101136945-101136967 GCCCGCAGGTAGCACTGGAAAGG - Intergenic
1047431416 8:124796544-124796566 CCCCGCAGGTAGGACTGGAAGGG - Intergenic
1051976745 9:22959273-22959295 TTCCGTAGCAAGCTCTGGAATGG - Intergenic
1058705184 9:107631991-107632013 CCCATTTGGCAGCTCTGGATTGG - Intergenic
1190433710 X:50402885-50402907 CTCCATAGTCAGATCTGGAAAGG + Intronic
1199387194 X:147236798-147236820 TCCCATAGGCAGGTCTTGAAAGG - Intergenic
1200073097 X:153538558-153538580 CTCCACAGGCAGTTCTGGAAAGG + Intronic