ID: 1094090680

View in Genome Browser
Species Human (GRCh38)
Location 12:26645592-26645614
Sequence TTGAATGCCCAGAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094090678_1094090680 -3 Left 1094090678 12:26645572-26645594 CCATCTCAAGAAGAATAAGCTTG 0: 1
1: 0
2: 2
3: 11
4: 311
Right 1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG 0: 1
1: 0
2: 3
3: 30
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094090680 Original CRISPR TTGAATGCCCAGAGGCAGCA TGG Intronic
902115724 1:14119393-14119415 TTGGATGCTAAGGGGCAGCAAGG + Intergenic
904022959 1:27482264-27482286 ATGAATGCCCAGAGGAATTAAGG + Intronic
904293705 1:29504191-29504213 TTGGCTGCCCAGAGGCAGGAGGG - Intergenic
906671056 1:47655285-47655307 ACGAATGCCTTGAGGCAGCAGGG + Intergenic
906897483 1:49792067-49792089 TTGCATGCCCAGCAGCATCACGG + Intronic
907383987 1:54113929-54113951 ATGACTGCCCAGGGGCAGCAGGG + Intergenic
907384288 1:54115966-54115988 ATGACTGCCCAGGGGCAGCAGGG + Intergenic
907457873 1:54587101-54587123 TTGCATGCCCAGTCTCAGCAAGG - Intronic
907938208 1:59061553-59061575 GTGAATGCCCAGTGGTGGCAGGG + Intergenic
909017996 1:70400217-70400239 ATGAAAGGCCAGAGGCAGAAGGG + Intergenic
909060561 1:70874343-70874365 TTGAGTGCCCACAGACAGCATGG - Intronic
909669636 1:78173605-78173627 TAGAAGGCACAGAGGCAGAATGG - Intergenic
909806310 1:79876792-79876814 TTCTCTTCCCAGAGGCAGCAGGG - Intergenic
910441755 1:87260223-87260245 TTGAAAGCTCAGAGGAAGCCAGG + Intergenic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
912816987 1:112837395-112837417 TAGTATGCCCAGAGAGAGCACGG - Intergenic
914464381 1:147913077-147913099 TGGAATACCCAGAGTCAGGAGGG - Intergenic
915716189 1:157947332-157947354 TTGAATGGGCAAAGACAGCATGG - Intergenic
916189697 1:162166998-162167020 CAGAATACCCAGAGGCAGCAGGG - Intronic
916279723 1:163036245-163036267 GTTTCTGCCCAGAGGCAGCATGG + Intergenic
919075444 1:192808351-192808373 TTGATTGCCCAGGGGCAGGGTGG - Intergenic
921711170 1:218374798-218374820 TTGAACTCACAGAGGGAGCAGGG - Intronic
922966872 1:229697802-229697824 TTGCATGCCCAGAGAGGGCATGG - Intergenic
923084639 1:230694286-230694308 TTGAACTCACATAGGCAGCATGG + Intergenic
924584832 1:245353196-245353218 TGGAATGACTAGAGGCAGCAGGG + Intronic
924827473 1:247555947-247555969 ATGGATGCCCACATGCAGCAGGG + Intronic
1062985194 10:1761878-1761900 TAGAATGCCCTGATGCTGCAGGG + Intergenic
1063666088 10:8061586-8061608 GTGACAGACCAGAGGCAGCAAGG + Intronic
1064193145 10:13224894-13224916 TTGATAGCCCAGGGGCAGCCTGG + Intronic
1065838705 10:29682090-29682112 TGCAAAGCCCAGAGCCAGCATGG - Intronic
1065850103 10:29780732-29780754 TTAAATACCCAGAGGCAGGGTGG + Intergenic
1067714932 10:48683590-48683612 GTGAATGCCCAGAGGAAGCGCGG - Intergenic
1069799721 10:71074565-71074587 TTGAATGCCCTGGGGCTGGAAGG - Intergenic
1070327157 10:75396601-75396623 GTGAGTCCCCAGAGGCAACAGGG + Intergenic
1070359689 10:75675535-75675557 TTTAATTTCCAGAGGCAGCATGG + Intronic
1070494048 10:77005207-77005229 TTCAATTCTCAGAGACAGCAGGG - Intronic
1070735796 10:78862846-78862868 GTCAATGCCCTGGGGCAGCAAGG + Intergenic
1078902083 11:15650895-15650917 TTTAATGCTCAGAGGCTGCCAGG - Intergenic
1080740491 11:35059434-35059456 ATGAATGCCCAGAGAGAGGATGG - Intergenic
1081337343 11:41882867-41882889 TTGCATGCCCAGATGCTTCAGGG + Intergenic
1081704057 11:45170437-45170459 GTGAATGCCTAGAGGGAGTAGGG + Intronic
1083551478 11:63593414-63593436 TGGCATGCCAAGAGGCAGCAAGG + Intronic
1084770019 11:71336609-71336631 AGGCTTGCCCAGAGGCAGCACGG + Intergenic
1086083739 11:82933552-82933574 TTGAATGCCTAGAGTCAGATAGG - Exonic
1086236995 11:84643768-84643790 TTGTATGCCCATTGGCTGCAGGG - Intronic
1087363551 11:97191216-97191238 TTGAGTGCGCAGAGGCAGAATGG - Intergenic
1087980644 11:104609471-104609493 TTGAAAGCTGTGAGGCAGCATGG + Intergenic
1088674975 11:112183589-112183611 TTGAATACCTAGATGCAGTATGG + Intronic
1089455332 11:118622458-118622480 TTTATAGCCCAGAGGCAGCATGG + Intronic
1089637663 11:119826510-119826532 CTGGGTGCCCAGAGGCAACATGG + Intergenic
1090448778 11:126787877-126787899 ATGAATGCCAAGAAGAAGCAGGG - Intronic
1092439396 12:8484866-8484888 TTTAATGCACAGAAGCAGAATGG + Intergenic
1092457810 12:8659987-8660009 TTGAATGCCTTGAGGCAGAATGG + Intronic
1093350918 12:18102676-18102698 TTGCAGGCTCAGAGGCAGAAGGG - Intronic
1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG + Intronic
1094797931 12:33998085-33998107 CTGAAGGGCCAGAGTCAGCAAGG + Intergenic
1095110697 12:38292124-38292146 CTGAAAGGCCAGAGTCAGCAAGG + Intergenic
1097900123 12:64864435-64864457 TGGAATGCCCAGCTGCAGCTGGG + Intronic
1098231465 12:68375719-68375741 GAGAATGCCCAGAGACAGAATGG + Intergenic
1099498189 12:83378522-83378544 TCCATAGCCCAGAGGCAGCAAGG + Intergenic
1100616157 12:96233319-96233341 TTGAATGTTCAGTGCCAGCAAGG - Intronic
1100715584 12:97302004-97302026 CTGAAAGCCCAGAGGAGGCAGGG - Intergenic
1101291191 12:103371363-103371385 TTAAATGGCAAGAGGCAGCTGGG + Intronic
1101414461 12:104497304-104497326 TTGGATGCACGGAGGCACCACGG + Intronic
1103173612 12:118843508-118843530 TGGAAGGGCCTGAGGCAGCAGGG - Intergenic
1105370022 13:19794116-19794138 TGGCATGCTCAGAGACAGCATGG + Intergenic
1105582925 13:21717970-21717992 TTGCATTCCAAGAGGCACCACGG - Intergenic
1107343418 13:39434087-39434109 TTGCATGCTCAGAGGCAGCATGG + Intronic
1107553316 13:41496570-41496592 CTCTATGCCCAGAGGCTGCAGGG + Intergenic
1112065756 13:95790908-95790930 TTGGATGCAGAGAGCCAGCAAGG + Exonic
1113453760 13:110432530-110432552 TTTAATGTCCAGAGGCACCATGG - Intronic
1114764017 14:25350095-25350117 TTTAAAGCCAAGAGGCAGCAGGG - Intergenic
1115120255 14:29928577-29928599 TTGACTGCCCAAGGGCAGGAGGG + Intronic
1118885840 14:69865326-69865348 TCTAATGCCCTGAGGCAGAAAGG + Intronic
1119007199 14:70942666-70942688 TGGCATGCCCAGAGACAGCATGG - Intronic
1120996812 14:90423660-90423682 TTGATTGCCAAGTGGCAGCTGGG + Intergenic
1121457376 14:94047028-94047050 TTGAAGGTCCTGAGGCAGCAAGG - Exonic
1121861695 14:97324732-97324754 GCCAATGCCCAGAGGCAGTAAGG - Intergenic
1122437374 14:101709399-101709421 TTCACCGCCCAGATGCAGCAGGG + Intergenic
1123663505 15:22587184-22587206 TGTTATGACCAGAGGCAGCAAGG + Intergenic
1124317335 15:28681636-28681658 TGTTATGACCAGAGGCAGCAAGG + Intergenic
1124566108 15:30815867-30815889 TGTTATGACCAGAGGCAGCAAGG - Intergenic
1125612404 15:40980369-40980391 TTGAAGGTCCAAAGTCAGCAAGG + Exonic
1128478489 15:68017468-68017490 TCGTATGGCCAGAGGCAACAAGG + Intergenic
1130192154 15:81747664-81747686 CAGAATGCCAAGAGGAAGCAGGG - Intergenic
1131165396 15:90138620-90138642 CTGAGTGCCAAGAGGCAGCCTGG - Intergenic
1131167724 15:90154575-90154597 TTGGATGCCCAGAGCCACAAGGG - Intergenic
1131761595 15:95628736-95628758 TTGAAGTCCCAGAGAGAGCAAGG + Intergenic
1132502751 16:291860-291882 GTGAAGGCCCAGAGGCAGGTTGG - Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132632922 16:928588-928610 TTCACTGCCCTGAGGGAGCAGGG + Intronic
1133894856 16:9916899-9916921 TTGAAGGCCAAGAGACACCATGG - Intronic
1137495839 16:48968593-48968615 TGGCATCCCCAGAGGGAGCAAGG + Intergenic
1137550114 16:49431769-49431791 AAGAATTCCCAGAGGTAGCAGGG + Intergenic
1139311735 16:66033376-66033398 CTGAATGCCCAGTGGCCACAAGG + Intergenic
1139660090 16:68414791-68414813 GGGAAGGCTCAGAGGCAGCAGGG + Intronic
1139660378 16:68416740-68416762 TTGAAGCCCCAGTGGCTGCATGG - Intronic
1140418597 16:74797020-74797042 TTGAATTCCCAGAGGGAGGGAGG + Intergenic
1143456993 17:7074690-7074712 TGGACTGCCCAGAGGCATGAGGG + Exonic
1143872121 17:9964523-9964545 GTGGATGCCTGGAGGCAGCAAGG - Intronic
1144108352 17:12007547-12007569 CTGACTGCCCAAAGTCAGCAGGG - Intergenic
1145916163 17:28575326-28575348 TTGTTTGCCCCTAGGCAGCATGG - Exonic
1146546087 17:33740064-33740086 TTGGGAGCCCAGAGGCAGAAAGG + Intronic
1147888196 17:43698621-43698643 TTGAAGGCCGAGAGCCAGGAAGG + Intergenic
1148510519 17:48165278-48165300 TTAAAAGCCCAGAGTCTGCAGGG + Intronic
1148866828 17:50633156-50633178 ATGAAGTCCCAGAGGCATCAAGG + Intergenic
1152214916 17:79026553-79026575 GAGAATGCCCAGGGGCAGGAAGG + Intronic
1203171721 17_GL000205v2_random:154326-154348 TTGAATGGCCAGTGGTATCAAGG + Intergenic
1153814732 18:8782743-8782765 TTGCATGGCAAGAGGCTGCAAGG + Intronic
1159306816 18:66653665-66653687 TCAAATGCCCTGAGGCAGCAGGG - Intergenic
1161195382 19:2983535-2983557 GTGAAGGCCCTGAGGCAGGACGG + Intronic
1161399670 19:4061671-4061693 TTAAAGGGCCAGAGGCAGGAAGG + Intronic
1161523293 19:4738071-4738093 TTGCATGCCCAGCTGCACCATGG - Intergenic
1161646307 19:5455515-5455537 CTTAATGCCTAGAGCCAGCAGGG + Exonic
1162086743 19:8253980-8254002 TTGGAGGCCCAGAGTCAGAAAGG - Intronic
1162189706 19:8935245-8935267 TGGAAAGCCCAGAGACAGCAGGG + Exonic
1163405168 19:17117418-17117440 GGGAGTGCCCAGAGGCAGCTTGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163995988 19:21047914-21047936 TGGATTGCTCAGAGCCAGCAGGG + Intronic
1164156621 19:22601316-22601338 TTGAAGGCACAGAGGCTGCCAGG - Intergenic
1164383547 19:27754882-27754904 TTGAATGCCTGGGGTCAGCAGGG + Intergenic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1166377578 19:42336260-42336282 TGGAGTGGCCAGTGGCAGCAGGG - Exonic
1167227408 19:48255964-48255986 TTGACTGCCCACAGCCATCATGG - Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
1168349280 19:55666856-55666878 GTGACTCCCCACAGGCAGCATGG - Intronic
1168482986 19:56737076-56737098 TTGGATGCTCAGAGGCAGGATGG + Intergenic
1168485696 19:56760169-56760191 TTGGATGCTCAGAGACAGGATGG + Intergenic
926434217 2:12822167-12822189 TGAAATGGCCAGTGGCAGCAGGG - Intergenic
927440311 2:23111414-23111436 TTGCATGCCCAGAGGGTGGAAGG - Intergenic
928389675 2:30899402-30899424 TTCACTGTCCAGATGCAGCAAGG - Intergenic
929243508 2:39676769-39676791 TGGAATGACCATAGGCAGGATGG - Intronic
930034283 2:47075869-47075891 AGCAATGCCCAGAGGCAGCAGGG - Exonic
930892866 2:56411491-56411513 ATAAATGCCTAGAGGGAGCAGGG + Intergenic
935322721 2:101904756-101904778 TTGGATGCAAAGAGGCAGGAGGG - Intergenic
935606218 2:104974496-104974518 TGGAAGGCACAGAGGCTGCATGG - Intergenic
936732911 2:115405529-115405551 TAGAATGCCCAGTGGAACCATGG - Intronic
937906928 2:127056969-127056991 TGGAATGCCCAGATACAGCAGGG - Intronic
939258413 2:139775252-139775274 TTAAATGCCTAGAGGCAAGAGGG + Intergenic
939258430 2:139775383-139775405 TTAAATGCCTAGAGGCAAGAAGG + Intergenic
939958353 2:148545482-148545504 TTGAGTGTCCAGAGCCACCAGGG + Intergenic
942401197 2:175605414-175605436 TAGAGTGGCGAGAGGCAGCAGGG - Intergenic
942535246 2:176956246-176956268 TTCAGTGTCCTGAGGCAGCAGGG - Intergenic
943169573 2:184380186-184380208 TTGAGTTACCAGAGGAAGCATGG + Intergenic
944322069 2:198357833-198357855 TAGAAAGACCAGAGGCAGGAAGG - Intronic
945681955 2:212924966-212924988 TAGAGTTCCCAGAGGGAGCATGG - Intergenic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
948603341 2:239119855-239119877 GCGACTGCACAGAGGCAGCAGGG + Intronic
1168808462 20:687068-687090 TTGAGTGTCCAGAGGTAGCAAGG + Intergenic
1173430373 20:42982565-42982587 GTGAAGGCCCTGAGGCAGCAAGG + Intronic
1173486647 20:43446151-43446173 TTGACTGTCGAGAGGCAGGAAGG - Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1175223249 20:57429545-57429567 TTGCATGCCCAGGGTAAGCACGG - Intergenic
1175307920 20:57990596-57990618 TACAATGCCCAGAGGAAACATGG + Intergenic
1176327704 21:5516161-5516183 TTGAATGGCCAGTGGTATCAAGG + Intergenic
1176400053 21:6304790-6304812 TTGAATGGCCAGTGGTATCAAGG - Intergenic
1176437104 21:6684314-6684336 TTGAATGGCCAGTGGTATCAAGG + Intergenic
1176461366 21:7011384-7011406 TTGAATGGCCAGTGGTATCAAGG + Intergenic
1176484927 21:7393162-7393184 TTGAATGGCCAGTGGTATCAAGG + Intergenic
1182994139 22:34797431-34797453 AGGAAGGCCCAGAGGCAGGAAGG + Intergenic
1183415159 22:37677424-37677446 ATGAATGACCAGACGCAGGAAGG - Intronic
1184298502 22:43541284-43541306 TTGAATCCTCAGAAGAAGCAGGG + Intronic
1184373496 22:44097478-44097500 ATGAATGCTGACAGGCAGCAAGG + Intronic
949102510 3:163076-163098 TTGAAGGCAGAGAGGAAGCAGGG - Intergenic
949409208 3:3745519-3745541 TAGAGTCCCCAGAGACAGCATGG - Intronic
949783672 3:7717455-7717477 TTGAAAGCCCTGTGGCAGGATGG - Intronic
952749732 3:36815553-36815575 TTCATTGCTCAAAGGCAGCAGGG - Intergenic
953079299 3:39600479-39600501 TTTAATTCCCAGAGGCAACCTGG + Intergenic
953475591 3:43203213-43203235 TTTAATGCAAAGAGACAGCATGG - Intergenic
953682244 3:45048393-45048415 GTCACTGCCCAGAGGCAGCCGGG - Intergenic
955143621 3:56294000-56294022 TTTGATGCCAAGGGGCAGCAAGG - Intronic
961728551 3:128950182-128950204 CTGAATGCCCACAGACAGAAAGG - Intronic
962573639 3:136736017-136736039 TTGAAGGCCCAGATGAAACAGGG - Intronic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
965624092 3:170669854-170669876 TTGCAGATCCAGAGGCAGCATGG - Intronic
967266262 3:187694909-187694931 TAGAATGCCCAGTGTCAGCCAGG + Intergenic
967463347 3:189773809-189773831 GTGAAAGGCCAGAGACAGCATGG - Intronic
968046895 3:195629530-195629552 CTGAGTGCCCAGCGTCAGCATGG + Intergenic
968307758 3:197660514-197660536 CTGAGTGCCCAGCGTCAGCATGG - Intergenic
969297631 4:6279140-6279162 CTGCATGCCCAGTGGCCGCAGGG + Intronic
969388349 4:6871988-6872010 TTGCCTGCACAGAGGCAGGAGGG + Intronic
970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG + Intergenic
974522974 4:63009404-63009426 TTGTATGCCGAGACTCAGCATGG - Intergenic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
977730806 4:100349475-100349497 TGGCATGGCCAGAGACAGCAGGG + Intergenic
979981495 4:127261573-127261595 TTGGATGCCTAGAGGCCACAGGG + Intergenic
980090716 4:128440611-128440633 TTAAAGGCTCAGAGGCAGAAGGG - Intergenic
982103446 4:151990910-151990932 TTGAATGCACAGAGACAGCAGGG - Intergenic
985617517 5:932579-932601 TGGTCTGCCCAGAGGAAGCATGG + Intergenic
986860342 5:11920147-11920169 TTGGATGCACAGAGACACCAGGG - Intergenic
987026558 5:13932726-13932748 ATGCATGCCCAGAGGCAGTCAGG + Intronic
989545452 5:42667316-42667338 TTGAATCCCCAGGGGCATCTGGG - Intronic
989578594 5:43011218-43011240 TTGAAATCCCAGAGACAGCAAGG + Intergenic
990513571 5:56511512-56511534 TCCAGTTCCCAGAGGCAGCAGGG - Intergenic
990674247 5:58165731-58165753 TTGAATGCACAGAGGCAGTGGGG + Intergenic
991008674 5:61858262-61858284 TTCACAGCCCTGAGGCAGCAAGG + Intergenic
992999049 5:82361913-82361935 GAGAATGCCCAGCGACAGCATGG + Intronic
993526874 5:88975887-88975909 ATGATTGCCAAGAGGCAGGAGGG + Intergenic
996086228 5:119308452-119308474 TTCAGTGCCAAGAGGCAGGAAGG - Intronic
997248657 5:132372104-132372126 TTCAGTGTCCAGAGGCATCATGG + Intronic
997852874 5:137348074-137348096 TTTGCTGCCCAGAGACAGCAGGG + Intronic
1001313214 5:170625728-170625750 GTCAAAACCCAGAGGCAGCAGGG + Intronic
1001483883 5:172106118-172106140 TCAAGTGCACAGAGGCAGCACGG + Intronic
1002495144 5:179606617-179606639 TTAGATGCCCAGAGACATCAGGG - Intronic
1003227220 6:4217338-4217360 TGGAAAGTCCAGAGGCAGCGGGG + Intergenic
1003381041 6:5624937-5624959 TTCGATGTCCAGAGCCAGCATGG + Intronic
1004543462 6:16573777-16573799 TTGTAGGCACAGTGGCAGCAGGG - Intronic
1006598174 6:35208734-35208756 TGGAAGGACAAGAGGCAGCAGGG + Intergenic
1007247313 6:40471898-40471920 CTGAGTGCCCAGAAGCAGCGAGG + Intronic
1008546825 6:52590563-52590585 TGGGGTCCCCAGAGGCAGCAGGG - Intergenic
1008612986 6:53201458-53201480 ATGAAGGGCCAGAGACAGCAGGG - Intergenic
1008810863 6:55497112-55497134 ATGAATGCATAAAGGCAGCATGG + Intronic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1013290934 6:108718110-108718132 ATGTATTCCCAGAGGCAGTAAGG - Intergenic
1013990819 6:116252566-116252588 ATGAAGGCCCAGAGGAAGAATGG + Exonic
1016778678 6:147934601-147934623 TGGGAAGTCCAGAGGCAGCAGGG + Intergenic
1016810502 6:148256697-148256719 TTGACTGCAAAGAGGCAGAAGGG + Intergenic
1017307912 6:152940542-152940564 TTCAAGGCCCAGAGGTAGGAGGG - Intergenic
1017602662 6:156100535-156100557 TCGAAGGCACAGAGGCAGGAAGG - Intergenic
1018489032 6:164272768-164272790 CTCAAGGCCCAGAGGAAGCAAGG - Intergenic
1018807067 6:167270026-167270048 AGGACTGCCCAGAGGCTGCACGG + Intergenic
1019279873 7:194143-194165 CTGAAAGCCCAGCGGCAGCCTGG - Intronic
1019553481 7:1616818-1616840 TCCAATGCGCGGAGGCAGCAGGG - Intergenic
1020251212 7:6469988-6470010 TTGACTGCGAAGCGGCAGCATGG - Intronic
1020346995 7:7176015-7176037 TTGTATGCCTGGAGACAGCATGG + Intronic
1020427764 7:8089236-8089258 TTAAATGCCAAGAGGAAGCCAGG - Intronic
1021588017 7:22230595-22230617 TTTACTTCCCAGAGGAAGCAAGG - Intronic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1022564307 7:31382196-31382218 TTGAATGCCCATACAGAGCAGGG + Intergenic
1023563477 7:41500136-41500158 TTGAGTGTCAAGAAGCAGCAAGG + Intergenic
1024207229 7:47174219-47174241 TTGGGTGCACAGAGACAGCATGG - Intergenic
1025225806 7:57161690-57161712 TTACAGGCCCATAGGCAGCAGGG - Intergenic
1027467240 7:78531047-78531069 TTGAGTTCCCTGAGGGAGCAGGG - Intronic
1028238608 7:88391530-88391552 TTGAATTCCCAGAGGGAACATGG + Intergenic
1028632320 7:92948383-92948405 TTGAATGCAAAGAGTTAGCATGG + Intergenic
1029935818 7:104423164-104423186 TAGGATGGGCAGAGGCAGCAGGG + Intronic
1032759197 7:134922827-134922849 TTAAATACACTGAGGCAGCAAGG + Intronic
1034313572 7:150110728-150110750 TAGAAGGGCCAGAGCCAGCAGGG + Intergenic
1034793324 7:153990068-153990090 TAGAAGGGCCAGAGCCAGCAGGG - Intronic
1038202662 8:25429435-25429457 TTGAATTCCTAGATGCAGTATGG - Exonic
1038291136 8:26250934-26250956 TTGACTGCACAGAGGCACAAAGG + Intergenic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1043850899 8:85215636-85215658 TGGCATGCCCAGAGAGAGCAGGG + Intronic
1043966490 8:86483091-86483113 TTGAAAGACCAGTGGCAGGAAGG - Intronic
1043980071 8:86627752-86627774 TTGTGTGCCCTGAGGCAGGATGG + Intronic
1046746565 8:117882396-117882418 TTGAATGGCAAGTGGCAGGATGG + Intronic
1047255814 8:123212741-123212763 TGCAAACCCCAGAGGCAGCAAGG - Intergenic
1047433622 8:124815824-124815846 CTGAATGCTGAGAGGCACCAGGG + Intergenic
1049331968 8:142059427-142059449 ACGCATGCCCAGAGGCAGCGGGG + Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1050462998 9:5893218-5893240 ATGAAAACCCAGAGGCTGCAGGG + Intronic
1050745801 9:8874558-8874580 TTGGCTGGCCAGAGGCACCAAGG - Intronic
1051116177 9:13697386-13697408 GTGAATGCCCATAGGAAGGAAGG - Intergenic
1051503511 9:17803624-17803646 TTATCAGCCCAGAGGCAGCAGGG + Intergenic
1052055532 9:23902860-23902882 TTCAATGTCCAGAGGTAGGAGGG - Intergenic
1053360005 9:37478715-37478737 TTGAATACCTAGATGCAGTATGG + Intergenic
1056084909 9:83137820-83137842 GTAAATGCTCAGAGGCAGGAGGG + Intergenic
1057013556 9:91630475-91630497 CTGAATGCCCAGTGGAGGCAGGG + Intronic
1058009490 9:99960735-99960757 TAGAATGCTCAAAGGCAGCAGGG - Intronic
1059279946 9:113124397-113124419 TTGGATGCACAGAGGCAGTGGGG + Intergenic
1059874773 9:118621918-118621940 TTAAAGGGCCAGAGGCAGTATGG + Intergenic
1060552537 9:124492410-124492432 TAGAAAGTCCAGATGCAGCAGGG - Intronic
1061779463 9:132987217-132987239 TGGGAAGCCCAGAGGGAGCAAGG - Intronic
1062018388 9:134303870-134303892 TTGAAGGCCCAGATCCAGAAGGG - Intergenic
1062276819 9:135735322-135735344 TTGGACCCCCAGAGGGAGCAGGG + Intronic
1186518612 X:10186107-10186129 TTTGATGCCTAGAGGAAGCAAGG + Intronic
1186932243 X:14406480-14406502 TTTAAAGCCCAGAGTAAGCAGGG + Intergenic
1189411301 X:40774446-40774468 TAGAATGTTCAGAGACAGCAGGG + Intergenic
1190280661 X:48927337-48927359 TTCAATACCCAGAGACAGCCTGG + Intronic
1191234340 X:58122048-58122070 TTGAATGCCTGGGGTCAGCAAGG - Intergenic
1191850270 X:65581171-65581193 TTTTATTCCCAGAGCCAGCAAGG + Intergenic
1192993544 X:76488145-76488167 TTGAGTCTACAGAGGCAGCATGG + Intergenic
1195472235 X:105243772-105243794 TTGTATGCCTAGACTCAGCATGG + Intronic
1195486045 X:105407450-105407472 TTGAATACCTAGATGCAGTATGG + Intronic
1197599230 X:128508108-128508130 TTGACTGCCCAGAGCCATCTTGG + Intergenic
1197828047 X:130611976-130611998 TAGAATGCCAAGAAGCAGCATGG - Intergenic
1198990375 X:142507177-142507199 TTGCATGCCTCGAGGTAGCAGGG - Intergenic