ID: 1094093728

View in Genome Browser
Species Human (GRCh38)
Location 12:26679450-26679472
Sequence AGCAGGAAATGGGACCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094093721_1094093728 -3 Left 1094093721 12:26679430-26679452 CCCATGAAGCCATCACCAAGAGC 0: 1
1: 0
2: 1
3: 33
4: 302
Right 1094093728 12:26679450-26679472 AGCAGGAAATGGGACCCTGCAGG 0: 1
1: 0
2: 1
3: 34
4: 212
1094093722_1094093728 -4 Left 1094093722 12:26679431-26679453 CCATGAAGCCATCACCAAGAGCA 0: 1
1: 0
2: 4
3: 71
4: 444
Right 1094093728 12:26679450-26679472 AGCAGGAAATGGGACCCTGCAGG 0: 1
1: 0
2: 1
3: 34
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094093728 Original CRISPR AGCAGGAAATGGGACCCTGC AGG Intronic
900955472 1:5883956-5883978 AGCAGGACACGGAACCCTGCTGG + Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901076063 1:6555403-6555425 AGCAGGAAATGAGAAGCTGCAGG - Exonic
902628638 1:17691444-17691466 AGCAGGAAATGGTCTCCTGCCGG + Intronic
903236105 1:21951731-21951753 AGCAGGACATGGAGCCCTGGGGG - Intergenic
903300329 1:22374357-22374379 AGCAGGAGAGCAGACCCTGCAGG + Intergenic
903681133 1:25097973-25097995 AGCAGGAAATGGAACCAGGATGG - Intergenic
903848011 1:26289958-26289980 TGCAGGAAAGGAGGCCCTGCAGG + Intronic
907862038 1:58362957-58362979 AGCCAGAAATTGAACCCTGCTGG - Intronic
908472303 1:64456111-64456133 AGCGGGAACTGGGACCATGGAGG + Intergenic
908747120 1:67386408-67386430 TGCGGGAAATGGGACCCTAAGGG - Intronic
910427275 1:87130255-87130277 CACAGGAGCTGGGACCCTGCTGG - Intronic
913109334 1:115642817-115642839 AGAAGGAAATGAGGTCCTGCCGG - Intronic
915603541 1:156937218-156937240 AGCAGGGCTTGGGTCCCTGCAGG - Intronic
918311501 1:183288620-183288642 GAGAGGAAAGGGGACCCTGCAGG - Intronic
919004775 1:191882731-191882753 CACAGAAAATGGGACCCCGCTGG - Intergenic
919652763 1:200166651-200166673 AGCAGGAATCTGAACCCTGCAGG - Intronic
920726000 1:208435805-208435827 AGCAGGCAGTGGGACCCAGCAGG + Intergenic
920976432 1:210790240-210790262 AGCAGGGACTTGGACCCTGTGGG - Intronic
922114733 1:222601671-222601693 AGCAGGAAATGAGATTTTGCAGG + Intergenic
924009112 1:239644843-239644865 CCCAGGCCATGGGACCCTGCTGG - Intronic
1062827066 10:578655-578677 AACAGGAATAGGGCCCCTGCAGG - Intronic
1063193248 10:3717668-3717690 AACAGGGCAAGGGACCCTGCAGG + Intergenic
1063490996 10:6463744-6463766 AGCAGGAAGTGGGACCCAAAGGG + Intronic
1063503974 10:6580056-6580078 AGTAGGAAATGGAACCAAGCGGG - Intronic
1065664529 10:28043382-28043404 GGCAGGAAATGGCAGCCAGCTGG + Intergenic
1066558838 10:36646369-36646391 AGGAGGCAATGGGACCATGGAGG - Intergenic
1066680081 10:37929748-37929770 AGCTGGAGATGATACCCTGCAGG - Intergenic
1067080558 10:43210059-43210081 AGCAGCAGATGTGACCCAGCAGG - Intronic
1069847739 10:71384427-71384449 CCCAGGGAATGGGAGCCTGCAGG + Intergenic
1070331203 10:75418549-75418571 AGCAGCAGATGGGACTCTGTAGG - Intergenic
1070948366 10:80411417-80411439 CTCAGGAAGTGGGGCCCTGCAGG - Intronic
1071284169 10:84128990-84129012 AGAAGGAGATGTGACCCTGGAGG - Intergenic
1073266994 10:102233885-102233907 GGCAGAAAAGGGGACCCTGCGGG - Intronic
1074391709 10:113063534-113063556 AGCGGGAGATGGGAACCTGGTGG + Intronic
1075663143 10:124212239-124212261 ACCGGGAAATGGGCCCTTGCCGG - Intergenic
1077332640 11:1990185-1990207 AGCAGGAGATGGGGCCCAGGGGG - Intergenic
1078407114 11:11079962-11079984 AGGAAGAAAGGGGACCCTACTGG - Intergenic
1082858706 11:57833093-57833115 AGCAGGATATGGGACTATGAAGG + Intergenic
1084072115 11:66743608-66743630 AGCAGCAGCTGGGACTCTGCAGG + Intergenic
1086178167 11:83917599-83917621 AGGATGAAATCTGACCCTGCTGG + Intronic
1087239236 11:95756982-95757004 AGCAGCAATGTGGACCCTGCTGG - Intergenic
1088422837 11:109668015-109668037 AGCAGGCAAGGGGAACCTGTTGG - Intergenic
1089074747 11:115729046-115729068 AGAAGGAAGTGGGGCCCTCCTGG + Intergenic
1089231574 11:116982134-116982156 AGATGGAACTGGGACCCTGGAGG - Intronic
1089588464 11:119524698-119524720 AGCAGAATATGGGCCCCTGGGGG + Intergenic
1090426020 11:126607512-126607534 AGCAGGAACTGGGCTCCCGCTGG + Intronic
1090436083 11:126687420-126687442 AGCAGGAAATCTCACCCAGCTGG + Intronic
1091163712 11:133451318-133451340 AGAAGGAAATGGGATGATGCTGG + Intronic
1202815623 11_KI270721v1_random:45361-45383 AGCAGGAGATGGGGCCCAGGGGG - Intergenic
1091649510 12:2299407-2299429 AGCAGGAAATGGTACACAGCTGG - Intronic
1094093728 12:26679450-26679472 AGCAGGAAATGGGACCCTGCAGG + Intronic
1096587532 12:52632507-52632529 AGGAGGCAATGGGCCCCTTCAGG + Intergenic
1097459247 12:59839872-59839894 AGGAGGAAATGCCAGCCTGCTGG - Intergenic
1099286411 12:80717934-80717956 AGCAGGAACTGGGGCCGTGTGGG - Intronic
1099413085 12:82356077-82356099 AACAGGAAATGGGACCACGGGGG - Intronic
1101697768 12:107142522-107142544 TGGAGGAAATGGGACCCAGGTGG + Intergenic
1103863758 12:124034905-124034927 GGGAGGACCTGGGACCCTGCTGG + Intronic
1103936466 12:124480128-124480150 GGCAGAAAAGGGGACCCTGTAGG + Intronic
1104873488 12:132017008-132017030 GGCAGGAAATGGGACCATGGTGG - Intronic
1105255150 13:18739412-18739434 AGCAGGAAAGGGGACCACGCAGG + Intergenic
1105922919 13:24982333-24982355 AGCAGGGAATGTGGACCTGCTGG - Intergenic
1106433318 13:29703138-29703160 AGCAGGAAATGAGTCACTGGAGG - Intergenic
1107332005 13:39311540-39311562 TGCAGGAAGTGGGACAGTGCTGG + Intergenic
1108590097 13:51905596-51905618 AGCAGGAAGTGGAATCCTGCAGG + Intergenic
1112550832 13:100418869-100418891 AGCAGACAATGGCACTCTGCAGG + Intronic
1112896091 13:104302517-104302539 AGCAGTAAGTGAGACCCTGGAGG - Intergenic
1115641305 14:35337206-35337228 GGCTGGAAAAGGGACCCTGACGG - Intergenic
1115667031 14:35562301-35562323 AGCAGGAAGTGTGAGCCTTCAGG + Intronic
1115816307 14:37168033-37168055 AGCAGGCAAGGTGAACCTGCTGG + Intronic
1119804579 14:77474652-77474674 AGCATGACATGGGACACTGCTGG + Exonic
1122355520 14:101120898-101120920 GGCTGGAACTGGGGCCCTGCTGG + Intergenic
1122913256 14:104843956-104843978 AGGAGGCACTGAGACCCTGCGGG - Intergenic
1122977934 14:105178603-105178625 TGCCGGAGATGGGACCCCGCGGG - Intronic
1123574949 15:21656806-21656828 AGCAGGGAAGGGGACCTTGGCGG - Intergenic
1123611564 15:22099295-22099317 AGCAGGGAAGGGGACCTTGGCGG - Intergenic
1125687505 15:41572347-41572369 AGCTAGAGATGGGACCCAGCAGG + Intronic
1126879140 15:53075892-53075914 GCCAGGAAATGGGACCTTTCTGG + Intergenic
1127936553 15:63645648-63645670 AGCATGAAGTGGGACCCTACAGG - Exonic
1130394373 15:83489373-83489395 AACAGGAAATGGGACCAGGATGG - Intronic
1130969564 15:88721374-88721396 TGTAGGTGATGGGACCCTGCTGG - Intergenic
1131066162 15:89436118-89436140 AGCAGGCACGAGGACCCTGCAGG - Intergenic
1131614944 15:94006257-94006279 AGCATGGAATGGGACCCAGCGGG - Intergenic
1202983817 15_KI270727v1_random:391050-391072 AGCAGGGAAGGGGACCTTGGCGG - Intergenic
1134416381 16:14047235-14047257 AGCAGAAAATGAGAGCATGCTGG + Intergenic
1137974396 16:53018990-53019012 GGCAGGAGATGGGAACCTGAAGG - Intergenic
1138182693 16:54953006-54953028 ATCAGGAAGTTGGCCCCTGCTGG - Intergenic
1138193514 16:55035575-55035597 AGCAGATAACAGGACCCTGCAGG + Intergenic
1138884858 16:61064327-61064349 AGCATGAAATGGGAACAAGCTGG + Intergenic
1139573212 16:67826087-67826109 AGCAGGACCTGGGGCCCTGCCGG - Intronic
1139587290 16:67912173-67912195 AGCAGTAAATGGGACCATACTGG + Intronic
1142232072 16:88904691-88904713 TGCAGGAGATGGGACCTTTCCGG + Intronic
1142716675 17:1750881-1750903 AGCAGGAAAGGGGAGCCTCGGGG - Intronic
1143336033 17:6172099-6172121 AGGAGGAAATGGGTCTCCGCGGG - Intergenic
1143573358 17:7775253-7775275 AGCAGCAAATGGGAAGCTGTGGG + Exonic
1146617362 17:34367594-34367616 ACCAGGAAATGGGCCCCAGTAGG - Intergenic
1148473216 17:47908916-47908938 GGCAGGACATGTGTCCCTGCTGG - Intronic
1150809945 17:68348370-68348392 AGCAGGAAGTGGTACCATGATGG + Intronic
1151497175 17:74466000-74466022 ATCAGGAAAGGGGTCCTTGCAGG + Intergenic
1151538257 17:74750547-74750569 GGCAGGAAGTGGGAGCCTGGTGG - Intronic
1154435872 18:14341190-14341212 AGCAGGAAAGGGGACCACGCAGG - Intergenic
1157588516 18:48820504-48820526 AGCTGGAAATGTGGGCCTGCGGG - Intronic
1157994260 18:52536174-52536196 AGGAGGAAATGGAACCATGTGGG + Intronic
1158780032 18:60637678-60637700 AGCAAGAAAGAAGACCCTGCTGG - Intergenic
1159266055 18:66081075-66081097 ACCAGGACAAGGGACCCTGGTGG + Intergenic
1161297171 19:3526009-3526031 GGCAGGAGATGGGACCCCCCGGG + Intronic
1163389706 19:17022868-17022890 AGGATGAAGTGGGATCCTGCCGG - Intronic
1164037418 19:21466947-21466969 AGCAGGAAATGGGAGAGTCCAGG + Intronic
1164903636 19:31949118-31949140 AGCAGGGAGGGGGACCCTGGGGG + Intergenic
1164983574 19:32631859-32631881 AGCAGGGAATTGGGCTCTGCAGG - Intronic
1166792840 19:45408232-45408254 AGCTGGAGAAGCGACCCTGCTGG + Exonic
927120966 2:19962963-19962985 AGCAGGAAATGGGAACTTAGGGG - Intronic
929855245 2:45632111-45632133 AGCAGGAAGAGGGCCCCTGCGGG + Intergenic
930042014 2:47132678-47132700 ATCAGGAAATAGGACATTGCTGG - Intronic
930866000 2:56122285-56122307 AGCAGGACATGGGAGCCTCTTGG - Intergenic
931845464 2:66199452-66199474 AGCAGGAAATGGGCACCTAATGG - Intergenic
933319620 2:80757450-80757472 AGCTGTAGATGGGACCCTGCCGG - Intergenic
937356662 2:121202136-121202158 AGCAGGAAGTGGGACCATGCTGG + Intergenic
938257133 2:129868274-129868296 AGCAGGACAGAGGACCCTCCAGG + Intergenic
938716655 2:134027811-134027833 AGTAGGAAAGGCGCCCCTGCAGG - Intergenic
939692978 2:145288902-145288924 AACAGGAAATGTGACCCAGGTGG + Intergenic
940237453 2:151526653-151526675 AGCAGGAATTAGGACCCTGAAGG - Intronic
941582698 2:167318924-167318946 CTCAGGGAATGGGCCCCTGCAGG - Intergenic
941975401 2:171399069-171399091 AGCTGAAAATGGGAACCTGTGGG - Intronic
942424293 2:175842790-175842812 AAGAGGAGATGGGATCCTGCAGG - Intergenic
942982720 2:182101500-182101522 AGCATGAAAGGGAACTCTGCTGG + Intronic
944155799 2:196606273-196606295 ACCAGGAAATGGGTCCTTACCGG + Intergenic
945898042 2:215506450-215506472 AGCAGGAACTAGGAGCCTGAAGG + Intergenic
946320868 2:218953729-218953751 AGCAGGACATGGCACGCAGCTGG - Intergenic
947015941 2:225619687-225619709 GGCAGGAAATGGGAAACTTCAGG + Intronic
947945350 2:234097108-234097130 AGCAGGAAAATGTACCCAGCAGG - Intergenic
948445298 2:238027911-238027933 AGCAGGCGAAGGGTCCCTGCCGG - Intronic
1170032808 20:11959975-11959997 ACCAGCAAAAGGGACCCTGGGGG + Intergenic
1171125826 20:22601177-22601199 AGCAGGAAATTGGATCCCTCTGG - Intergenic
1171879984 20:30611385-30611407 AGCGGGAAAGGGGACCATGCAGG + Intergenic
1174086907 20:48015611-48015633 AGTAGACAATGGGACCCTCCGGG - Intergenic
1174295775 20:49544076-49544098 GGCTGGAAATGGGACCTTACAGG - Intronic
1174517778 20:51106347-51106369 ACCAGGAAATGGGCCCTTACTGG + Intergenic
1175569978 20:60011016-60011038 GGCAGGAAATGTGATCTTGCCGG + Intronic
1176841164 21:13844444-13844466 AGCAGGAAAGGGGACCACGCAGG + Intergenic
1179138532 21:38701513-38701535 ACAAGGAAAGGGGACCCAGCTGG + Intergenic
1180110697 21:45647669-45647691 TGAAGGAGTTGGGACCCTGCTGG + Intronic
1181545582 22:23600295-23600317 AGCTGGAAGTGGGTCCCTGAAGG - Intergenic
1181735206 22:24876221-24876243 AGGAGGGAAGGGGAGCCTGCTGG - Intronic
1181814726 22:25429604-25429626 AGCCGGAAGTGGGTACCTGCAGG + Intergenic
1183042328 22:35191597-35191619 AACAGGAAATGGGAACCCTCTGG - Intergenic
953683820 3:45060653-45060675 AGAATGAAATTGGCCCCTGCTGG + Intergenic
953986730 3:47449613-47449635 AGCAGGAAAGGGGATCCTCATGG - Intronic
960966823 3:123111284-123111306 AGCAGGAAATGGGACATGGTGGG - Intronic
961438829 3:126938726-126938748 AGCAGGAAAGGTGGCCCTGTAGG + Intronic
961455657 3:127022683-127022705 AGCAGGCACAGGGCCCCTGCAGG - Intronic
961814721 3:129543582-129543604 AGCAGGAAACGGGCTCCAGCTGG - Intronic
961825347 3:129596444-129596466 AGCTGGAAATGGGGCCAGGCCGG - Intronic
961825949 3:129599168-129599190 ACCAGGACATGGAACCCAGCTGG + Intronic
962374337 3:134847639-134847661 GGCAGGAAATGGGAACCAGAAGG + Intronic
962972689 3:140418914-140418936 AGCAGGAAATGGGAAGGTGAGGG - Intronic
964809841 3:160651758-160651780 AGCAGCAAATGGCAGCCTGGAGG - Intergenic
965494754 3:169384093-169384115 AGTAGGAAATAGGTCCCTGATGG + Intronic
966807235 3:183817250-183817272 AGCATGGCATGGGCCCCTGCGGG - Exonic
967423779 3:189302930-189302952 AGCAAGAAATGGCAGCCTGATGG + Intronic
968045205 3:195620065-195620087 AGAAGGAAGAGGGGCCCTGCTGG - Intergenic
968061058 3:195726408-195726430 AGAAGGAAGAGGGTCCCTGCTGG - Exonic
970324967 4:14913998-14914020 AGGAGGCAATGGGACCATGGAGG - Intergenic
971427331 4:26529516-26529538 AGCAGGAAAGGGGATGGTGCAGG + Intergenic
971766030 4:30833239-30833261 AGCAGGAAATGGGTCTCAGTGGG + Intronic
979116974 4:116836991-116837013 AGTAGGAGTTGGGACCCTTCAGG + Intergenic
979471258 4:121099997-121100019 AGCTGCAAATAGGAGCCTGCAGG + Intergenic
979728908 4:123998012-123998034 AGCAGGAAATGTGATTTTGCTGG + Intergenic
985589008 5:755229-755251 AGCAGGGAATGGGAGGCTGGGGG + Intronic
985603688 5:847745-847767 AGCAGGGAATGGGAGGCTGGGGG + Intronic
986490210 5:8281341-8281363 AGAATGAAATGGGAACCTGCTGG + Intergenic
991341479 5:65615498-65615520 AGGAGGAAGGGGGGCCCTGCAGG - Intronic
991520164 5:67488111-67488133 ACCATTAAATGGGCCCCTGCTGG - Intergenic
992681493 5:79157839-79157861 AGCAGGACATGGGTCCCTGATGG - Intronic
995038223 5:107559224-107559246 TGGAGGCAATGGGACCCAGCAGG - Intronic
998382594 5:141736227-141736249 CGCAGGAGATCAGACCCTGCAGG - Intergenic
998514571 5:142741193-142741215 AGCAGGAGATGGGTCCGTGGAGG + Intergenic
1000383680 5:160652149-160652171 AGCAGGAAAGGAGACACAGCAGG - Intronic
1001775280 5:174324234-174324256 AGCAGCAGAGGGGAACCTGCTGG + Intergenic
1002196191 5:177502896-177502918 AGCCAGAAAAGGGTCCCTGCAGG + Intronic
1002775893 6:327304-327326 AGCTGTAAATGGGGCTCTGCTGG - Intronic
1003041115 6:2688003-2688025 AGCAGGAAGCGGGTCCCTGATGG + Intronic
1003399835 6:5782437-5782459 AGCAGGGAATGTGGACCTGCTGG - Intergenic
1006037935 6:31228722-31228744 TGCAGGAGATGGGAGCATGCGGG + Intergenic
1006577013 6:35053892-35053914 AGCAGTACATCGGACCCTGTGGG + Intronic
1006746638 6:36347321-36347343 AGCAGGAAGAGGGACACTCCCGG - Intergenic
1006981215 6:38149788-38149810 AGCAGGAAATGGATTACTGCTGG - Intronic
1007251502 6:40498204-40498226 AGCAGGAGATGGGACACAGCTGG + Intronic
1007582285 6:42966689-42966711 AGAAGGGAATGGGACGCTGATGG - Intronic
1009839260 6:69046420-69046442 AGCAGGGATTTGGACCCTGCAGG + Intronic
1010549867 6:77208247-77208269 ACCAGGAAGTGGGAACTTGCTGG + Intergenic
1013628377 6:111959998-111960020 ATGAGGAAATGGGACCCAGCTGG + Intergenic
1015447714 6:133326668-133326690 TGCAGGGAGTGGGACCTTGCCGG + Intronic
1018721001 6:166572686-166572708 AGGAGGAAAGGGGGCCTTGCTGG - Intronic
1020140659 7:5609741-5609763 TGGAGGAAATGGGGCCCAGCTGG - Intergenic
1020343174 7:7134669-7134691 AGCAGGAAATGTGAACATGAGGG + Intergenic
1020531440 7:9342321-9342343 AGAAGGAAATGCAACCTTGCTGG - Intergenic
1020842941 7:13243622-13243644 ATCAGGAAATGGGCCCTTGCAGG + Intergenic
1023048648 7:36232795-36232817 AGCAGGACATGGCATCCTTCAGG + Intronic
1023394443 7:39739439-39739461 AGAAGGAAATGGGAAGATGCAGG + Intergenic
1024087457 7:45907321-45907343 ATGAGGAAATGGGACCCAGAAGG + Intergenic
1024870072 7:53954998-53955020 AGCATGGAAGGGGACCCGGCTGG + Intergenic
1025854404 7:65265053-65265075 AGCAGGAAATGAGAGCGTCCAGG + Intergenic
1026863676 7:73809956-73809978 AGCTGGAGCTGGGTCCCTGCTGG - Intronic
1028021876 7:85786879-85786901 AACAGAAAATGGAACTCTGCAGG + Intergenic
1029268337 7:99359889-99359911 AGCTGGAAATGAGAGCCTGGCGG - Intronic
1030439469 7:109569281-109569303 AGCAGAAAATGGAACTCTGTGGG - Intergenic
1031630990 7:124042601-124042623 ACCAGGAAATGGGACCTCACTGG - Intergenic
1032705029 7:134414190-134414212 GGCAGGAAATGGAGCCCTGGGGG + Intergenic
1033467748 7:141611263-141611285 AGGAGGAGATGGGACACTGCAGG + Exonic
1034080797 7:148276070-148276092 AGCAGGACATGTGGCCCTGCTGG - Intronic
1035717506 8:1764695-1764717 AGCAGGAGGTGGGACCCGCCTGG + Intronic
1036406504 8:8460197-8460219 AGCAGGCAGTGGGACCAGGCTGG - Intergenic
1037940229 8:22945723-22945745 AGGAGGAAATGGAACAGTGCTGG - Intronic
1041549561 8:59085052-59085074 AGATAGAAATGGGCCCCTGCAGG + Intronic
1041772734 8:61489886-61489908 AGCAGGAAATTGCAACCTGAGGG + Intronic
1041783640 8:61607031-61607053 AGGAGGAAATGACACACTGCTGG - Intronic
1042194470 8:66220764-66220786 AGCAGGCAAGGAGATCCTGCAGG + Intergenic
1045187766 8:99856351-99856373 AGTAGGAAATGGGAAGATGCTGG + Intronic
1045951526 8:107856612-107856634 AGTAGCACGTGGGACCCTGCAGG - Intergenic
1048017325 8:130509116-130509138 AGGAGGCAATGGGATCCTGGAGG - Intergenic
1048497236 8:134945485-134945507 AGAAGGAAACTGGCCCCTGCAGG - Intergenic
1049207651 8:141370894-141370916 GGCAGGCTATGAGACCCTGCAGG + Intergenic
1049235226 8:141508796-141508818 AGCTGGAGGTGGGACCCAGCTGG - Intergenic
1049677073 8:143894829-143894851 AGATGGAGAGGGGACCCTGCTGG + Intergenic
1052881582 9:33603960-33603982 AGCAGGAAAGGGGAACATGCAGG - Intergenic
1054762007 9:69012484-69012506 AGGAGGAAAGGGGACACTGGTGG + Exonic
1056544019 9:87598034-87598056 AGCAGGAGATAAGACCCTGAGGG - Intronic
1057638667 9:96796198-96796220 AGCAGCAACTGGGACCCAGGAGG - Intergenic
1058132901 9:101273521-101273543 AGCAGGCAATGCTACCCTGCCGG + Intronic
1059433100 9:114261410-114261432 AGCAGGACTGGGGAACCTGCGGG + Intronic
1060054161 9:120399589-120399611 AGCAGGACATGGGACACTCCAGG + Intronic
1060723799 9:125994703-125994725 GGCAGGAGATGCCACCCTGCTGG + Intergenic
1060875900 9:127083450-127083472 AGCAGAGAAAGAGACCCTGCAGG + Intronic
1062217517 9:135397292-135397314 TGCAGGAAGTGGCACACTGCTGG + Intergenic
1062266468 9:135688620-135688642 TGCAGGAACTGTGACCCTGCAGG - Intergenic
1062266481 9:135688686-135688708 TGCAGGAACTGTGACCCTGCAGG - Intergenic
1186157131 X:6737526-6737548 AGCAGGTATTAGGACCCTGAAGG + Intergenic
1187182278 X:16954487-16954509 AGAAGGAAATGGAAACATGCAGG + Intronic
1187619535 X:21035719-21035741 AGCAGGAAATGGAATTTTGCTGG - Intergenic
1188331289 X:28874780-28874802 AGCAGTAAATAGGAATCTGCTGG + Intronic
1189314591 X:40045751-40045773 AGCAGGAAATGGGTACATGGAGG - Intergenic
1196251843 X:113470067-113470089 AGCAGGCAAGGTGAACCTGCTGG - Intergenic
1197972618 X:132130964-132130986 AGGAGGAGATGGGACACTGCAGG - Intergenic
1199104640 X:143849728-143849750 ACCAGGAAATGGGTCCTTGAGGG - Intergenic
1200090326 X:153632967-153632989 AGCAGCAACAGGGACCCAGCGGG + Intergenic
1200169783 X:154064236-154064258 AGGAGGAAATGGGGACCTGGAGG - Intronic
1201602793 Y:15749185-15749207 AGCATGAAAGGGGACCCTAGTGG - Intergenic