ID: 1094096130 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:26706847-26706869 |
| Sequence | CCCAAGGAAGGTGTTGTGAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 198 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 13, 4: 182} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1094096130_1094096137 | 15 | Left | 1094096130 | 12:26706847-26706869 | CCTTTCACAACACCTTCCTTGGG | 0: 1 1: 0 2: 2 3: 13 4: 182 |
||
| Right | 1094096137 | 12:26706885-26706907 | AATATTGTCTATGTATGATTTGG | 0: 1 1: 0 2: 1 3: 25 4: 275 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1094096130 | Original CRISPR | CCCAAGGAAGGTGTTGTGAA AGG (reversed) | Intronic | ||