ID: 1094096137

View in Genome Browser
Species Human (GRCh38)
Location 12:26706885-26706907
Sequence AATATTGTCTATGTATGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094096130_1094096137 15 Left 1094096130 12:26706847-26706869 CCTTTCACAACACCTTCCTTGGG 0: 1
1: 0
2: 2
3: 13
4: 182
Right 1094096137 12:26706885-26706907 AATATTGTCTATGTATGATTTGG 0: 1
1: 0
2: 1
3: 25
4: 275
1094096128_1094096137 28 Left 1094096128 12:26706834-26706856 CCTGTCAGTCATTCCTTTCACAA 0: 1
1: 0
2: 1
3: 21
4: 254
Right 1094096137 12:26706885-26706907 AATATTGTCTATGTATGATTTGG 0: 1
1: 0
2: 1
3: 25
4: 275
1094096134_1094096137 3 Left 1094096134 12:26706859-26706881 CCTTCCTTGGGCTGGGCCTCAGT 0: 1
1: 0
2: 5
3: 36
4: 395
Right 1094096137 12:26706885-26706907 AATATTGTCTATGTATGATTTGG 0: 1
1: 0
2: 1
3: 25
4: 275
1094096135_1094096137 -1 Left 1094096135 12:26706863-26706885 CCTTGGGCTGGGCCTCAGTTTTA 0: 1
1: 1
2: 2
3: 30
4: 272
Right 1094096137 12:26706885-26706907 AATATTGTCTATGTATGATTTGG 0: 1
1: 0
2: 1
3: 25
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094096137 Original CRISPR AATATTGTCTATGTATGATT TGG Intronic