ID: 1094097352

View in Genome Browser
Species Human (GRCh38)
Location 12:26722090-26722112
Sequence TACTTTTTTGCCTAATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094097352_1094097355 17 Left 1094097352 12:26722090-26722112 CCTCCTAATTAGGCAAAAAAGTA 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1094097355 12:26722130-26722152 AAAAGTCTCAGCCAATATTAAGG 0: 1
1: 0
2: 1
3: 18
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094097352 Original CRISPR TACTTTTTTGCCTAATTAGG AGG (reversed) Intronic
901288092 1:8098678-8098700 TGCTTATTTTCCTAATTTGGGGG - Intergenic
901422964 1:9163209-9163231 TGCTTTGTTGCCTCCTTAGGAGG - Intergenic
907409264 1:54273369-54273391 AACTTTTTTTCCTATTTAAGAGG + Intronic
908238448 1:62169262-62169284 TATTTGTATACCTAATTAGGTGG + Intergenic
909030829 1:70537532-70537554 TAATTTTTTGCATAATTGGGGGG + Intergenic
909605455 1:77503290-77503312 TACATTTTTGCCTAGTTTAGAGG + Intronic
910115221 1:83724408-83724430 TATTCTTTTGCCTTATTTGGGGG + Intergenic
911423573 1:97677757-97677779 TAATTTTTTGCCTAAATAAAGGG + Intronic
913030196 1:114894062-114894084 TACTTTTTTTTCTAATTTTGTGG + Intronic
916583873 1:166132657-166132679 AAAATTTTTGTCTAATTAGGTGG - Intronic
920421992 1:205841154-205841176 GACTTTTTTGCCTGACCAGGAGG + Intronic
920705979 1:208250913-208250935 TTCTTTCTCCCCTAATTAGGAGG - Intergenic
1067220679 10:44342004-44342026 CACCTTTTTGCCTGGTTAGGCGG - Intergenic
1072416012 10:95247611-95247633 TACTTTTTGGCCTAATCCAGTGG + Intronic
1072558699 10:96547986-96548008 TTCTTTTTTGCCTTTTTAGGAGG - Exonic
1076086955 10:127640838-127640860 TTCTTATTTGACTAATTAGAGGG - Intergenic
1076990554 11:271274-271296 CCCTCTTTTGCCTCATTAGGTGG - Intergenic
1078902843 11:15657478-15657500 TAAATGTTTGCCTAATGAGGTGG - Intergenic
1080089885 11:28334903-28334925 TACTTTGTTGCCTAATAATTTGG - Intergenic
1081086241 11:38804632-38804654 GACTTTGTTCCCTAATTGGGTGG - Intergenic
1084515543 11:69636491-69636513 TGCTTTTTTACGTAATAAGGCGG - Intergenic
1086668828 11:89521682-89521704 AACTCTTTTGTTTAATTAGGTGG - Intergenic
1086972196 11:93094573-93094595 TTCTTTTTTGCCTTTTTTGGGGG + Intergenic
1089865635 11:121628870-121628892 TCCTTTCTTGCCTAATAAGCCGG + Intronic
1090403934 11:126466239-126466261 TCCCTTTTTCTCTAATTAGGTGG - Intronic
1092785963 12:12026994-12027016 TACTTTTTTGTCACATTAGGAGG - Intergenic
1094097352 12:26722090-26722112 TACTTTTTTGCCTAATTAGGAGG - Intronic
1095205660 12:39437228-39437250 TATTTTGATGCCTAATTATGGGG - Intronic
1095675219 12:44909109-44909131 TTCTTTTTTTCCTATTTAGATGG - Intronic
1097481795 12:60136316-60136338 TGCTTCTTTGCCTTATTTGGAGG + Intergenic
1097713106 12:62935934-62935956 TACTTTTGTTCCTAAGTTGGAGG - Intergenic
1098204266 12:68090818-68090840 TAATTTTTTGTCAAATTAGTAGG + Intergenic
1100871587 12:98915516-98915538 TAATTTTTTGCATATTTAGTAGG + Intronic
1108530406 13:51322734-51322756 TTCTTTTTTCCCTCATTAAGTGG - Intergenic
1111683628 13:91475109-91475131 TCTTTTTTTCCCTAATTATGAGG + Intronic
1113219946 13:108088419-108088441 TGCCTTTGTGCCTAATTTGGGGG - Intergenic
1113898453 13:113781936-113781958 TACCTTTTTGCATAGCTAGGGGG + Intronic
1114805906 14:25836452-25836474 ATCTTTTTTGCTTATTTAGGAGG + Intergenic
1115101143 14:29701591-29701613 TATTTTTTTGAATAATTAGTTGG + Intronic
1115694301 14:35879901-35879923 TACCATTTTGAATAATTAGGAGG - Intronic
1116483747 14:45421692-45421714 TACATTTTTGCCTAGTTCAGAGG + Intergenic
1117047849 14:51830561-51830583 TGCTTTTTGGCTTAATTAGAAGG - Intronic
1118082314 14:62374737-62374759 TCCTTTATTGCTTAATAAGGTGG - Intergenic
1118119050 14:62816599-62816621 TACTTTTTTGTCTATTTCAGTGG - Intronic
1118947464 14:70400652-70400674 TACATTTTTGCCTAGTTTAGGGG - Intronic
1119939102 14:78621630-78621652 CAATCTTTTGCCCAATTAGGAGG + Intronic
1120046265 14:79810213-79810235 TACTTTTATACCTAATAAGTGGG + Intronic
1120291056 14:82571221-82571243 TACTTTTGTGGGTAATTAAGTGG - Intergenic
1121388632 14:93554801-93554823 AACTATTTTGCCTAATTTAGAGG - Intronic
1121518119 14:94567428-94567450 TTCTTTTTTGCCTAAAGAGGGGG - Intronic
1121738080 14:96232733-96232755 TTCTTGTTGGCCTAATCAGGAGG + Intronic
1122184344 14:99978921-99978943 TACTTTTTTGCTAAAATAAGTGG - Intronic
1125306545 15:38323058-38323080 GATTTTTTTTTCTAATTAGGAGG + Intronic
1126512201 15:49490491-49490513 AACTTTGCTGCTTAATTAGGTGG + Intronic
1127841270 15:62834148-62834170 TACTTTTATGCCAAAGTAGATGG - Intronic
1130238206 15:82159154-82159176 TTTTTTTTTGTCTAATTAAGTGG + Intronic
1132278248 15:100589240-100589262 TACATTTTTGCCTAATTTAAAGG + Intronic
1134369770 16:13612215-13612237 TACTTATTTGCCTATTTACTCGG + Intergenic
1134369781 16:13612301-13612323 TACTTATTTGCCTATTTATTAGG + Intergenic
1137906580 16:52328716-52328738 TTCTTTTTTTCCTGATTAGTTGG - Intergenic
1138441752 16:57039553-57039575 TACTTTTTTTTTTAATTAGCTGG + Intronic
1139338175 16:66248041-66248063 TATTTATTTGACTAATTAGAGGG + Intergenic
1140163961 16:72529689-72529711 TACTTTTTTGTTTAATGAGATGG - Intergenic
1146846830 17:36187453-36187475 TACATTTGTGGCAAATTAGGAGG - Intronic
1153611170 18:6886781-6886803 TACTTTTCTGCCTCATTATATGG + Intronic
1153673132 18:7431600-7431622 TACTTTTCTGAGTCATTAGGAGG - Intergenic
1154414460 18:14168984-14169006 TACTTTCTTACCTTATTAGTGGG + Intergenic
1154971718 18:21416523-21416545 TAATTTTTTGTATATTTAGGAGG - Intronic
1155549432 18:26949381-26949403 TACTTTTTTTTTTAATTAGCTGG + Intronic
1158477437 18:57792829-57792851 TTGTCTTTTGCCTAATTGGGAGG - Intronic
1164816870 19:31210962-31210984 TACTTAATTGCATAAGTAGGTGG + Intergenic
1167247505 19:48382696-48382718 TGGTTTTTTGGCAAATTAGGGGG - Exonic
926500495 2:13647114-13647136 TAAATTTTTGCCTAGTTAGAGGG - Intergenic
927228857 2:20799779-20799801 TATTTTTTGGCTTCATTAGGAGG - Intronic
933631223 2:84661563-84661585 TACTTTTATTCCTAAGTAGTTGG - Intronic
936595184 2:113840665-113840687 GACTTCTTTGCCTAAATATGCGG - Intergenic
937846288 2:126582870-126582892 AACTTTTCTGCCTAATAAAGTGG - Intergenic
939155225 2:138517171-138517193 TAATTTTTTACATAAATAGGTGG + Intronic
940296851 2:152135349-152135371 TACTTTTTAACCAAATTAAGGGG - Intronic
940499120 2:154472744-154472766 TACATTTTTGCCTAGTTTAGAGG - Intergenic
940656542 2:156493961-156493983 TAATTTTTTTCCTCATTAGATGG + Intronic
943569590 2:189557557-189557579 GACTTTTTTTCCTTATAAGGAGG - Intergenic
945426589 2:209712505-209712527 AACTTTTTTGCAGAAGTAGGAGG + Intronic
1169051295 20:2580379-2580401 TACTTTGTTCCTTAATTAGTAGG + Intronic
1169156627 20:3336267-3336289 TTTTTTTTTGCCAAATTTGGGGG + Intronic
1169573210 20:6928653-6928675 TACATGTTTTCCTAATTTGGGGG - Intergenic
1169665184 20:8025803-8025825 TACTTTTTTTCTTAATGAAGAGG - Intergenic
1172986403 20:38994697-38994719 TTCTTTTTTGCCTGAGGAGGAGG - Intronic
1174881712 20:54286563-54286585 TACATTTTTGCATTATTTGGGGG - Intergenic
1175365916 20:58456106-58456128 TAATTTTTTGCATTTTTAGGAGG + Intergenic
1175809904 20:61852341-61852363 GACATTTGTGCCTAATTGGGCGG - Intronic
1176858574 21:13989261-13989283 TACTTTCTTACCTTATTAGTGGG - Intergenic
1179567598 21:42258827-42258849 AGCTTTGTTCCCTAATTAGGAGG + Intronic
1181874410 22:25928761-25928783 GTCTTTCTTGCCTAATAAGGGGG + Intronic
1182045718 22:27272524-27272546 TACTTTATTGGGTTATTAGGAGG + Intergenic
1182467544 22:30526552-30526574 TGTTTTTATGCCAAATTAGGGGG - Intronic
1183962217 22:41418309-41418331 TACTTTGATCCCTAGTTAGGAGG + Intergenic
951884697 3:27513013-27513035 TACTTTTTTGTTTGCTTAGGTGG - Intergenic
952235499 3:31475028-31475050 TGCCTTTTTTCCTAAATAGGTGG + Intergenic
953268686 3:41418322-41418344 TACTTTTTTTCTTAATTTGGCGG + Intronic
953457901 3:43057481-43057503 TTTTTTTTGGCCTATTTAGGAGG + Exonic
953813142 3:46131759-46131781 TAATTTTTGGCCTAATTAATTGG + Intergenic
955876598 3:63496689-63496711 TACTTTTTTACATAATTATTAGG + Intronic
958517861 3:95143386-95143408 CACTTTTTTTCCTAAATATGTGG - Intergenic
959327965 3:104961969-104961991 TACTTTTTTGCATTCTTAGATGG + Intergenic
960708387 3:120503704-120503726 TACTTTTTTGACTAATCAGCCGG - Intergenic
962044970 3:131747916-131747938 TGCTTTGTTGCCTATTTTGGAGG + Intronic
963198106 3:142556166-142556188 AACTTTCTTGCCTAATTTTGTGG + Intronic
963622566 3:147630160-147630182 TACTGTTTTGGTAAATTAGGTGG + Intergenic
964997096 3:162895434-162895456 TCCTTTTATGCCTAATTTGTTGG - Intergenic
966113328 3:176430533-176430555 TACTTTATTGCCTATTTATGGGG - Intergenic
971095893 4:23402308-23402330 TACTTTTTTTCCTAAATATGTGG + Intergenic
971888332 4:32482693-32482715 TACTGTTTTGCTTAATTGGAAGG - Intergenic
974203789 4:58673026-58673048 TAAATTTTTGCCTAATTTAGAGG + Intergenic
975238948 4:72034106-72034128 TCCTTTTTTCCATAATAAGGAGG - Intronic
975349939 4:73333892-73333914 TTTTTTTTTGCCTAATCAGAGGG + Intergenic
976046314 4:80952404-80952426 TGCTTTTCTGCCTAGGTAGGTGG + Intronic
976838097 4:89398942-89398964 TATTTTTTTGGTTAATTATGAGG + Intergenic
977040640 4:92013065-92013087 TACTTCTTTTCCTTATTTGGAGG - Intergenic
980967911 4:139541178-139541200 TGGTTTTTAGCCTAATTATGAGG - Intronic
984502080 4:180569134-180569156 TACTTGTTTGCTTAATTACGAGG + Intergenic
986231797 5:5871285-5871307 TATTTTTTTGCCTAAATGAGAGG - Intergenic
987681362 5:21140172-21140194 TACTTTTTTGAGTTAATAGGAGG + Intergenic
989324068 5:40169863-40169885 TTCTTTTTTCCCCAATTTGGAGG - Intergenic
989664258 5:43834766-43834788 GAATATTTTGCCTAATTTGGGGG + Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
992763489 5:79972684-79972706 TACTTTTTTACCTATCAAGGTGG + Intergenic
993229786 5:85219567-85219589 TATTTTTTTCCCTAAGTTGGTGG + Intergenic
995069336 5:107899935-107899957 TACTTTTTTTAATATTTAGGGGG - Intronic
995073630 5:107954616-107954638 AACTTCTTGGACTAATTAGGAGG - Intronic
995927370 5:117390728-117390750 TATTTTTTTGCCTAATGAATTGG + Intergenic
1000928093 5:167218186-167218208 TGTTTTTTATCCTAATTAGGAGG + Intergenic
1007282827 6:40725005-40725027 TACTTTTTTGTTTGTTTAGGTGG - Intergenic
1008709897 6:54212153-54212175 TACTTGTTTCCCTAATTATTAGG + Intronic
1009425393 6:63508184-63508206 TATTTTTGTACCTACTTAGGAGG + Intergenic
1009454315 6:63837531-63837553 TATCTCTTTGCCTAATTAGAAGG - Intronic
1011029575 6:82907294-82907316 TACCTGTCTGGCTAATTAGGAGG + Intronic
1011584119 6:88905970-88905992 TTCTTTTTTGTCTAGTGAGGAGG - Intronic
1012717166 6:102690048-102690070 GAATTATTTGCCTAACTAGGAGG + Intergenic
1014579944 6:123124719-123124741 TACTTGTATGCATAATGAGGTGG - Intergenic
1014738614 6:125123533-125123555 TACATTTTTGCCTAGTTTAGAGG + Intronic
1017222303 6:151980456-151980478 TATGTTTTTTCCTAAATAGGAGG + Intronic
1017527671 6:155256331-155256353 TACATTTTTGCCTAATTACCAGG + Intronic
1019204458 6:170348132-170348154 GACTTTTTTTCTTAACTAGGGGG + Exonic
1020578842 7:9969338-9969360 TACCTTTTTGCCTAATTTTAAGG - Intergenic
1022678106 7:32519680-32519702 TAATTTTTTTCCTAGTTAAGAGG + Intronic
1023688055 7:42756811-42756833 TAATTTCTTACCTAATTAGCTGG + Intergenic
1024751669 7:52473272-52473294 TACTCTTTTGCCTATTTGGAAGG - Intergenic
1026733117 7:72928451-72928473 TTCTTTTGTGCCTAAGTAAGTGG + Exonic
1028655665 7:93203628-93203650 TATTTGTTTGCCTAAGGAGGAGG - Intronic
1028900197 7:96090471-96090493 TATTTCTTTCCTTAATTAGGTGG + Intronic
1032338998 7:131053743-131053765 TATCTTTTTGCCTAAATTGGCGG + Intergenic
1034596791 7:152203900-152203922 TACTTTTTTGCTTACTTCTGTGG - Intronic
1037419529 8:18687534-18687556 TACTTTTTTGTATAGTTAGGGGG - Intronic
1040430841 8:47340650-47340672 GTCTTTGTTGCGTAATTAGGTGG + Intronic
1040485135 8:47864026-47864048 TCCTTTTTTGCCACATGAGGAGG - Intronic
1042009816 8:64230384-64230406 CACATTTTTTCCTTATTAGGGGG - Intergenic
1043356890 8:79424318-79424340 CATTTTTTTTCCAAATTAGGTGG + Intergenic
1043772027 8:84215696-84215718 TACTTTATTTTCTAATTCGGAGG + Intronic
1044305139 8:90631314-90631336 TTCTTTTTTGCCTCTTTAAGAGG + Intronic
1045108682 8:98919023-98919045 TACTTCTTTGCCTTATTACAAGG - Intronic
1047852879 8:128877945-128877967 TACTTTTTTGGCTGTTTATGTGG + Intergenic
1048642364 8:136378218-136378240 CACTTTTTTTCCTAATAAGAAGG - Intergenic
1049911878 9:276732-276754 GACTTGTTTGCCTGAATAGGTGG - Intronic
1051283403 9:15467297-15467319 TATTTTTGTGCCTAATAAAGGGG + Intronic
1053341868 9:37343572-37343594 TACTTTATTGCCTAAATTTGAGG - Intronic
1056483822 9:87034307-87034329 TACTTCCTTTCCTTATTAGGAGG + Intergenic
1058641097 9:107086199-107086221 TAATTTTTTCCCTATTTTGGTGG - Intergenic
1061650801 9:132048421-132048443 TAATTTTTTCCCTAATAAGGAGG - Intronic
1187947984 X:24445063-24445085 ACCCTTTTTGCCAAATTAGGTGG + Intergenic
1188142324 X:26566812-26566834 TACTTTTTTTTCCAATTAGCTGG - Intergenic
1189072512 X:37878941-37878963 TATTTTTTTTCCTAAGCAGGAGG - Intronic
1190447556 X:50543979-50544001 TACTTTTTAGCCTACTGATGTGG - Intergenic
1194584135 X:95712862-95712884 TACTGTTTTGCCTAATTAACTGG + Intergenic
1194601004 X:95921794-95921816 TACTTTTTTTCAGAATTATGTGG + Intergenic
1197007592 X:121521211-121521233 TCCTTTTTTCCCTAATTGAGTGG + Intergenic
1199149426 X:144412671-144412693 TATTTTTTCTCCTAATTTGGGGG + Intergenic
1199216780 X:145268345-145268367 TTATTTTATGCCTAATTAGGTGG - Intergenic
1199927946 X:152489059-152489081 TGCTTTTTTTCTTTATTAGGAGG + Intergenic