ID: 1094098063

View in Genome Browser
Species Human (GRCh38)
Location 12:26730328-26730350
Sequence GTTTAGAAGCAGGATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094098063_1094098067 4 Left 1094098063 12:26730328-26730350 CCCTCCTCATCCTGCTTCTAAAC 0: 1
1: 0
2: 3
3: 38
4: 448
Right 1094098067 12:26730355-26730377 TAGTATTCCTTGATCTGTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094098063 Original CRISPR GTTTAGAAGCAGGATGAGGA GGG (reversed) Intronic
901123460 1:6913112-6913134 GTTTACAAACATGAAGAGGAAGG - Intronic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
902093538 1:13923669-13923691 GATGAGGAGGAGGATGAGGAGGG + Intergenic
902546025 1:17190824-17190846 GTGTAGCAGCAGCGTGAGGAAGG - Intergenic
905869366 1:41394441-41394463 GTTTAGGAGCTGGCTGTGGAGGG + Intergenic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906530039 1:46518478-46518500 GATTTTAAGCAGGATGGGGAGGG + Intergenic
906938746 1:50237250-50237272 GGTTGGCAGCAGGAAGAGGATGG - Intergenic
907342070 1:53742299-53742321 AATTAGGAGAAGGATGAGGATGG - Intergenic
908246900 1:62234526-62234548 GGTTAGAAGCAAGATGAAGTTGG - Intergenic
909751520 1:79166670-79166692 CTTTAGTAGCAGCATGAGAATGG + Intergenic
909910843 1:81256055-81256077 CTTTATTAGCAGGATGAGAACGG - Intergenic
910012495 1:82482681-82482703 GGTTAGAAGTTTGATGAGGAAGG - Intergenic
910709538 1:90165492-90165514 TTTCAGAAGCAGGTTGGGGATGG + Intergenic
910719091 1:90265873-90265895 GTGTAGGAGGAGGATGAAGATGG + Intergenic
910852021 1:91657744-91657766 ACTTAGGGGCAGGATGAGGAAGG - Intergenic
911541023 1:99158641-99158663 GTTTTGAATCAGGATGATGCTGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
913130307 1:115833129-115833151 GTCTAGAAGCAGCGTGAGAATGG + Intergenic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
915555928 1:156660826-156660848 GTTTAGAAATAGGGTGGGGAAGG - Intergenic
915620215 1:157077664-157077686 GGATAGAAGAAGGAGGAGGAAGG - Intergenic
915804187 1:158827813-158827835 CTTTATCAGCAGGATGAAGATGG - Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
915929317 1:160049267-160049289 GTTCAGAAGCAGACTGCGGAAGG - Intronic
916106760 1:161438709-161438731 GTTTGCAAGCATGAGGAGGAAGG + Intergenic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
918702370 1:187621037-187621059 GTTTAGAAGTGGAATAAGGAAGG - Intergenic
918988210 1:191660962-191660984 GTTTAGAAGCAAGATGAAGTTGG - Intergenic
920277328 1:204816228-204816250 GTTGAGGAGGAGGATAAGGAGGG + Intergenic
920342521 1:205284454-205284476 GTTTGGAAGGAGGTTTAGGAAGG + Intergenic
920559439 1:206928817-206928839 TTTTAGAATAAGGAGGAGGAGGG - Exonic
920806925 1:209243448-209243470 GCTTGCAAGAAGGATGAGGAAGG + Intergenic
921117913 1:212112079-212112101 GTCCAGGAGCAAGATGAGGATGG - Intergenic
921498025 1:215864680-215864702 GTATGGAAGCTGGAGGAGGAAGG + Intronic
922960660 1:229643128-229643150 GTTGAGGAGGAGGAAGAGGAGGG + Intronic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923464004 1:234232168-234232190 GATTAGAAAGAGGATGAGTAAGG - Intronic
923852731 1:237815080-237815102 GTTTAGGAGACGGATGAGGGAGG + Intronic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
924871806 1:248055429-248055451 TTTTGGAAGCAGGATGATGCTGG + Intronic
1062911010 10:1212537-1212559 GTTTAGCAGGAGGGGGAGGAGGG - Intronic
1063095394 10:2904254-2904276 GTTTGGAAGCGGGATGGGAAGGG - Intergenic
1063511664 10:6650372-6650394 GTTCAGAAGGATGATGAGAATGG - Intergenic
1063755126 10:8998654-8998676 GTTTTTAAGTAGGAGGAGGATGG + Intergenic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067679189 10:48416917-48416939 GGTAAGAAGCAGGCTGAGAAAGG - Intronic
1068497606 10:57805277-57805299 GATGTGAAGCAGGATGAAGAAGG - Intergenic
1068588471 10:58827885-58827907 GTTGAGAAGGAGGAGGAGAAGGG - Intronic
1068834200 10:61534304-61534326 GGATAAAAGCAGGAAGAGGAAGG - Intergenic
1069291552 10:66786371-66786393 GGGTAGAAGCAAGAGGAGGAAGG - Intronic
1069350146 10:67515903-67515925 GTTTAGATGCAGTCTAAGGAAGG - Intronic
1069626505 10:69871154-69871176 GTTTAGAAGCAAGAGGAAGAGGG + Intronic
1069926485 10:71854244-71854266 GCTTTGAAACAGGAGGAGGAGGG + Intergenic
1070669082 10:78365472-78365494 CTTTAGAACCAGGAAAAGGAGGG + Intergenic
1071358746 10:84823715-84823737 GTTTAGTAGCTAGATGTGGAGGG + Intergenic
1071515470 10:86294081-86294103 GTGTAGAAGCTGGAGGAGTATGG + Intronic
1071848364 10:89542875-89542897 GTTGAGAAGCATGATAATGAAGG - Intronic
1071959758 10:90798757-90798779 GGTTAGAAGCAGGATGGAGTTGG - Intronic
1071963213 10:90826581-90826603 GTTTAAAAGCAAGAGGATGAAGG + Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1074227326 10:111497546-111497568 GTTTAGAAGGAGGAGAGGGATGG + Intergenic
1074746180 10:116534837-116534859 GGGTAGAAGGAGGGTGAGGATGG - Intergenic
1075295076 10:121267948-121267970 TGCTAGAAGCAGGATGATGAAGG + Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1076042482 10:127262550-127262572 GTTTAGAAGCTGGATCAGGTGGG + Intronic
1078470219 11:11580465-11580487 GTTCAGTAGCAGGATGCGGAAGG - Intronic
1078908770 11:15711737-15711759 ATTTAGAGGCAGGAGGAGCAAGG - Intergenic
1078960719 11:16265403-16265425 GTTTCCAAGCAGGATAAGGCAGG - Intronic
1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080121739 11:28685736-28685758 GCTGAGGAGGAGGATGAGGAGGG + Intergenic
1080290387 11:30664528-30664550 GTTTATTAGCAGCATGAGAATGG - Intergenic
1080643361 11:34171155-34171177 GTGTAGAGTGAGGATGAGGATGG + Intronic
1081057853 11:38432276-38432298 GATGAGGAGGAGGATGAGGAGGG + Intergenic
1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG + Intronic
1081385945 11:42473358-42473380 GTGTAGAATTAGGATAAGGAGGG + Intergenic
1081830536 11:46108615-46108637 GTTTAAAAGTAGGATGAGAACGG + Intronic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085620637 11:78035464-78035486 GGTTAGTAACAGGGTGAGGAAGG - Intronic
1086700079 11:89891809-89891831 GATTATATGCAAGATGAGGATGG - Intergenic
1086706091 11:89952707-89952729 GATTATATGCAAGATGAGGATGG + Intergenic
1087601831 11:100327181-100327203 GCTTTTAAGCAGGATGAGGCTGG - Intronic
1088582790 11:111331601-111331623 GTTTACAAGCTGGAGGAAGAGGG + Intergenic
1089279548 11:117363685-117363707 GTTTAGAGGCAGGGTCTGGAAGG - Intronic
1089654788 11:119939375-119939397 GGTTAGGAGTAGGAGGAGGAAGG + Intergenic
1091027089 11:132151138-132151160 GTTTGGTAGCAGGATTAAGAGGG - Intronic
1091077048 11:132628988-132629010 CTTTATTAGCAGGATGAGAATGG + Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092337655 12:7647911-7647933 TTTTAGTAGGAGGATGAGAAGGG - Intergenic
1092409993 12:8245329-8245351 GATTGGAAGCAGACTGAGGAAGG + Intergenic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094559376 12:31536048-31536070 GATTAGAAGCAGGAGGAAGAGGG - Intronic
1095400322 12:41807228-41807250 TTTTGGAATCAGGATGATGATGG - Intergenic
1096365030 12:51021782-51021804 GTTAGGAAGCAAGAAGAGGAGGG + Intronic
1096613836 12:52820411-52820433 GTTTGGTAGCAGGGTGGGGAGGG + Intergenic
1096879288 12:54654378-54654400 GTTTAGAAGCCAGACGAGAATGG - Intergenic
1097644966 12:62225455-62225477 GTTTAGAAGCACGCTTAGAAAGG - Intronic
1098038210 12:66328046-66328068 GTTGAGAAGCAGGAATAGCAAGG + Intronic
1099120944 12:78688614-78688636 GGTTAGAAGCAAGATGAAGTCGG - Intergenic
1099217479 12:79870784-79870806 GTATATAAGAAGTATGAGGAAGG - Intronic
1099286797 12:80722925-80722947 GTTTAGAAGTAGGGAGAGAAGGG - Intergenic
1099983127 12:89629827-89629849 ACTTAGAAGCAGGGTGGGGAGGG + Intronic
1100223623 12:92533831-92533853 GGTTAGAAGCAAGATGGGGACGG + Intergenic
1101230489 12:102736404-102736426 GTTCAGAAGAAGTATGAAGAGGG - Intergenic
1101428389 12:104606325-104606347 GATGAGGAGGAGGATGAGGAGGG + Intronic
1102397620 12:112600803-112600825 CTTTATTAGCAGCATGAGGACGG - Intronic
1103207819 12:119144024-119144046 GTTTAGAAGCAGGATGGCGAGGG - Intronic
1103643853 12:122375266-122375288 GTTTAGATTTAGGAAGAGGAAGG - Intronic
1103902481 12:124310566-124310588 GTTGAGGAGCAGGATGGGGTGGG + Intronic
1104355565 12:128082256-128082278 GGTTAGAAGCAAGATGGGGTCGG - Intergenic
1104378215 12:128283931-128283953 GTTCAGAAGCAGGAGGAAGAGGG + Intronic
1104539784 12:129653185-129653207 TTTGATAACCAGGATGAGGAGGG + Intronic
1106036409 13:26049332-26049354 GTTTAAAAGTAGCATGAAGAAGG + Intronic
1106277766 13:28229992-28230014 GATTAGGAGGAGGATGAGAAAGG - Intronic
1106460015 13:29960386-29960408 GTTTAGAAGCAAGATGGTGCTGG + Intergenic
1106833921 13:33613797-33613819 ATTTAGCAGCAGGGTGAGGAAGG + Intergenic
1106895755 13:34300518-34300540 GTTTATAAGGGGGATTAGGAAGG + Intergenic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107829572 13:44362422-44362444 GTTCAGGAGGAGGAAGAGGAAGG - Intergenic
1109718511 13:66247200-66247222 CTTTATTAGCAGGATGAGAATGG + Intergenic
1110172455 13:72518203-72518225 AGTTAGTAGCAGGATCAGGATGG - Intergenic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110428450 13:75395954-75395976 ATTTATAAGCAGGATCAGGTTGG + Intronic
1110456711 13:75697261-75697283 GTTTATTAGCAGCATGAGAATGG - Intronic
1110881156 13:80574337-80574359 GTTTATTAGCAGCATGAGAATGG - Intergenic
1112057188 13:95700574-95700596 GTTTAGAAGGAGAAAGAGCAAGG + Intronic
1112513040 13:100026902-100026924 GCTTAGGAGGAGGAAGAGGAGGG - Intergenic
1113628124 13:111861541-111861563 GGTTAAAAGAAGGATGAGGGAGG + Intergenic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116437439 14:44911187-44911209 GTTTGGAAGCAAGACCAGGATGG + Intergenic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119655202 14:76412537-76412559 GTTTGCAAGGAGGAGGAGGATGG - Intronic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1120281305 14:82441889-82441911 TTTTAGGAGCAGAATGAGTAAGG - Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1121087105 14:91155018-91155040 GACTAGAAGCAGGCTGGGGAGGG - Intronic
1121489078 14:94345018-94345040 TGTTAGAAGCAGGAGCAGGAAGG + Intergenic
1121714440 14:96063071-96063093 GTTTGGAAGGTGGATGAGGCAGG + Intronic
1123727259 15:23115455-23115477 GATTAGAAACAGAATAAGGAAGG + Intergenic
1125746378 15:42000183-42000205 GTTTGGAAGCAGGCAGAGGTTGG + Exonic
1126297950 15:47162291-47162313 AGTTAGAAGGAGGATGAGCATGG + Intergenic
1128531776 15:68456670-68456692 GATTAGTAGCAAGATGAGGAAGG + Intergenic
1128577239 15:68784396-68784418 GATGAGGAGGAGGATGAGGATGG - Exonic
1130636021 15:85620808-85620830 GTGTCTAAGCAGGATGAGGGCGG + Intronic
1131023084 15:89116274-89116296 GTTTACAAGCACAGTGAGGACGG - Intronic
1132178707 15:99735037-99735059 GTTTATCAGCAGGATGAAAACGG + Intergenic
1132192039 15:99873256-99873278 TTTTAAAAGCAGGTTCAGGAAGG + Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136170349 16:28485726-28485748 GATTAGAAGTAGGATGAGGGTGG - Intronic
1138815732 16:60200882-60200904 CTTTAGAGGCAGGATGAGCCAGG - Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1140165581 16:72547186-72547208 TTTTAGAACCAGGATGATGCTGG - Intergenic
1140973681 16:80038665-80038687 ATTTGGAAGCAGGTTGAGGGAGG + Intergenic
1141003963 16:80334985-80335007 CTTTAGGAGCAGGATGAAGATGG - Intergenic
1141839127 16:86563243-86563265 GTTTAGAAGCCGGATTACAATGG + Intergenic
1141855054 16:86675110-86675132 GTTAAGAATCAAGATGAGGCTGG - Intergenic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143391314 17:6560892-6560914 GATGAGAAGGAGGAAGAGGAGGG - Intergenic
1143729114 17:8870363-8870385 GATTAGAAAATGGATGAGGATGG - Intergenic
1143901925 17:10181024-10181046 GTCTAGAATAAGGATGAGGGTGG + Intronic
1144041397 17:11414140-11414162 GTACAGAAGAAAGATGAGGAAGG - Intronic
1144189641 17:12832680-12832702 GGTTAGAAGCAAGATGAAGTTGG + Intronic
1145399065 17:22516752-22516774 GTTAGGAAGCAGGAGGAGGTAGG + Intergenic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1146418596 17:32661265-32661287 GTTTAGAAGGATGAAGAGAAGGG - Intronic
1146453959 17:32995273-32995295 GGTGTGAAGCAGGATGGGGAAGG + Intronic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1147177071 17:38662569-38662591 GATCAGATACAGGATGAGGAAGG - Intergenic
1147268987 17:39253631-39253653 ATTTGGAAGTAGGGTGAGGAGGG + Intergenic
1147870384 17:43582965-43582987 GTTTAGAAACAGAATGGGAATGG - Intergenic
1148384465 17:47224017-47224039 GTTTAAAAGCAGCAAGAGCAAGG - Intergenic
1148569571 17:48657377-48657399 GTATAGCATCAGGCTGAGGAAGG + Intergenic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1150811734 17:68362229-68362251 GGTGAGAGGCAAGATGAGGAGGG - Intronic
1152150669 17:78598360-78598382 GGTTAGAAGCAAGATGGGGTCGG + Intergenic
1153119415 18:1703298-1703320 TTTTAGAATCAGGATGATGCTGG - Intergenic
1155740447 18:29282353-29282375 GTTCAGAAGAAGCATGTGGATGG - Intergenic
1156221450 18:35056530-35056552 GTATGGAGGCAGGATGGGGAGGG + Intronic
1156860716 18:41833238-41833260 CTTTAGAAGCTGTTTGAGGAGGG - Intergenic
1157175364 18:45446927-45446949 GATGAGAAGCAGGGTGGGGAGGG - Intronic
1157724130 18:49950412-49950434 TTTTAGAAGCAGATTGATGATGG - Intronic
1158363465 18:56704021-56704043 GATTATAAACAGGATGATGAAGG - Intronic
1159112571 18:64076387-64076409 GGTTAGAAGCAAGATGAAGTTGG - Intergenic
1161153733 19:2721845-2721867 GTTTAGAAGCGGGCAGAGGCGGG + Intronic
1161266434 19:3366727-3366749 GTTTTGAAGCAGGAGGAGGCGGG + Intronic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1164768883 19:30792762-30792784 GTTCAGAAGCAGTAAGAGCATGG - Intergenic
1164900781 19:31920260-31920282 GTTTAGTAGCAGCATGAGAATGG + Intergenic
1165120029 19:33552941-33552963 GTTCAGAAGCAGGAGGACAAAGG - Intergenic
1166010131 19:39935471-39935493 GTCTGGAAGCAGGATGTGGGTGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926415555 2:12646234-12646256 CTTTATAAGCAGCATGAGAATGG - Intergenic
927700103 2:25262627-25262649 GTTTAGAAGCAGGACCAGGTAGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928843613 2:35641657-35641679 GGTGAGAAACAGGATGAGCATGG + Intergenic
929069872 2:38019569-38019591 GGTTATTACCAGGATGAGGAGGG - Intronic
929448896 2:42023355-42023377 CTTTACAAGCAGCATGAGAATGG + Intergenic
929842041 2:45477176-45477198 TTTTAGAGGGATGATGAGGAGGG - Intronic
929957114 2:46466424-46466446 GATTAGAGGCTGGCTGAGGACGG - Intronic
930216660 2:48704375-48704397 GTTTAGTATCAGGATGATGCTGG + Intronic
930510364 2:52336805-52336827 GGTTAGAAGCAAGATGGGGTTGG - Intergenic
931290169 2:60865703-60865725 CTTTAGAAGCAGTATGAGAACGG + Intergenic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
932018037 2:68053109-68053131 TTTTAGAAGGAGTATGTGGAAGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
934568674 2:95354545-95354567 GTCTAGAACCAGGATGTGCAGGG + Intronic
934688220 2:96336841-96336863 GTTTAGAAGCTGGATAGAGAAGG + Intronic
936115507 2:109699646-109699668 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
936535505 2:113307995-113308017 GTTCAGAAACAGGCAGAGGAGGG - Intergenic
936769209 2:115891580-115891602 TTTTAGTAGCAGGATGATGCTGG + Intergenic
936937235 2:117850179-117850201 GGATAGAAGCAGGATCAGGTGGG - Intergenic
937151199 2:119687030-119687052 GTTTAGAACCAAGAGGAGCAAGG - Intergenic
937335217 2:121058409-121058431 GTCTGGCAGCAGGATGAGGGTGG + Intergenic
937856521 2:126675604-126675626 GTTTTGAAGCAGGGTAGGGATGG - Intronic
937993586 2:127677298-127677320 GTTTAGCAGGAGGTGGAGGATGG + Intronic
938786709 2:134636492-134636514 GGTTAGAAGCAAGATGAAGTTGG - Intronic
939020076 2:136948038-136948060 GTTTACAAGGAAGATGAAGATGG - Intronic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
939954627 2:148517282-148517304 GTTAAGAAGCAGTAAGAGGCTGG - Intronic
940857972 2:158744544-158744566 GTTTAGAAGCATCCTGAGGATGG - Intergenic
941673750 2:168322150-168322172 GGTTAGAAGCAAGATGGGGTCGG + Intergenic
942043739 2:172087249-172087271 GGTAAGAAGGAGGAGGAGGAGGG - Intronic
942154764 2:173116651-173116673 GGTTAGAAGCAGGATGCAGATGG - Intronic
943164715 2:184306340-184306362 GGGTAGGAGGAGGATGAGGATGG - Intergenic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947535315 2:230936585-230936607 GTTTATTAGCAGCATGAGAATGG + Intronic
947542808 2:230990444-230990466 CTCTGGAAGCAGGATGAGGACGG + Intergenic
948302450 2:236917905-236917927 GGTTAGAAGCAAGATGGGGTCGG + Intergenic
1168864973 20:1078528-1078550 GCTGAAAATCAGGATGAGGAGGG + Intergenic
1169635166 20:7682733-7682755 GGTTAGAAGCAAGAGGAAGATGG - Intergenic
1170725172 20:18919818-18919840 GGTTAGAAGCAAGATGAAGTTGG - Intergenic
1170875394 20:20245250-20245272 GTTTATCAGCAGCATGAGAATGG - Intronic
1171095200 20:22326093-22326115 GTTTATAAGCAAGGTGGGGATGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172602586 20:36194265-36194287 GGTGACAAGCGGGATGAGGATGG + Exonic
1172939811 20:38646369-38646391 GCTTAGAAGCGGGTTGGGGAGGG + Intronic
1173069424 20:39747384-39747406 GTTTACAAGCAGTATGAGGCTGG - Intergenic
1173924435 20:46770342-46770364 CTTTATTAGCAGCATGAGGATGG - Intergenic
1174352252 20:49976792-49976814 GGTTAAATCCAGGATGAGGATGG + Intergenic
1176677377 21:9791824-9791846 GTTTATTAGCAGCATGAGAATGG + Intergenic
1177403068 21:20631191-20631213 GGTTAGAAGCAAGATGGGGTTGG + Intergenic
1178280733 21:31280503-31280525 GTTTATCAGCAGGATGAAAATGG + Intronic
1178331449 21:31697630-31697652 GTCTATAAGCAGAATGAGCACGG - Intronic
1178870193 21:36367195-36367217 GTTTTGAAACAGAATGAGTAAGG + Intronic
1179193754 21:39145361-39145383 GTCTAGTAGCAGGCTAAGGAGGG + Intergenic
1179382715 21:40914397-40914419 CTTTAGTAGCAGCATGAGAATGG - Intergenic
1179529047 21:42005649-42005671 GTCTAGAAGCTGTATTAGGATGG - Intronic
1180652113 22:17386474-17386496 GTTTGGAAACAGGCTGAGAAAGG - Intronic
1180709725 22:17831612-17831634 GTTTAGAAACTGGAAGTGGAAGG - Intronic
1181574430 22:23784648-23784670 GTTTAAAAAAAGGATGCGGACGG + Intergenic
1182454557 22:30441694-30441716 GGTTAGAAGCAAGATGAGAACGG + Intergenic
1182864207 22:33588392-33588414 CTCTAGAAGAAAGATGAGGAAGG + Intronic
1183120415 22:35726050-35726072 GGTTAGAAGCAAGATGAAGCCGG + Intronic
1183135924 22:35887610-35887632 GTTTGGAAGCAGTATTGGGAAGG - Intronic
1183790814 22:40067687-40067709 GTTCAAGAGCAGGAGGAGGAGGG + Intronic
1184240036 22:43207118-43207140 GGCTGGAAGCAGGAAGAGGAGGG + Intronic
949288830 3:2439008-2439030 GTTGAGAAGCAGGGTGACCATGG - Intronic
949505066 3:4719811-4719833 GTTTGAAACCAGGAAGAGGAGGG + Intronic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950408159 3:12817285-12817307 GTTTATGAGCAGGCTGTGGATGG + Exonic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
953600771 3:44361954-44361976 TTTTAGAAGCAGCATAAGGTTGG - Intronic
954060658 3:48063980-48064002 GGTTAGAAGCAGGATGGAGTTGG - Intronic
955238852 3:57163038-57163060 AGTTAGGAGCAGGATGAGAAGGG + Intronic
955458983 3:59158727-59158749 GACTAGAAGAAGGATCAGGAAGG - Intergenic
955563451 3:60218906-60218928 GTTTAGAAGCAGGATAAGAAAGG - Intronic
957039136 3:75322859-75322881 GGCTAGAAGCAGGAAGAGGCTGG + Intergenic
957055231 3:75437453-75437475 GATTGGAAGCAGATTGAGGAAGG + Intergenic
957983725 3:87545829-87545851 GGTTAGAAGCAAGATGAAGTTGG - Intergenic
959034657 3:101346937-101346959 GTTTAAAAAAAGGAGGAGGAGGG + Intronic
959062915 3:101632435-101632457 GTTTAGAAAGGGGATGGGGAGGG - Intergenic
959547988 3:107620538-107620560 CTTTAGCAGCATGAAGAGGATGG + Intronic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
959857100 3:111172371-111172393 GTTTAGATCTTGGATGAGGAAGG + Intronic
960070697 3:113426649-113426671 GTTTATTAGCAGCATGAGAACGG + Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961030854 3:123602408-123602430 GTTTAAAAGCAGCATAGGGATGG + Intergenic
961087296 3:124079079-124079101 GGCTAGAAGCAGGAAGAGGCTGG + Intergenic
961389596 3:126544444-126544466 GTTTAGAGACAGGCTGAGGAGGG + Intronic
961894034 3:130152555-130152577 CTTTTGAACCAGGATGAGCAAGG + Intergenic
962195441 3:133358799-133358821 GTTTAGAAGAGGGATGGGAAGGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
963037488 3:141045130-141045152 GTTTAGACACAGGATGAGATAGG - Intergenic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
963560087 3:146854123-146854145 GTTTGGAAGATGGAGGAGGAGGG + Intergenic
964057357 3:152477655-152477677 GTACAGAAGCTGGATGAGAAAGG - Intergenic
964340016 3:155698555-155698577 GTTTAAAAGTAGGGTGAGTAGGG + Intronic
964969928 3:162547461-162547483 GGTTAGAAGCAAGATGGGGTTGG + Intergenic
965885247 3:173437490-173437512 GTTCAAAAGCAGGAGGAGCAAGG - Intronic
966550677 3:181200880-181200902 CTTTACAAGCAGCATGATGATGG + Intergenic
967020056 3:185514926-185514948 GATTGGGAGAAGGATGAGGAAGG - Intronic
969755956 4:9150899-9150921 GATTGGAAGCAGATTGAGGAAGG - Intergenic
970210101 4:13700851-13700873 GTTTTGAATCAGGATGATGATGG + Intergenic
970214202 4:13741888-13741910 TTTTAGAATCAGGATGATGCTGG + Intergenic
971322620 4:25617530-25617552 GTTTAGAAGCAAGATGGAAATGG - Intergenic
971357985 4:25912259-25912281 GGGAAGAAGTAGGATGAGGATGG + Intronic
971974372 4:33664631-33664653 TTTTAGAATCAGGATGATGTTGG + Intergenic
972678089 4:41279598-41279620 CTTTATTAGCAGGATGAGAACGG - Intergenic
973115366 4:46451128-46451150 GTTTAGAAGCAGAATGTAGGTGG + Intronic
974730477 4:65858223-65858245 GTTTAGTATCAGGATGATGCTGG + Intergenic
975549330 4:75594957-75594979 GTTTAGCAGAAGAATGATGAGGG + Intronic
975668699 4:76758401-76758423 GTTTAGAAGCAGAATGGTCATGG + Intronic
975954677 4:79823502-79823524 GTTTAGAAGCCAGAAGAAGATGG - Intergenic
976127862 4:81853346-81853368 GTTTATCAGCAGCATGAAGATGG - Intronic
977496503 4:97781587-97781609 CTTTAGTATCAGGATGATGATGG - Intronic
977575748 4:98672580-98672602 TTTTATCAGCAGGATGAGCACGG - Intergenic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
979513208 4:121577286-121577308 GATTAGCAGCAGGAGGAGAAAGG + Intergenic
979513921 4:121585353-121585375 GTCTAGAAGCAGGAGGGAGAAGG - Intergenic
979560909 4:122100992-122101014 GTTTACAAGCAAGATGAACAAGG + Intergenic
979719142 4:123878845-123878867 GCTTAGAAGCAAGATGGGGTTGG - Intergenic
980980605 4:139651565-139651587 GGTTAGCAGTAGGATGGGGAAGG + Intergenic
981421913 4:144560628-144560650 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
982635528 4:157891738-157891760 GTTCAGTTGCAGGATGAGGGTGG - Intergenic
982884654 4:160763411-160763433 GTTTATTAGCAGGAAGGGGAGGG + Intergenic
983211403 4:164962135-164962157 GATAAGAAGGAGGATAAGGAAGG + Intronic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
985398159 4:189566957-189566979 GTTTATTAGCAGCATGAGAATGG - Intergenic
986181215 5:5394672-5394694 GTTTAGCAGCTGGATCAGGGTGG - Intergenic
986314989 5:6581167-6581189 GTTTAGGAGCAGGGAGGGGAGGG + Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987377665 5:17251545-17251567 GTCTAGCAGCAGGAGGAGGTAGG + Intronic
987474400 5:18373091-18373113 CTTTGGAAGCAGAATCAGGAGGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG + Intergenic
993836011 5:92821361-92821383 GTTTGGAAGCAGCAATAGGAAGG + Intergenic
994797683 5:104325936-104325958 TTTTAGAAGCTGGAAAAGGATGG - Intergenic
995281151 5:110337117-110337139 GTTTAGAAGATGGAAGAGGTAGG + Intronic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996213806 5:120843362-120843384 GTTTTGAAAGAGGATGAGGCTGG - Intergenic
996555619 5:124776307-124776329 GTGCAGAAGCAAGATGATGATGG + Intergenic
996696169 5:126397853-126397875 GTTTGGTAGCAAGATGATGATGG + Intronic
997625113 5:135326407-135326429 GTTTAGAGGCAGGAAGAGGTAGG - Intronic
998021300 5:138773673-138773695 GTTTAGAAGCAGGATTAGGGAGG + Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998439628 5:142146751-142146773 GCTTAGAACCAAGATGAAGAAGG - Intronic
998551422 5:143081263-143081285 ATTTAGAAGTGGGAAGAGGAGGG + Intronic
998566781 5:143222956-143222978 GTTTGCATGCAGGATGAAGAGGG + Exonic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000725437 5:164763732-164763754 GTTTAGAAGCAAGATGGAGTTGG + Intergenic
1001852500 5:174981700-174981722 CTTTAGCAGCAGGAGGAAGAGGG - Intergenic
1002123805 5:177026305-177026327 CTTCAGAAACAAGATGAGGAAGG - Intronic
1002393655 5:178936611-178936633 GTTTGGAGGCTGGAGGAGGATGG - Intergenic
1002893471 6:1357748-1357770 GTTGAAAAGGAGGAAGAGGAGGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003837656 6:10088963-10088985 GTTTAGAAGCTGAAGGAGAAAGG - Intronic
1005370945 6:25132164-25132186 GGTTAGAAGCAAGAGCAGGATGG + Intergenic
1005738007 6:28766913-28766935 GCTTAATAGTAGGATGAGGAGGG + Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006727317 6:36209106-36209128 GTTTAGAGACAGCATGATGAAGG - Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008060964 6:46996564-46996586 GTTTATCAGCAGCATGAGAATGG + Intergenic
1008521690 6:52367726-52367748 GTGTAGAGGAAAGATGAGGATGG + Intronic
1008652067 6:53573841-53573863 ATTTAAAAGAAGGATGAGGCAGG + Intronic
1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG + Intergenic
1009021313 6:57950663-57950685 GTTTAGCAGCTGGATCAGGGTGG - Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1010201501 6:73286131-73286153 GTTTGGCAGCAGGATAAGGCTGG - Intronic
1010561819 6:77360285-77360307 GTTTAGAAGGAGGTTGATCAGGG + Intergenic
1010912979 6:81582193-81582215 CTTTGGTAGCAGGATGATGATGG - Intronic
1012143204 6:95649566-95649588 GTTGAGCAGCAGGATGAGTTTGG - Intergenic
1012746555 6:103097903-103097925 GTTTAAGAGAAGGGTGAGGAAGG - Intergenic
1012839706 6:104314441-104314463 GTTCTGAAGCAGGATGAAGGGGG - Intergenic
1014139641 6:117926410-117926432 TTTTCGTAGCAGCATGAGGATGG + Intronic
1016168555 6:140978676-140978698 CTTTAGTAGCAGCATGAGAATGG - Intergenic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018511028 6:164525161-164525183 GTTTATTAGCAGTATGAGAATGG + Intergenic
1018641401 6:165907579-165907601 GCTGAGGAGCAGGATGATGAGGG - Intronic
1019069897 6:169336218-169336240 GTTTAGAAGCAAGATGGAGTAGG - Intergenic
1019171748 6:170136790-170136812 GTTGAGTAGCAGGTGGAGGACGG - Intergenic
1019721709 7:2576240-2576262 GGTTAGATGCAGGCTGAGGCTGG + Intronic
1020000486 7:4752918-4752940 GTTTACAAGTAAGATGAGAAGGG - Intronic
1020252951 7:6483992-6484014 CTTCAGCAGCAGGATGACGATGG + Exonic
1020612066 7:10410847-10410869 GTTTTGAAGCAAGATGGGTAGGG + Intergenic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG + Intergenic
1021737948 7:23657457-23657479 GTTTAGAAGGAGAAGGAGTAGGG - Intergenic
1022779031 7:33559466-33559488 GCATAGAAGCAGGATGAGCCAGG + Intronic
1023078473 7:36505994-36506016 TTTTATAAGCAGGCTGGGGAAGG - Intergenic
1023555828 7:41421914-41421936 GATTAGAAGCATCATGAGGTAGG - Intergenic
1023639909 7:42247095-42247117 GTTTAGATGCAGGAGGAAGAAGG + Intergenic
1024093061 7:45963128-45963150 CTTTGGAATCAGGATCAGGATGG + Intergenic
1026568248 7:71507783-71507805 GTTTGCATGCAGGATGAAGAAGG + Intronic
1028231807 7:88314633-88314655 CTTTAGAAGCAGGGGGAGGTAGG + Intergenic
1028947871 7:96601362-96601384 GTTTAGAAGGAGGATGGGGTGGG + Intronic
1029575606 7:101401489-101401511 GACTAGAAGAAGGAAGAGGAGGG + Intronic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1030545655 7:110892079-110892101 GTTGAGAAACAGGAGGTGGAAGG - Intronic
1030551624 7:110968427-110968449 GTTTGGAAGTATGAGGAGGATGG + Intronic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1030685563 7:112483647-112483669 GTCTTGAGGCAGGATTAGGAAGG + Intronic
1031793446 7:126139797-126139819 CTTTATTAGCAGGATGAGAATGG - Intergenic
1033445837 7:141421203-141421225 ATTTAGAAGCATGATGGAGAAGG - Intronic
1033755535 7:144396161-144396183 GTTGAGATGTAGGAAGAGGAGGG - Intergenic
1034552796 7:151832198-151832220 GATTAGAGGGAGGAAGAGGAGGG + Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035777153 8:2196793-2196815 GGATAGAAGCAGGCAGAGGAAGG - Intergenic
1036553597 8:9837696-9837718 GTTTTGAAGATGGAGGAGGAAGG - Intergenic
1036711261 8:11080355-11080377 CTTTAGAAACAGGGTGGGGAAGG + Intronic
1036850359 8:12196412-12196434 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1036871723 8:12438685-12438707 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1037300263 8:17444063-17444085 GATCAGAAGGAGGAGGAGGAGGG - Intergenic
1037670241 8:21009225-21009247 GATTAGAAGGAGGATGAAGTTGG - Intergenic
1038483763 8:27919277-27919299 GTGAAGGAGGAGGATGAGGAGGG + Intronic
1038535039 8:28347655-28347677 GCCTGAAAGCAGGATGAGGAAGG - Exonic
1039731838 8:40287926-40287948 GTTTAGAAGCAAGATGGAGCTGG + Intergenic
1041842425 8:62287778-62287800 GGTTAGAATCAGAATGTGGAAGG - Intronic
1042212425 8:66393775-66393797 TTTTAGAGTCAGGAGGAGGAAGG - Intergenic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1045496902 8:102716811-102716833 GTTCAGAGGCACGATGAGGGAGG + Intergenic
1045948082 8:107819703-107819725 GCTAAGAGGCAGGAAGAGGAGGG - Intergenic
1046670866 8:117054643-117054665 GATTAGAATCATGATGGGGAAGG + Intronic
1047062540 8:121244073-121244095 CTTTATCAGCAGGATGAGAACGG + Intergenic
1047682600 8:127269703-127269725 GTGCAGAAGCAGGATTTGGATGG - Intergenic
1048477226 8:134754669-134754691 GTTTTGAAGAAGGGTGAGGTGGG - Intergenic
1049753100 8:144294934-144294956 GTTGAGAAGCTGGCTGAGGGAGG - Intronic
1050301804 9:4266217-4266239 GTTAAGAAGCAGGGTGAGTGCGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050524673 9:6535119-6535141 GTATAAAAGCATGATGAGAATGG - Intronic
1051542182 9:18231963-18231985 CTTTAGGAGCAAGGTGAGGATGG - Intergenic
1051840457 9:21391951-21391973 GCTGCGAAGCAGGAGGAGGAAGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052444424 9:28542069-28542091 GGTAAGAAGCAGGATTAGGAAGG + Intronic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1053356725 9:37452164-37452186 GGTTAGAAGCAAGATGGGGTCGG + Intronic
1053886840 9:42650038-42650060 GTTTAGAGGGAGGGTGGGGAGGG - Intergenic
1054225859 9:62457488-62457510 GTTTAGAGGGAGGGTGGGGAGGG - Intergenic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055537594 9:77265282-77265304 TTTTGGTAGCAGGATGAGGCTGG + Intronic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG + Exonic
1058177721 9:101756720-101756742 GTTTTGAAGGAGGACTAGGATGG + Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1059063155 9:111054352-111054374 GTTGAGAAGCAGGATAGGGCAGG - Intergenic
1059253259 9:112906179-112906201 GGTTAGAAGCAGGATGGAGTCGG - Intergenic
1059419170 9:114180507-114180529 GTCTAGAAACAGGATGATGGTGG - Intronic
1059481241 9:114591645-114591667 GTTCTGAATCAGGATGTGGAAGG + Intronic
1059639545 9:116203309-116203331 GTTTCAAAACAGGATGAGCAAGG - Intronic
1059664716 9:116435665-116435687 GTTTAGAAACAGAATGAAGAAGG - Intronic
1059756425 9:117297837-117297859 GGGTAGAAGGAGGATGAGGTTGG - Intronic
1060046031 9:120341819-120341841 GCTCAGAAGAAGGAGGAGGAGGG + Intergenic
1060049396 9:120366818-120366840 GCTTTGAAGCAGGAAGAGGCCGG - Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1062518155 9:136946299-136946321 GCTTAGCAGGAGGATCAGGATGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185918218 X:4059822-4059844 GTTTAGTGACAGGAAGAGGAGGG + Intergenic
1185983697 X:4807266-4807288 GTTTAGAAGCAAGATGGAGTTGG + Intergenic
1186109367 X:6239678-6239700 GTTTATTAGCAGCATGAGAATGG - Intergenic
1186930904 X:14388923-14388945 TTATAGCAGCAGTATGAGGAAGG - Intergenic
1187009467 X:15265293-15265315 CCTTGGATGCAGGATGAGGAGGG - Intronic
1187299031 X:18030182-18030204 GATCAGAAGCAGGATTAAGAGGG - Intergenic
1187919557 X:24187869-24187891 CTTTAGAAGCACTAAGAGGATGG + Intronic
1188144613 X:26595645-26595667 GTTAGGAGGGAGGATGAGGAGGG + Intergenic
1188491724 X:30745155-30745177 GGGTAGATGCAGGCTGAGGAAGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190114964 X:47620224-47620246 TTTTAGGACCAGGATGAGGCGGG - Intergenic
1190478527 X:50851423-50851445 GGTTAGAAGCAAGATGAAGTTGG + Intergenic
1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG + Intergenic
1192619740 X:72666724-72666746 GCTAAGAAGCAGGATAGGGAAGG + Intronic
1194676705 X:96803013-96803035 GGATAGAAGCAGGCAGAGGAAGG - Intronic
1195220539 X:102742191-102742213 GTTTAGAAGCAAGATGGAGTTGG - Intronic
1195647740 X:107251156-107251178 GTCTTGAAGCAGGATATGGATGG + Intergenic
1195947286 X:110228781-110228803 GCGTATAAGCAAGATGAGGAGGG - Intronic
1197209660 X:123818349-123818371 GGTTAGAAGCAAGATGGGGTTGG + Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1197995349 X:132366877-132366899 CTTTATTAGCAGCATGAGGATGG - Intergenic
1198204187 X:134450873-134450895 GTACAGAAGGAGGATCAGGAAGG + Intergenic
1198575042 X:138001067-138001089 TTCTAGAAGCAGGATGACAAAGG + Intergenic
1199362066 X:146932862-146932884 GGTTAGAAGCAGGATGGAGTTGG - Intergenic
1199524588 X:148778338-148778360 TTTTTGAATCAGGATGATGACGG + Intronic
1201467852 Y:14304237-14304259 GCTTTGAAGCAGGATGAGAGAGG + Intergenic