ID: 1094102059

View in Genome Browser
Species Human (GRCh38)
Location 12:26775379-26775401
Sequence GCAACAAGGTAAAAAGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094102056_1094102059 -4 Left 1094102056 12:26775360-26775382 CCTAGAACAATGAGCCAATGCAA 0: 1
1: 0
2: 1
3: 14
4: 219
Right 1094102059 12:26775379-26775401 GCAACAAGGTAAAAAGTAACAGG 0: 1
1: 0
2: 0
3: 28
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094102059 Original CRISPR GCAACAAGGTAAAAAGTAAC AGG Intronic