ID: 1094107303

View in Genome Browser
Species Human (GRCh38)
Location 12:26828033-26828055
Sequence TATAATACCCCCAGGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094107303 Original CRISPR TATAATACCCCCAGGGGGAT GGG Intronic
901080825 1:6582963-6582985 TAAAATAGCCCCTGGGGGCTGGG - Intronic
905760308 1:40550949-40550971 TCTAGTCCCCCCAGGAGGATAGG + Intergenic
908428313 1:64030766-64030788 TATATTACCCACAAAGGGATGGG - Intronic
909172741 1:72316445-72316467 TATCACATCCCCAGAGGGATTGG - Intergenic
912697060 1:111849514-111849536 TACAATACCCACAGGGGTAGAGG - Intronic
916895798 1:169160522-169160544 TATAATACTCCAAGGGGTCTGGG + Intronic
917779074 1:178372041-178372063 TCTAATACAACCAGGGGGAGGGG - Intronic
920157740 1:203968914-203968936 AATAAGACTCCCATGGGGATGGG - Intergenic
920292505 1:204933630-204933652 TTTAATACCTCCAGGAGGTTTGG + Intronic
920732491 1:208500844-208500866 AACAATACTCCCAGGGAGATGGG - Intergenic
924307307 1:242703446-242703468 TATACTACCCCCTCAGGGATGGG - Intergenic
1065079178 10:22110867-22110889 TCTAAGCCACCCAGGGGGATAGG - Intergenic
1075615416 10:123887542-123887564 CCAAATATCCCCAGGGGGATGGG - Intronic
1081340522 11:41921924-41921946 TCTGATACCCCCTGGGGGACAGG - Intergenic
1083706910 11:64522891-64522913 TTTAAGATCCCCATGGGGATGGG - Intergenic
1094107303 12:26828033-26828055 TATAATACCCCCAGGGGGATGGG + Intronic
1096600947 12:52728834-52728856 TATAAAACCCCCAGTGTGAAAGG + Intergenic
1098479489 12:70942540-70942562 TTTAATACCCAGAGGGTGATAGG - Intergenic
1100270866 12:93023272-93023294 CACAATAGCCCCATGGGGATGGG - Intergenic
1100769307 12:97903602-97903624 TATAATAGCACCATGGGGAGGGG - Intergenic
1103323710 12:120106374-120106396 TATAACAACCCCATGGGGAAAGG + Intronic
1106796494 13:33211477-33211499 TATCAGACACCAAGGGGGATTGG + Intronic
1116518953 14:45828370-45828392 TATAATATCCAGAGGGGGAGAGG + Intergenic
1121003847 14:90473737-90473759 AATAAGACTCCCATGGGGATGGG + Intergenic
1128262239 15:66240512-66240534 TCTAATACGCCCATGGGGACTGG + Intronic
1131495769 15:92909540-92909562 TATAATACCACCACGAGGCTGGG - Intronic
1133992237 16:10717558-10717580 TGTAATATCCTAAGGGGGATAGG - Intergenic
1138392372 16:56679482-56679504 CATAATACCCGCAGGCAGATGGG - Intronic
1152896111 17:82912314-82912336 TCTGATACCCCCCGGGGGTTAGG + Intronic
1164745700 19:30611143-30611165 TATTCTACCCCCAGAGGGTTTGG - Intronic
925215357 2:2090037-2090059 TATGATACCTGCAGAGGGATGGG - Intronic
935413805 2:102793531-102793553 TTTCATATCCTCAGGGGGATGGG - Intronic
936403872 2:112185542-112185564 TATATTACTCCCATGGGGAATGG - Intronic
937682157 2:124655599-124655621 TATAATAAACCCAGGTGGACTGG + Intronic
948016220 2:234692897-234692919 TAAGATAACTCCAGGGGGATGGG + Intergenic
948100047 2:235366111-235366133 GAAAATCCCCCCAGAGGGATGGG + Intergenic
1168779610 20:477612-477634 TTGAATGCCCCCAGGGAGATAGG - Intronic
1171442108 20:25173483-25173505 GATAAGACTCACAGGGGGATGGG - Intergenic
1172443988 20:34983772-34983794 TAAAATACCCACAGGGACATTGG - Intronic
1172984774 20:38975924-38975946 TATAATCCTCCCATAGGGATGGG + Intronic
1179941312 21:44640196-44640218 AATAATATTCCCATGGGGATGGG - Intronic
1182154036 22:28052116-28052138 TATAAAACCCCCAAGGGAACTGG - Intronic
952595607 3:35014128-35014150 AAAAATATCTCCAGGGGGATGGG - Intergenic
955420467 3:58731500-58731522 TATAAAAACACCAGGGGAATGGG + Intronic
960047082 3:113209398-113209420 TTTAATTCCCCCAAGGGAATGGG - Intergenic
962247992 3:133813892-133813914 TGTAAGACCCCCAAGGGGAAAGG - Intronic
970031531 4:11680824-11680846 TATAATACTCAGAAGGGGATAGG - Intergenic
975959643 4:79886508-79886530 AATAAGACCCCCAGAGGGACAGG - Intergenic
976811809 4:89107193-89107215 TATCATGCCCCATGGGGGATGGG - Intronic
982810965 4:159825523-159825545 TATAATACCCCCAGAGCCCTGGG + Intergenic
985250113 4:188015699-188015721 TGTAATACCTTCAGGGGGCTGGG - Intergenic
993903447 5:93599262-93599284 TAAAATACCCCCAGGTGAAAAGG + Intergenic
997687167 5:135796561-135796583 CATAATATCCACAGGGGGAGAGG + Intergenic
998564067 5:143200402-143200424 TATAATAGCTAAAGGGGGATAGG + Intronic
1008946845 6:57107571-57107593 TATAATAAATCCATGGGGATGGG - Intronic
1009367055 6:62863986-62864008 CATAATATCCCCAGGGGGAGAGG - Intergenic
1009368231 6:62872469-62872491 TTTAATATCCACAGGGGGAGAGG + Intergenic
1015666265 6:135633042-135633064 TAGAATACCCACAGTGGCATGGG - Intergenic
1021201438 7:17732321-17732343 GATAAGACTCCCATGGGGATTGG + Intergenic
1024507327 7:50172949-50172971 ATTAATACCCCCAGTGGGTTAGG - Intergenic
1031793821 7:126145273-126145295 TATAATATTCCCAGAGGGTTTGG + Intergenic
1037983036 8:23268789-23268811 TAGAAAACCCCAAAGGGGATAGG + Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1043805705 8:84669990-84670012 CAAAACACCCCCAAGGGGATTGG + Intronic
1051367977 9:16334563-16334585 TTTCATCCCCACAGGGGGATAGG - Intergenic
1052085510 9:24260793-24260815 TGTAATAGCTTCAGGGGGATTGG - Intergenic
1055142284 9:72889235-72889257 TATCCTACCCCCAGGCGGAAAGG - Intergenic
1058518615 9:105798792-105798814 TATAATATCCCCGGGGGAAAAGG - Intergenic
1061780190 9:132991336-132991358 TAGAATACCCCCAGGGAGACAGG + Exonic
1061780499 9:132993383-132993405 TGGAATACCCCCAGGGAGACAGG + Intergenic