ID: 1094107473

View in Genome Browser
Species Human (GRCh38)
Location 12:26829868-26829890
Sequence ATGCTGCTATTGGTGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094107473_1094107475 12 Left 1094107473 12:26829868-26829890 CCAGGTTTCACCAATAGCAGCAT 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1094107475 12:26829903-26829925 TGTTTTGTTTGTTTTTTTTGAGG 0: 1
1: 37
2: 488
3: 8968
4: 31936

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094107473 Original CRISPR ATGCTGCTATTGGTGAAACC TGG (reversed) Intronic
901792381 1:11661226-11661248 ATGCTGCTGTTGGTGACCCTCGG - Exonic
901794752 1:11673711-11673733 ATGCTGCTGTTGGTGACTCGGGG - Exonic
906421306 1:45670098-45670120 CTGCTGCTGATGGTGAAAACTGG - Intronic
906441662 1:45852038-45852060 ATGACACTATTGGTGAAAGCTGG - Intronic
908972883 1:69858489-69858511 ATGCTAATATTGGTGTAGCCTGG - Intronic
909663923 1:78112951-78112973 ATGCTGCTAGTGGTGAAGTCTGG - Intronic
915906760 1:159884391-159884413 ATGCTGCAGCTGGTGAAACGTGG + Intronic
917286745 1:173429103-173429125 ATGCTGCTAATTGTTAAAGCTGG + Intergenic
919367411 1:196680624-196680646 CTGCTGCAATTAGTGAAACAAGG + Intronic
919690613 1:200525311-200525333 ATGCTGTTCTTGGTGAGGCCTGG - Intergenic
920289487 1:204908570-204908592 ATGTTACTATTGGGGGAACCTGG - Intronic
1063412461 10:5847127-5847149 ATGTTCCTATTGGGTAAACCAGG + Intergenic
1067572584 10:47382328-47382350 ATGATGCTATTGTTGGAACCTGG - Intronic
1069214245 10:65799381-65799403 ATGCTGCTATGTGAGAAATCTGG + Intergenic
1072696092 10:97603939-97603961 ATGTTGCCATTGGGGAAAACTGG - Intronic
1078139440 11:8681647-8681669 ATGCTGCTATTAGCGAAGACAGG + Intergenic
1078900778 11:15640506-15640528 ATGCGGCTATTGTTTAAAGCCGG + Intergenic
1079924968 11:26482665-26482687 ATATTGCTAGTGGTGAAGCCTGG + Intronic
1080652859 11:34236496-34236518 ATGCTGCTGTTAGGGAAAACTGG - Intronic
1092165848 12:6341765-6341787 CTGCTGCCACTGGTGAGACCAGG - Exonic
1092988388 12:13869858-13869880 ATGCTATCATCGGTGAAACCAGG + Intronic
1093974800 12:25409698-25409720 ATGCTACTAGTGGAGAAACCTGG - Intronic
1094107473 12:26829868-26829890 ATGCTGCTATTGGTGAAACCTGG - Intronic
1097376681 12:58851852-58851874 ATGCTGCTATAAGTGTTACCAGG + Intergenic
1104253654 12:127120904-127120926 ATGAGGCTATTGATGATACCGGG - Intergenic
1109648605 13:65294030-65294052 ATCTTGCTGTGGGTGAAACCTGG + Intergenic
1110003031 13:70229908-70229930 AAGCTGCTAATGGAGAAAACTGG + Intergenic
1110210752 13:72969535-72969557 ATGTTGCTATAGGTGTACCCTGG + Intronic
1113964055 13:114142495-114142517 ATGCTGCTGTTGGGGGAACTGGG + Intergenic
1115637973 14:35309206-35309228 ATGCTGCTGTCGGAGAAACTGGG + Intronic
1117799693 14:59430504-59430526 ACGTTGCTATTGGTAAAACTGGG + Intronic
1118297306 14:64582238-64582260 CTGCTGCTCTAGGTGAAATCAGG - Intronic
1121646606 14:95522030-95522052 ATGCTGCCATCGGTGGAAACTGG - Intergenic
1128036743 15:64533789-64533811 ATGCTGCTATTGGAGGAAATTGG - Intronic
1128172659 15:65526585-65526607 ATGTTACTAGTGGTCAAACCAGG + Intergenic
1129949137 15:79570752-79570774 ATGCAGCTATTGGGGGAACCTGG - Intergenic
1131674340 15:94655557-94655579 CTTCTGCTAATGGTGACACCCGG - Intergenic
1140246505 16:73254586-73254608 ATGCTGCCATTGGAGGAAGCTGG - Intergenic
1140887491 16:79257801-79257823 ATGTTGCTGTTAGTGAAAACTGG + Intergenic
1141053417 16:80793839-80793861 ATTTTGCTATTAGTGAAAACAGG - Intronic
1141733042 16:85834995-85835017 AAGCTGCTGATGTTGAAACCTGG - Intergenic
1142578565 17:925961-925983 CTGCTACTATTGGTGATATCAGG - Intronic
1146665741 17:34701914-34701936 ATGCTCCTACAGGTGAAACCAGG + Intergenic
1147549369 17:41428609-41428631 ATGATGGTGTTGATGAAACCTGG + Intergenic
1149666572 17:58369007-58369029 TTGCTGCTATTGGTGGGAGCTGG - Intronic
1152748899 17:82053554-82053576 ATGCTGCTCATGGAGAAGCCAGG + Intronic
1155494309 18:26427601-26427623 ATACTGCTTTTGGTGAAGTCTGG - Intergenic
1156364168 18:36409883-36409905 ATGTTGCTGTTGGAGAAAACAGG + Intronic
1156534787 18:37852097-37852119 ATGCTGATAATGGTGAACTCAGG - Intergenic
1159293448 18:66451485-66451507 ATGCTTCTATTAATGCAACCTGG - Intergenic
1160082956 18:75747218-75747240 ATGTTTCTATTGGGGAAAACTGG - Intergenic
1160888348 19:1363087-1363109 ATGCTGCCAGTGGGGAAGCCCGG - Intronic
927627815 2:24742035-24742057 TTGCTGCTAGTTGTGAAAACGGG - Exonic
928032510 2:27793914-27793936 ATGCTAATATTGGGGAAACTAGG + Intronic
928731157 2:34234854-34234876 TTGCTGCAATCGGTGAAAACAGG - Intergenic
930263973 2:49178164-49178186 AGGCTGCAATTGGTGAAGCCAGG - Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935096010 2:99945057-99945079 ATCCTGCTCTTGGGGAGACCTGG + Intronic
935176978 2:100657205-100657227 ATGTTACTACTGGGGAAACCGGG - Intergenic
935346641 2:102114329-102114351 CTGATACTATTTGTGAAACCAGG - Intronic
935847692 2:107184706-107184728 ATCCTGTTATTGGTGATACAGGG - Intergenic
938789488 2:134664121-134664143 TTCCTGCTGTTGGTGAAAGCTGG - Intronic
941390244 2:164904251-164904273 ATGTTGCTATTGGAGAAAAGAGG - Intronic
942209997 2:173660598-173660620 AGGCTGACATTGGGGAAACCTGG + Intergenic
942487005 2:176450664-176450686 ATACTGCAATTTGTGAAAGCTGG - Intergenic
942872893 2:180756960-180756982 AGGCTGCTATTGGGGTAACATGG + Intergenic
943450952 2:188041325-188041347 ATGTTACTATTGGGGAAAACTGG + Intergenic
946038665 2:216765371-216765393 ATGTTGCTATTGGGGTAACTGGG + Intergenic
1171297210 20:24028478-24028500 ATGATGATATTGGGGAAGCCTGG - Intergenic
1172496758 20:35391791-35391813 ATGGTGCAATTACTGAAACCAGG - Intronic
1175462870 20:59166443-59166465 ATGTTGCTATTGGAGGAAACTGG - Intergenic
1181105396 22:20571650-20571672 GCGCTGCTATTGGTGGAACAAGG - Intronic
1182777845 22:32844025-32844047 ATGCTACCATGGGTGGAACCTGG + Intronic
949437299 3:4043239-4043261 TTCCTGCTATTGCTAAAACCTGG + Intronic
949469975 3:4384334-4384356 ATGTTGCCATTGGGGAAAACTGG - Intronic
950251621 3:11470334-11470356 TTGCTGCTATGGTGGAAACCTGG + Intronic
951105053 3:18732629-18732651 ATGCTGATGCTGCTGAAACCAGG - Intergenic
951295958 3:20934824-20934846 ATGCTGGTATTGAAGAAACGTGG + Intergenic
951727325 3:25774636-25774658 ATGGTGCTATTGGTGGAGCATGG - Intronic
953267006 3:41400117-41400139 ATGCTTCCATTGGGGAAACTGGG - Intronic
961019174 3:123489637-123489659 ATGCTGCACTTGGTTAAAGCCGG - Intergenic
962821705 3:139054845-139054867 ATGCTGCTGTTGCAGAAAGCAGG - Intronic
963839971 3:150095178-150095200 ATGTTGCTACTGATGAAAGCTGG + Intergenic
964558701 3:157968876-157968898 ATCCTGATATTTGTGAAACTGGG - Intergenic
966140938 3:176754630-176754652 CTGCTGCTTGTGTTGAAACCGGG - Intergenic
970536452 4:17035024-17035046 ATGCTGTTATTGGGGGAAGCTGG - Intergenic
973828699 4:54736399-54736421 ATGCTGCTGTTGCTGAAATGTGG - Intronic
975960457 4:79897737-79897759 ATGTTGCTTTGGATGAAACCAGG - Intergenic
978350322 4:107814301-107814323 AAGTTGCTAATAGTGAAACCTGG + Intergenic
984002900 4:174272141-174272163 AGGCTTCTATTGGCCAAACCTGG + Intronic
989367810 5:40676152-40676174 CTGCTGCTATTGATTAAGCCAGG + Intergenic
990637849 5:57749554-57749576 AAGGTGCCAATGGTGAAACCAGG + Intergenic
992892220 5:81213953-81213975 ATGCTGCTGTTGGGGGAAACTGG - Intronic
994061917 5:95487353-95487375 ATGCTGCCATTCCTGGAACCTGG + Intronic
996764884 5:127026155-127026177 ATGCTGCTTTTCTTGAAACTGGG - Intronic
998835442 5:146198554-146198576 ATGCTGCCATTGGAGGAAACTGG - Intergenic
1005175847 6:23043738-23043760 ATGCTCCTATTGGTTAAAGCTGG + Intergenic
1010355993 6:74934121-74934143 ATGCTGCTATTTGTGTATGCAGG - Intergenic
1011426071 6:87231674-87231696 ATGCTGCTATTTGAGAATGCAGG + Intronic
1013079983 6:106803859-106803881 ATGGTGCTATTAGTCAAGCCAGG - Intergenic
1013305056 6:108840018-108840040 ATGTTGCCATTGGAGAAACTGGG - Intergenic
1015073815 6:129130545-129130567 ATGCTGATAGTGGTGAGACATGG + Intronic
1017145743 6:151233012-151233034 ATGTTACTATTGGGGAAAACTGG - Intergenic
1018089472 6:160333346-160333368 ACGCTGCTATTGATGACAACTGG + Intergenic
1021538513 7:21731480-21731502 ATGCTGATATTGGTGTATCTAGG - Intronic
1022865406 7:34413539-34413561 ATGTTGCCATTGGTGGAAACTGG - Intergenic
1026458619 7:70594417-70594439 ATGCTGCTAGTGGAGAGAACCGG + Intronic
1028669959 7:93390487-93390509 ATGTTGCCATTGGGGAAAACTGG + Intergenic
1032568522 7:132973993-132974015 GAGCTGCTCTGGGTGAAACCTGG - Intronic
1032581588 7:133108037-133108059 ATGTTGCTATTTCTGAAACTGGG - Intergenic
1033168984 7:139066751-139066773 ATTCAGCTAGTGGTCAAACCAGG - Intronic
1034041334 7:147880283-147880305 ATCCTGCTATTGGAGCCACCAGG - Intronic
1034902766 7:154917738-154917760 ATGGTGCTACTGGTGACACAAGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041557881 8:59179281-59179303 ATGCTACCATTGGAGAAAACTGG - Intergenic
1042339873 8:67667353-67667375 AGCCTGCTCTTGGGGAAACCTGG - Intronic
1049696000 8:143984644-143984666 ATGGTGCTATTGATGGAGCCAGG - Exonic
1050355218 9:4776438-4776460 ATGCTGCTGTTGTTGAGACAGGG - Intergenic
1053408204 9:37896312-37896334 ATGCTGCAATAGGTTAAAACAGG - Intronic
1055336508 9:75237681-75237703 ATCCTGCTATTGGGTAAATCAGG + Intergenic
1056875771 9:90328989-90329011 ATGTTACCATTGGCGAAACCTGG - Intergenic
1057326655 9:94070526-94070548 CTGCTACTATTGGTGGAAACTGG - Intronic
1059639416 9:116202142-116202164 ATGCTTCTACAGGTGAAAACAGG + Intronic
1060037478 9:120268533-120268555 ATGCTGCCATTGGGGGAAACTGG + Intergenic
1060397384 9:123325672-123325694 ATCCTGCTATTGAGAAAACCTGG - Intergenic
1191838306 X:65489066-65489088 ATGCTGCTCTGGGAGAAACTTGG - Exonic
1196986850 X:121282714-121282736 ATGCTGCCACTGCTGCAACCAGG - Intergenic
1197686835 X:129449085-129449107 ATGTTACTATTGGGGAAAACTGG + Intronic
1200817010 Y:7544023-7544045 ATGTTGCTATTGGTTAAATGTGG - Intergenic