ID: 1094112353

View in Genome Browser
Species Human (GRCh38)
Location 12:26875064-26875086
Sequence ATGCAAACTCAAAATTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094112351_1094112353 -10 Left 1094112351 12:26875051-26875073 CCTAAAATTCCTCATGCAAACTC No data
Right 1094112353 12:26875064-26875086 ATGCAAACTCAAAATTATTTTGG No data
1094112345_1094112353 30 Left 1094112345 12:26875011-26875033 CCATGCCATAACATGGTCAGAGA No data
Right 1094112353 12:26875064-26875086 ATGCAAACTCAAAATTATTTTGG No data
1094112346_1094112353 25 Left 1094112346 12:26875016-26875038 CCATAACATGGTCAGAGAAGTTG No data
Right 1094112353 12:26875064-26875086 ATGCAAACTCAAAATTATTTTGG No data
1094112350_1094112353 -4 Left 1094112350 12:26875045-26875067 CCAAGGCCTAAAATTCCTCATGC No data
Right 1094112353 12:26875064-26875086 ATGCAAACTCAAAATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094112353 Original CRISPR ATGCAAACTCAAAATTATTT TGG Intergenic
No off target data available for this crispr