ID: 1094114042

View in Genome Browser
Species Human (GRCh38)
Location 12:26890864-26890886
Sequence AGGATCTAAGTGGAAATAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094114042_1094114047 28 Left 1094114042 12:26890864-26890886 CCGACTATTTCCACTTAGATCCT No data
Right 1094114047 12:26890915-26890937 GCAAGATAAACAAGCATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094114042 Original CRISPR AGGATCTAAGTGGAAATAGT CGG (reversed) Intergenic
No off target data available for this crispr