ID: 1094116076

View in Genome Browser
Species Human (GRCh38)
Location 12:26914784-26914806
Sequence CTCAAACATAAATGCATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 6, 3: 19, 4: 328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094116074_1094116076 4 Left 1094116074 12:26914757-26914779 CCTTTATATGATGAAAATGAAGA 0: 1
1: 1
2: 1
3: 52
4: 452
Right 1094116076 12:26914784-26914806 CTCAAACATAAATGCATTCATGG 0: 1
1: 0
2: 6
3: 19
4: 328
1094116072_1094116076 29 Left 1094116072 12:26914732-26914754 CCTTTCTGAACTTGAAACCTATC 0: 1
1: 0
2: 0
3: 6
4: 162
Right 1094116076 12:26914784-26914806 CTCAAACATAAATGCATTCATGG 0: 1
1: 0
2: 6
3: 19
4: 328
1094116073_1094116076 12 Left 1094116073 12:26914749-26914771 CCTATCAGCCTTTATATGATGAA 0: 1
1: 0
2: 0
3: 8
4: 1622
Right 1094116076 12:26914784-26914806 CTCAAACATAAATGCATTCATGG 0: 1
1: 0
2: 6
3: 19
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094116076 Original CRISPR CTCAAACATAAATGCATTCA TGG Intronic
904684992 1:32253359-32253381 CTCAAACAAAAATGCCTCCCGGG + Intronic
905237163 1:36558120-36558142 CTCTAACATTACTGCATCCAGGG + Intergenic
906365138 1:45203331-45203353 CACAAACAAAAAAGCCTTCAAGG - Intronic
907182348 1:52581978-52582000 CTCATTCATAAATCCAGTCAGGG + Intergenic
908018371 1:59871920-59871942 CTCACACATAATTTCCTTCAGGG - Intronic
908560855 1:65304758-65304780 CTCAAACTCAAATGCCTGCAAGG + Intronic
908752843 1:67441322-67441344 CTCAAACAAAAAGGAACTCAAGG - Intergenic
910363487 1:86438681-86438703 CTCAAAAATGCATGCTTTCAGGG - Intronic
910658023 1:89638236-89638258 CTAAAACAAAAATCCATCCAAGG + Intronic
911937162 1:103992027-103992049 GTTAAATATAAATTCATTCATGG + Intergenic
912071556 1:105816835-105816857 CTTAAACAAAAATTAATTCAAGG - Intergenic
913943502 1:125133571-125133593 CTCAAAAAAAAATGCATTTTTGG + Intergenic
914097511 1:144556301-144556323 CTCAAAGTTAAATGAATTAAGGG - Intergenic
914393162 1:147240269-147240291 CTCAAGGTTAAATGGATTCAGGG + Intronic
915995851 1:160562553-160562575 CTTAAACAAAAATTAATTCAAGG + Intronic
917794498 1:178522786-178522808 CTCAAAGATAAATGCTTGAAGGG - Intronic
917809930 1:178648562-178648584 CTAAAAAATAAATGCATAAATGG - Intergenic
917810106 1:178650302-178650324 CTAAAAAATAAATGCATAAATGG - Intergenic
917911125 1:179647433-179647455 CTTAAACAAAAATCAATTCAAGG + Intronic
919250345 1:195048218-195048240 CTCAAACATAAAAACATTATTGG - Intergenic
919430190 1:197482888-197482910 CTCAAAATTAAACTCATTCATGG + Intergenic
920766944 1:208842482-208842504 CATAAACATAACTGCATACAAGG - Intergenic
922003377 1:221503712-221503734 CTAAAACAAAAATGCCTGCATGG - Intergenic
923059140 1:230454410-230454432 CTCACACATATAAGCTTTCAAGG - Intergenic
923493181 1:234502420-234502442 CCCAAACATAAATTCTTTCAAGG - Intergenic
923642166 1:235774929-235774951 ATCAAACAAAAATGCATTGTTGG - Exonic
1062882100 10:987696-987718 CACAAACATAAAAGCAGTAAAGG + Intergenic
1063085485 10:2814185-2814207 CTCAAAAATAATTGCCTTCTCGG - Intergenic
1063751083 10:8948067-8948089 CTCACACAAAAAGGAATTCAGGG - Intergenic
1063878643 10:10508226-10508248 CTCAAACAGATAAGCCTTCACGG + Intergenic
1065505360 10:26425177-26425199 CTCACACAAAAAGGAATTCAAGG - Intergenic
1067811788 10:49433814-49433836 CTCAAAAAAAAATGAATACATGG + Intergenic
1067901667 10:50248034-50248056 CTCAAACGTAAATCCTTACAAGG - Intronic
1068682823 10:59838550-59838572 TGCAAGCATAAATGCCTTCAGGG + Intronic
1068757933 10:60675302-60675324 TTCAAAGATAAAAGGATTCAGGG + Intronic
1068763481 10:60737190-60737212 CGCAAACATATTTGCCTTCAGGG + Intergenic
1072492177 10:95919323-95919345 TGCAACCATAAATGCATTAAGGG + Intronic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1075197054 10:120368915-120368937 CTCAAACTTGAGTGCATACAAGG - Intergenic
1075745953 10:124727682-124727704 CTCAAACTCAAATGCCTTCCAGG + Intronic
1077633662 11:3827424-3827446 CTCAGAGAAAAAGGCATTCAGGG + Exonic
1079160406 11:17987231-17987253 CACATACACAAATGCATACAAGG - Intronic
1080021219 11:27562135-27562157 CTCATCCATAAAATCATTCAAGG + Intergenic
1081060832 11:38474148-38474170 AACCAACATACATGCATTCATGG - Intergenic
1082131410 11:48494111-48494133 CTCACACATAAATACCTTCCTGG - Intergenic
1082564906 11:54664987-54665009 CTCACACATAAATACCTTCCTGG - Intergenic
1085174084 11:74471542-74471564 CTAGAACATAAATTCATTGAGGG + Intergenic
1085704672 11:78775943-78775965 CTAAAAAATAAATACCTTCAAGG - Intronic
1086020685 11:82226206-82226228 CTCAACCCTAAAAGCAATCAGGG + Intergenic
1086062977 11:82719381-82719403 CAGAAACATAAAGGCATTGACGG + Intergenic
1086224301 11:84489132-84489154 CCCAAACATAAAGCCATGCAGGG - Intronic
1086769371 11:90742935-90742957 CTCATAAATAAATACATTAATGG - Intergenic
1086934727 11:92732473-92732495 TTAAACCATAAATGCATTGAGGG - Intronic
1087185217 11:95184228-95184250 CTCAATCTGAAATACATTCAAGG + Intronic
1087186869 11:95208902-95208924 CTTAAACAAAAATTAATTCAAGG + Intronic
1089820992 11:121226062-121226084 CTCAAACAAGAAAGAATTCAAGG + Intergenic
1089950308 11:122519591-122519613 CTCAAACTTTAAAACATTCATGG - Intergenic
1090026662 11:123173391-123173413 GTCTTACATGAATGCATTCATGG + Intronic
1091250694 11:134141563-134141585 CTGAAACATAGATGCAGCCACGG - Intronic
1092291939 12:7164925-7164947 CTCAAAAATAAAAGCTTTCTAGG + Intergenic
1092655920 12:10685529-10685551 CACAAACACAAATGTATTCATGG + Intergenic
1093761772 12:22918981-22919003 CACAAACACAAATGCCTACATGG + Intergenic
1094116076 12:26914784-26914806 CTCAAACATAAATGCATTCATGG + Intronic
1094699100 12:32851467-32851489 CTCAAACAAAAAAGAATTTAGGG - Intronic
1096172510 12:49484116-49484138 CACACACATGAATGTATTCACGG + Intronic
1096936933 12:55291017-55291039 CTCAGAGATAAATGAATACATGG + Intergenic
1097587998 12:61538042-61538064 CACACACATAGATGAATTCAGGG - Intergenic
1100469975 12:94882111-94882133 CTCAAGCATAAAAGAACTCACGG + Intergenic
1100651024 12:96588650-96588672 ATGAAGTATAAATGCATTCATGG - Intronic
1100689822 12:97027905-97027927 CTCAACCTCAAATGTATTCAGGG - Intergenic
1102223021 12:111207429-111207451 CTCGTCCATCAATGCATTCATGG - Intronic
1102856009 12:116294470-116294492 ATCAAACTTAAATGAATTCCTGG + Intergenic
1103806611 12:123578701-123578723 CTCAAATTCAAATGCCTTCAGGG - Intergenic
1107213026 13:37881040-37881062 CTGCAACATTAATCCATTCAGGG + Intergenic
1107569945 13:41646312-41646334 CTGAATCATTAATTCATTCATGG + Intronic
1109620971 13:64904623-64904645 CTCAAACAACTAGGCATTCAAGG + Intergenic
1109784825 13:67159745-67159767 CTAAAAAACAAATTCATTCAGGG + Intronic
1110183932 13:72650624-72650646 CTCAAGCCTAAATGCATTTCAGG + Intergenic
1110743906 13:79030614-79030636 CTCTAACAGACATGCTTTCAAGG + Intergenic
1110982984 13:81926045-81926067 CTTAAAAATAAATTCCTTCAAGG + Intergenic
1111009790 13:82296392-82296414 CTTACACTTTAATGCATTCATGG + Intergenic
1111473410 13:88716838-88716860 CTTAAACATAAAGGAGTTCAGGG + Intergenic
1111481687 13:88836229-88836251 CCAAAACATAAATGAATACAAGG - Intergenic
1111902538 13:94217479-94217501 CTCAAAGAAAGATGCATTCCAGG - Intronic
1112604062 13:100886546-100886568 CTCAAACGTTAATCCATCCAAGG + Intergenic
1112699469 13:101988965-101988987 ATCAAACATAATTGCTTTTAAGG + Intronic
1114413952 14:22526552-22526574 CTCAACCATAACCTCATTCAGGG - Intergenic
1115065302 14:29252753-29252775 CTCAAACAAAAATACATTGAGGG - Intergenic
1115109297 14:29802015-29802037 CTCAGACATTAATACATTCCTGG + Intronic
1116187700 14:41618844-41618866 CTCAAAAATATATGAATCCATGG - Intronic
1116345692 14:43790527-43790549 CTCACACAAAAAAGAATTCAGGG + Intergenic
1116550570 14:46232150-46232172 CTTATACAAAAATGAATTCAAGG + Intergenic
1118520666 14:66580979-66581001 CACAGACATAAATGCATCCCAGG - Intronic
1119346955 14:73933646-73933668 CAGAAACATAAATGCGTCCATGG - Exonic
1119353687 14:73987941-73987963 ATCAAACATAATTCCATACAAGG + Exonic
1120044055 14:79786655-79786677 CGCACACATTAATGCATGCAGGG - Intronic
1120865885 14:89294922-89294944 CTCAAACAAGAAAGAATTCAGGG - Intronic
1121831929 14:97060225-97060247 CTCACAAATAAATAAATTCATGG + Intergenic
1123414914 15:20088316-20088338 CTCAAAAAAAAATGCAGTAATGG - Intergenic
1123524256 15:21095430-21095452 CTCAAAAAAAAATGCAGTAATGG - Intergenic
1124170496 15:27368320-27368342 CGCACACATACATGCACTCACGG + Intronic
1125606014 15:40940461-40940483 ATCAAACAGGAAAGCATTCAGGG + Intergenic
1126258405 15:46655689-46655711 TTTAAACATAAATGTATTCATGG + Intergenic
1129427953 15:75478404-75478426 CTCAAAAATAAATAAATTAAAGG - Intronic
1129767889 15:78181878-78181900 CACACACACAAATGCACTCAGGG + Intronic
1130172681 15:81531906-81531928 GTTAAACATAAATGCAGACAGGG + Intergenic
1132192556 15:99880072-99880094 TTTAAACTTAAATGCATACAAGG - Intergenic
1132440172 15:101854740-101854762 CTCAAACATTAAGGCATGCCAGG + Intergenic
1133142038 16:3752534-3752556 ATTTAACATAAATGCAGTCAGGG + Intronic
1133560124 16:6943046-6943068 ATCTAACGTAAAGGCATTCAGGG - Intronic
1133575490 16:7085153-7085175 TACAAACATAAATGCCTCCAAGG + Intronic
1133645028 16:7755977-7755999 CTCCAACAAAAAGGCATTAAGGG + Intergenic
1136199167 16:28675917-28675939 CTCAAACTTGAAGGTATTCAGGG - Intergenic
1136215514 16:28790087-28790109 CTCAAACTTGAAGGTATTCAGGG - Intergenic
1136770278 16:32832533-32832555 CTCAAAAAAAAATGCATTTTTGG - Intergenic
1137457603 16:48630040-48630062 CTCTAACATAAAAGCTTGCAAGG + Intergenic
1137540987 16:49361495-49361517 CACAAACACAAATGTCTTCAAGG + Intergenic
1137547773 16:49416204-49416226 CTCAAACCTGAAGGCTTTCATGG + Intergenic
1138135104 16:54514480-54514502 CTCAAGCATGCATGCACTCAAGG - Intergenic
1138429825 16:56961680-56961702 GTAAAAAATAAATGAATTCATGG + Intergenic
1138566152 16:57834156-57834178 TTTAAAAATAAATGCATTCCCGG - Intronic
1139677545 16:68535141-68535163 ATCAAACATAAATCCAGTCTGGG - Intronic
1142392838 16:89813887-89813909 CTCAAAAATTAATGAATTAAAGG + Intronic
1143664498 17:8348725-8348747 CACAAACTCAAATGCATACAGGG + Intergenic
1147281053 17:39361794-39361816 CTCAAAAAAAAATGCTTTCTTGG + Intronic
1148589136 17:48802480-48802502 CACAAACTCAAATGCCTTCAAGG + Intronic
1149136653 17:53374469-53374491 CTAAAATATGAATGTATTCATGG - Intergenic
1152465806 17:80465530-80465552 CTCATCCATGAATGCCTTCAGGG - Intergenic
1153037740 18:780355-780377 CTAAAGGATAAATGGATTCATGG + Intronic
1153889249 18:9497197-9497219 CTCGCACAAAAATGAATTCAGGG - Intronic
1155507048 18:26544290-26544312 TTAAAAAATGAATGCATTCAAGG - Intronic
1155600124 18:27536010-27536032 CTCAAACATTAAATAATTCAAGG + Intergenic
1156099402 18:33575865-33575887 TTCAAACACAAATGCAATAAAGG - Intergenic
1156380142 18:36551655-36551677 CTTATACAAAAATTCATTCAAGG - Intronic
1156512195 18:37647453-37647475 CTTATACAAAAATTCATTCAAGG - Intergenic
1156943993 18:42804602-42804624 ATTAAAGATAAATGCATTCTAGG + Intronic
1158079190 18:53568288-53568310 CTCAGGCATAAATGGATTAAGGG - Intergenic
1158134556 18:54192150-54192172 TTCACACATAAATGCTTACAGGG + Intronic
1158705512 18:59788909-59788931 CTCAAACATATAAGCAAGCATGG - Intergenic
1158723947 18:59951188-59951210 CTCAAAGATACTTGCTTTCATGG - Intergenic
1159970143 18:74640628-74640650 TTAAAACATAAATGCACTCAGGG - Intronic
1160077905 18:75695038-75695060 TTCAAACATAAATCCCTCCAGGG - Intergenic
1160227525 18:77022747-77022769 CTCACAAATAACTGCATTCAGGG - Intronic
1160557801 18:79737354-79737376 GTCAAACGTAAACGCATCCAAGG - Intronic
1161791652 19:6363567-6363589 CACAAACACAAATGCTTCCAGGG - Intronic
1163187828 19:15652311-15652333 CAGAAACATGAAAGCATTCATGG + Intronic
1164019979 19:21292796-21292818 CTCAAGTATAAATGCTTTCCTGG + Exonic
1165098095 19:33421180-33421202 CTCAACCAGAGATGCATGCATGG - Intronic
925590543 2:5505190-5505212 CTCAGACAAGAGTGCATTCAGGG + Intergenic
925721038 2:6827580-6827602 CTCAAATAAGAAGGCATTCAAGG - Intergenic
926571164 2:14531330-14531352 TTCAAAAATAAATGTTTTCATGG - Intergenic
928034018 2:27805085-27805107 CTCAAACACAGATACATTCAGGG + Intronic
928786749 2:34896449-34896471 CTCAAACGTATGTCCATTCATGG + Intergenic
930418051 2:51115153-51115175 GTCAATCATGAATGCACTCATGG + Intergenic
930694637 2:54398919-54398941 GTCAAACATAAATGCACTTGAGG + Intergenic
931102110 2:59013796-59013818 CTTTCACATAAATACATTCAAGG + Intergenic
936930722 2:117785884-117785906 ATCAGACAGAAATGCTTTCAGGG + Intergenic
937370505 2:121294227-121294249 CCAAAACACAAATGCAGTCATGG + Intergenic
938004105 2:127773672-127773694 CTGAAACTTAATTGGATTCATGG - Intronic
938859680 2:135355294-135355316 CTCAAACATCACTGGATTCTGGG + Intronic
938951057 2:136254902-136254924 CTCAAACTTTACTGCATACAAGG + Intergenic
941383378 2:164823013-164823035 ACCAAACATAAATTCATCCAAGG + Intronic
942122796 2:172794668-172794690 CACAAACACAAATGCCTGCAGGG - Intronic
942589240 2:177523149-177523171 ATCAACCATAAATGCCTTTATGG - Intronic
942623642 2:177875678-177875700 CTTAAAAATAAATGCATATACGG - Intronic
942957544 2:181791063-181791085 CTAAAAGACAAATGCAGTCAGGG + Intergenic
943113618 2:183638795-183638817 CATAAACAAAAATGCATTAATGG + Intergenic
943807622 2:192141734-192141756 CTAAAACATAAATTCAATCATGG - Intronic
945485785 2:210394376-210394398 CTGAAACAGAAATGGATTCATGG - Intergenic
945954908 2:216077505-216077527 CTCAAAAAAAAATACATGCAGGG + Intronic
946388214 2:219399057-219399079 CTCAAACTTAAGTGCTTGCAAGG - Intronic
948417969 2:237830222-237830244 ATCAATCTCAAATGCATTCAGGG - Intronic
1169180163 20:3557488-3557510 CTCAAACAAGAGTGAATTCAGGG + Intronic
1169538802 20:6577806-6577828 ATCCAACAGAAATGCATGCATGG + Intergenic
1172067160 20:32229769-32229791 CTCAAAAAAAAAAGCATTGAAGG - Intronic
1172598944 20:36170261-36170283 CTCTAACTTAAACTCATTCAAGG + Intronic
1172936783 20:38626172-38626194 CTCAAACAAAACTGCTTTTATGG - Intronic
1173605044 20:44325826-44325848 CTCAAAAATAAATACATTTTTGG + Intergenic
1176256821 20:64157283-64157305 CTCAAACCCTAATGCATCCACGG + Intronic
1177272542 21:18868465-18868487 CTCACACATAATGACATTCATGG - Intergenic
1177930543 21:27277647-27277669 CACACACACAAATGAATTCAAGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178194789 21:30332106-30332128 CTCAAAAATAAATGCAATAAAGG - Intergenic
1179309107 21:40181147-40181169 CACAAACAGAAATGTATGCATGG - Intronic
1179392960 21:41010786-41010808 CTCAAACTCAAATGCCTGCAGGG + Intergenic
1179811597 21:43874450-43874472 TTTGGACATAAATGCATTCATGG - Intronic
1181938117 22:26453391-26453413 CTCCAACAGAAATGCCTCCACGG - Exonic
1185325397 22:50223206-50223228 CTCATGCATAAATGCATACACGG + Intronic
951255740 3:20447546-20447568 TTCAAACTTAAATGCCTTCAAGG + Intergenic
951431225 3:22609273-22609295 CTCAAACATAACTGTCTTTATGG + Intergenic
951496414 3:23332441-23332463 CTGAAAAACAAATGCATACATGG + Intronic
953187111 3:40648330-40648352 CTCCATCATAACCGCATTCAAGG - Intergenic
953199617 3:40767292-40767314 TTCAAACAGAAATGCATCCCAGG - Intergenic
953363205 3:42319014-42319036 CTCAAACATTAAGGCATGCCAGG - Intergenic
954249151 3:49354984-49355006 GTCATTCATAAATGCAATCAAGG - Intergenic
954600686 3:51865489-51865511 CTCAAACATTAAGGCATACCAGG + Intergenic
955888447 3:63625195-63625217 CTCGAACATAAATTCCATCAAGG + Intergenic
956648548 3:71481447-71481469 GTGAAAAATAAATGCATTCCAGG - Intronic
957089534 3:75715921-75715943 CTCAAACATTAAGGCATGCTAGG - Intronic
957201559 3:77142676-77142698 CTCACACATGGCTGCATTCAGGG + Intronic
957214879 3:77307395-77307417 TGCAAACATAAAAGCATACAGGG + Intronic
957427338 3:80054988-80055010 CTCAATCCTAAATGCAATAAAGG + Intergenic
958170566 3:89934281-89934303 CTCAAACATTAAGGCATACCAGG + Intergenic
959197744 3:103207577-103207599 CCCAAAGATAAATGCATTTAGGG - Intergenic
959678858 3:109069173-109069195 CTTTAACATAAATGTTTTCAAGG - Intronic
960061543 3:113327957-113327979 CACAAAAATAAATTCATTAATGG + Intronic
963612713 3:147492114-147492136 CTCAAAAATAAATACATGAATGG - Intronic
963751723 3:149186710-149186732 CCCATACATGAATCCATTCATGG + Exonic
963998988 3:151745293-151745315 CTCACAAATAATTCCATTCATGG + Intronic
964155437 3:153579693-153579715 CTAAAACTAAAATGCATTAAAGG + Intergenic
964734765 3:159905438-159905460 CACAAATATAAATGCATATAGGG + Intergenic
965161174 3:165135550-165135572 CTTATACAAAAATGAATTCAAGG - Intergenic
965495408 3:169391928-169391950 TTCAAAAAAAAATGCATTCAGGG + Intronic
965789013 3:172367770-172367792 ATTAACCATAAATGCATTCCTGG - Intronic
965882562 3:173403892-173403914 TCCAAACATACATTCATTCAGGG - Intronic
966000947 3:174948125-174948147 CTTACACATAAATATATTCATGG + Intronic
966071089 3:175878992-175879014 GTCTTAAATAAATGCATTCAGGG - Intergenic
966165809 3:177015089-177015111 CTCAAATATACAGGGATTCAAGG + Intergenic
966654936 3:182345598-182345620 CTCATACAAAAATTAATTCAAGG + Intergenic
967258880 3:187622217-187622239 CCCAAACTCAAATGGATTCAAGG - Intergenic
967335982 3:188345257-188345279 CTTAAACATAAATGGACTCCAGG + Intronic
967652406 3:192002796-192002818 TTTAAACATTAATGCATTGAAGG - Intergenic
967754051 3:193148610-193148632 CTCAAAAACTAATGCATACAAGG + Intergenic
968147660 3:196312797-196312819 CTCAAACACAAAAGAATCCAGGG + Intronic
970102786 4:12544463-12544485 CTCAAAAATAAATGTATTATAGG - Intergenic
970220277 4:13803381-13803403 CTTAAACAAAAATCAATTCAAGG + Intergenic
971055496 4:22908617-22908639 CACAAACTTAAATGCCTTCATGG + Intergenic
971561164 4:28081171-28081193 CTCATACAAAAATTAATTCAAGG + Intergenic
972438446 4:39059200-39059222 CTTAAACATTAATGCCTTTATGG - Intronic
972707984 4:41564350-41564372 CTCAAGCAATAATGCTTTCACGG - Intronic
973792128 4:54387660-54387682 CATAAAAATAAATGAATTCATGG - Intergenic
974585778 4:63875075-63875097 CTCAAACATTAAAATATTCAGGG + Intergenic
974800381 4:66810246-66810268 CTTAAACATAAAAGAATTCTTGG + Intergenic
975879353 4:78884732-78884754 TTCCTCCATAAATGCATTCAGGG + Intronic
976663243 4:87562532-87562554 TTCAAACAGAAATGCTTCCATGG - Intergenic
977499702 4:97823600-97823622 CTCACACAAAAAAGAATTCAAGG - Intronic
980201725 4:129664017-129664039 CTCAGACATAAATGGGTTAAGGG + Intergenic
980944220 4:139302772-139302794 TGCAAACATCAATGCATTTATGG - Intronic
981880867 4:149610712-149610734 CTCAAACGAAAATGAATTAAAGG + Intergenic
983106484 4:163692593-163692615 ATAAAACATAAATTCTTTCAGGG - Intronic
983424742 4:167569071-167569093 CACAAACATAACTGGAATCAGGG + Intergenic
983866343 4:172771785-172771807 ATCAAACTTTAATGCATTTAAGG - Intronic
986367754 5:7051114-7051136 TTTAAACATAAAAGCTTTCATGG - Intergenic
987177128 5:15325044-15325066 CTCAAACATCTACACATTCAGGG - Intergenic
987617093 5:20290257-20290279 CTCAAGCATTAATGCATAGAAGG - Intronic
987787279 5:22517894-22517916 CTCACACATTAATACATTAATGG + Intronic
988239218 5:28587678-28587700 TTCAATCATACAGGCATTCATGG - Intergenic
988857043 5:35237606-35237628 ATCAAACTCAAATGCTTTCATGG + Intergenic
989203097 5:38785512-38785534 CTAGAACATAAGTGCATTGAAGG - Intergenic
989591561 5:43117833-43117855 CCCAAACTCAAATGCTTTCAGGG + Intronic
990240651 5:53813172-53813194 CACTAAAAGAAATGCATTCAGGG - Intergenic
991159195 5:63476970-63476992 GAAAAACATAAATGCAATCATGG + Intergenic
991250971 5:64560932-64560954 CACAAAAATGAATGCATTAAGGG - Intronic
992998867 5:82359735-82359757 CTCAAACTGCAATGCCTTCAAGG - Intronic
993476100 5:88366563-88366585 CTCACACAGAAAGGAATTCAAGG - Intergenic
993620722 5:90164632-90164654 CTCAAACTGAAGTGCCTTCAGGG + Intergenic
994029569 5:95126419-95126441 GTTAAAAATAAATGCATGCATGG - Intronic
996156699 5:120111401-120111423 CATAAACTTAAATGCGTTCAGGG - Intergenic
996318748 5:122190539-122190561 CTCAAACATGAATCTATTCCTGG + Intergenic
996582126 5:125043011-125043033 CATAAACATAAATTCATTCAGGG - Intergenic
996753240 5:126910360-126910382 GTCAACCAGAAATGCATTAATGG + Intronic
997421119 5:133767490-133767512 CCCTAGCATAGATGCATTCAAGG - Intergenic
998576300 5:143321079-143321101 CTCACACATAAGAGCATACAAGG + Intronic
999023466 5:148197419-148197441 CTCAAACTCAAATGCCTCCAAGG + Intergenic
999749515 5:154616747-154616769 CTTATACAAAAATGAATTCAAGG + Intergenic
1000060238 5:157648823-157648845 CCAAACCATAAATGCGTTCATGG + Exonic
1000122790 5:158213241-158213263 TTCAAACATAAAGGCCTTCAAGG + Intergenic
1000555571 5:162721529-162721551 CCCAAACACAAATGCTTTCATGG - Intergenic
1000666808 5:164008057-164008079 GACAAACAAAAATGCATTTATGG - Intergenic
1001862718 5:175072030-175072052 CTCAAACATTAAGGCATGCCAGG + Intergenic
1003384931 6:5658610-5658632 ATAAAACATAAATGCCATCATGG - Intronic
1004788696 6:18998992-18999014 CTCTAACATAAAACCACTCAGGG - Intergenic
1005170204 6:22975537-22975559 ATTAAACATAAATGAATTCTGGG + Intergenic
1006668884 6:35717382-35717404 CTCACACATACATGAATACATGG - Intronic
1006918236 6:37610020-37610042 CTCTTACATAAATGGATTCGGGG - Intergenic
1006987412 6:38185089-38185111 CTAAGACATAAACTCATTCATGG + Intronic
1007646850 6:43389384-43389406 CTAACTCATACATGCATTCAAGG - Intergenic
1007865845 6:44969247-44969269 TTCAAACATAAATGGAATTAAGG - Intronic
1008426377 6:51362493-51362515 CTCAAAGTTAAATGTTTTCACGG + Intergenic
1012367012 6:98453564-98453586 CTCAAGTATAAGTGCTTTCAGGG + Intergenic
1012378853 6:98595597-98595619 CTCAAACATAAAAGAATTCATGG - Intergenic
1013096942 6:106953924-106953946 GTCAACCACAAATGCAGTCATGG + Intergenic
1013686729 6:112593414-112593436 CTGAAACATGACTGCTTTCAGGG - Intergenic
1014920553 6:127210528-127210550 CTTATACATAAATATATTCAGGG - Intergenic
1017114283 6:150962284-150962306 CTCACACAAAAATACATTTAAGG - Intronic
1018077188 6:160228140-160228162 CTCACACATGAAAGAATTCAGGG - Intronic
1018944403 6:168336332-168336354 CTCACACATATATGGAGTCAGGG + Intergenic
1020493210 7:8815170-8815192 TTCTAACATAAATGTAATCATGG + Intergenic
1020734389 7:11928725-11928747 ATGCAGCATAAATGCATTCATGG - Intergenic
1020803239 7:12757642-12757664 CTGAAACATAGATACATTCCTGG - Intergenic
1021399223 7:20190281-20190303 ATCAAAGATAATTGCAATCATGG + Intronic
1021455232 7:20822844-20822866 CTGAAACTTATAAGCATTCATGG + Intergenic
1022267056 7:28767227-28767249 AACAAAAATAAATGCATACATGG - Intronic
1022379438 7:29846050-29846072 CTAAAATTTAAATGCATTGAGGG - Intronic
1022747238 7:33184767-33184789 CTCAAACAAGAAAGAATTCAGGG + Intronic
1024631085 7:51247611-51247633 CCATAACATAAAGGCATTCATGG + Intronic
1026513671 7:71048712-71048734 CCCAAACATAATTACATTCCTGG - Intergenic
1026670260 7:72384078-72384100 CTTATGCATAAATGCATTCCTGG + Intronic
1026764619 7:73152720-73152742 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027041089 7:74962488-74962510 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027082548 7:75239885-75239907 CCCAAACAGAAATGCATTCAGGG + Intergenic
1028293731 7:89100773-89100795 TTCAAACTTAAATTCATTAATGG + Intronic
1029834442 7:103295025-103295047 CTCAAACATGAAAGAATTAAAGG + Intergenic
1030224092 7:107129602-107129624 CTCGCACAAAAATGAATTCAGGG + Intronic
1031259605 7:119501694-119501716 GTCAAAATGAAATGCATTCAAGG - Intergenic
1031324860 7:120382467-120382489 TTCAAATATAAATGTAATCATGG + Intronic
1031740706 7:125426557-125426579 CACAAACACAAATCTATTCATGG - Intergenic
1034293949 7:149955142-149955164 CTCCAACAGAAATGCATGCTAGG + Intergenic
1034697691 7:153068645-153068667 AGCAAACAGAAATGCCTTCATGG + Intergenic
1034812122 7:154141718-154141740 CTCCAACAGAAATGCATGCTAGG - Intronic
1036504184 8:9340337-9340359 ATCAAACATAAATGCTTTTTTGG - Intergenic
1037720704 8:21441494-21441516 CTCAAAGATAAAACCATTTAAGG - Intergenic
1040367227 8:46730370-46730392 CTCATACAAAAATTAATTCAAGG + Intergenic
1040943774 8:52859510-52859532 CTCAAACATTAAGGCATGCCAGG + Intergenic
1041774480 8:61509210-61509232 CTCAAACAAGAAAGAATTCAGGG + Intronic
1043302554 8:78751971-78751993 CTAAAACATAATTGAGTTCATGG - Intronic
1043486773 8:80705588-80705610 CACACACACAAATGCATACACGG - Intronic
1043909927 8:85852077-85852099 CTCAAACATTAAGGCATGCCAGG - Intergenic
1045624600 8:104028841-104028863 CTCAAACAAGAAAGAATTCAAGG + Intronic
1046158454 8:110326409-110326431 CTCAAACAAAAAGGCACTGAAGG - Intergenic
1047786093 8:128155138-128155160 ATCAAACTTAAATTCAATCAAGG - Intergenic
1049917884 9:336167-336189 CACAATCACAAATGCCTTCAGGG + Intronic
1050490683 9:6184994-6185016 CTTATACATATCTGCATTCATGG + Intergenic
1050751599 9:8945195-8945217 ATCAAACAGAAAATCATTCATGG + Intronic
1050793093 9:9499292-9499314 CTAAAATATATGTGCATTCATGG + Intronic
1053351749 9:37417911-37417933 CACAAATACAAATCCATTCAAGG + Intergenic
1054829797 9:69610778-69610800 CTCAAACATTAAGGCATGCCAGG + Intronic
1054883202 9:70166981-70167003 CTAAAATATAACCGCATTCAGGG + Intronic
1055135993 9:72829556-72829578 TACATACATAAATGCATGCAGGG - Intronic
1057095495 9:92304401-92304423 ATCAAACAGAACTGCACTCAAGG + Intronic
1057960270 9:99448889-99448911 ATAAGACATAAATGCATTGAAGG - Intergenic
1058414050 9:104766402-104766424 TTCAAATATGAATGCGTTCATGG + Exonic
1062489242 9:136796696-136796718 ATCAAAGATTAATGCATTTAGGG + Intronic
1203488050 Un_GL000224v1:76036-76058 CTCAAACATTAAGGCATGCTAGG + Intergenic
1203500671 Un_KI270741v1:17929-17951 CTCAAACATTAAGGCATGCTAGG + Intergenic
1185953457 X:4462388-4462410 CTTAAAGATAACTCCATTCAAGG - Intergenic
1185984801 X:4820154-4820176 CTGAAATAAATATGCATTCATGG - Intergenic
1186293420 X:8123473-8123495 CTGAACTAGAAATGCATTCATGG - Intergenic
1186366427 X:8898993-8899015 TTCAATCATAATTGCATTCCTGG - Intergenic
1186509379 X:10118934-10118956 CACAAAGATCACTGCATTCAAGG - Intronic
1188867868 X:35336488-35336510 GTCAAACATCAATACATTCAGGG - Intergenic
1189358993 X:40334210-40334232 CTCAAACTTATTTGCAATCAGGG - Intergenic
1189790554 X:44599668-44599690 CTTAAACAAAAATGAATTCTAGG - Intergenic
1193179021 X:78431529-78431551 CTCAAACATAGTTGCAATCCTGG + Intergenic
1193272028 X:79540000-79540022 CTGAAACATTATTGCATTCCTGG + Intergenic
1194611028 X:96045315-96045337 CTCAAAAATAAATCCATTCATGG - Intergenic
1195120865 X:101750695-101750717 CACAAACATAAATTTATTTAAGG + Intergenic
1195905007 X:109835952-109835974 CTCAAACATAAAGGCCTTCAGGG - Intergenic
1196316596 X:114233143-114233165 CTCAAAAATAAATTTAATCAAGG - Intergenic
1199340668 X:146673342-146673364 CTTATAAATAAATGCATTCTGGG - Intergenic
1199538808 X:148934331-148934353 GCCAAACAAAACTGCATTCACGG - Intronic
1199940804 X:152625914-152625936 CTCAAACAGAGTTTCATTCAAGG - Intergenic
1200008467 X:153103659-153103681 CACAGACATAAATACATCCATGG - Intergenic
1201436864 Y:13968519-13968541 CTTATACAAAAATGAATTCAAGG - Intergenic