ID: 1094120912

View in Genome Browser
Species Human (GRCh38)
Location 12:26973298-26973320
Sequence ATGCCTACTCCCAGCTCCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094120912_1094120913 -7 Left 1094120912 12:26973298-26973320 CCTTGGGAGCTGGGAGTAGGCAT 0: 1
1: 0
2: 0
3: 39
4: 286
Right 1094120913 12:26973314-26973336 TAGGCATGTGCCACCATGCCTGG 0: 477
1: 7714
2: 31688
3: 81374
4: 150167
1094120912_1094120917 22 Left 1094120912 12:26973298-26973320 CCTTGGGAGCTGGGAGTAGGCAT 0: 1
1: 0
2: 0
3: 39
4: 286
Right 1094120917 12:26973343-26973365 TTTTAATTTTTTTGTAGAGATGG 0: 402
1: 2523
2: 10319
3: 52606
4: 380491
1094120912_1094120918 23 Left 1094120912 12:26973298-26973320 CCTTGGGAGCTGGGAGTAGGCAT 0: 1
1: 0
2: 0
3: 39
4: 286
Right 1094120918 12:26973344-26973366 TTTAATTTTTTTGTAGAGATGGG 0: 336
1: 2410
2: 10119
3: 40550
4: 186506
1094120912_1094120919 24 Left 1094120912 12:26973298-26973320 CCTTGGGAGCTGGGAGTAGGCAT 0: 1
1: 0
2: 0
3: 39
4: 286
Right 1094120919 12:26973345-26973367 TTAATTTTTTTGTAGAGATGGGG 0: 305
1: 2286
2: 9353
3: 37630
4: 165503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094120912 Original CRISPR ATGCCTACTCCCAGCTCCCA AGG (reversed) Exonic
901775657 1:11558956-11558978 AGCCCTACTACCAACTCCCAGGG + Intergenic
902509107 1:16955948-16955970 CTGACTACTCCCAGGACCCAGGG + Intronic
902546214 1:17192122-17192144 ATGCCTAATCCCAGCTACTCGGG - Intergenic
902681235 1:18045286-18045308 AAGCTTAGTCCCAGGTCCCAAGG - Intergenic
902843159 1:19088223-19088245 ATGCCAAGTCTCAGCTTCCAAGG + Intronic
902869420 1:19304812-19304834 ATGCCTTGTCCCAGCTACTAGGG + Intronic
903742756 1:25567746-25567768 CTGGCTGCTCCCTGCTCCCAGGG + Exonic
904153589 1:28463855-28463877 ATGCCTAGTCCCAGCTACCTGGG - Intronic
904458891 1:30663817-30663839 ATGCCGAAACCCAGCTCCCGTGG + Intergenic
904775580 1:32904104-32904126 ATGCCAATGCCCATCTCCCAGGG + Intergenic
905226291 1:36481280-36481302 AGGCCAACACCCAGCACCCAGGG - Intronic
905256772 1:36689749-36689771 AGCCCTACTCCCAGGCCCCATGG - Intergenic
905389374 1:37626430-37626452 ATGCCTCCTCCCAACTCCCCGGG + Intronic
907550395 1:55300059-55300081 AGGACTTCTCCCAGCTCTCATGG + Intergenic
908368482 1:63454151-63454173 ATGCCTACTACCAGTTTCCAAGG + Intronic
909907717 1:81220583-81220605 CTGCCTGCTCCTGGCTCCCATGG - Intergenic
912445799 1:109735298-109735320 ATGCATAGTCCCAGCTACCCAGG - Exonic
912662653 1:111546878-111546900 ATTCCTACTAGCAGTTCCCAAGG + Intronic
913112653 1:115670402-115670424 ATGCATCCTCCCAGCTTGCAAGG + Intronic
915358074 1:155268536-155268558 TTGTCCACTCCCAGCTCTCACGG - Intronic
915587434 1:156851840-156851862 AGGCCTCCTCACTGCTCCCAGGG + Intronic
916432418 1:164743892-164743914 ATGGCTACTCCTAGCTGCGAGGG + Intronic
917637798 1:176954090-176954112 ATCCCCACTGCCATCTCCCATGG + Intronic
917979648 1:180260897-180260919 GTGCCGACCCCTAGCTCCCAAGG - Intronic
919912620 1:202121180-202121202 TTCCCTCCTCCCAACTCCCACGG - Intergenic
923611639 1:235500993-235501015 ATGCCTAGTCCCTTCTCCCAAGG - Intronic
924625806 1:245695756-245695778 TTCTCTACTCCCAGCTCACACGG + Intronic
924625819 1:245695823-245695845 TTCTCTACTCCCAGCTCACACGG + Intronic
924625832 1:245695890-245695912 TTCTCTACTCCCAGCTCACACGG + Intronic
1067415136 10:46097017-46097039 AACCCTACACCCAGCCCCCATGG + Intergenic
1069621091 10:69837670-69837692 AGGCCCACTTCCAGCTCCCCAGG - Intronic
1069755305 10:70771129-70771151 ATCCCTACTCCCCACTCCCATGG - Intergenic
1070159673 10:73858583-73858605 ATGACTGCTCCCAGGTCCTAAGG - Intronic
1070808668 10:79286286-79286308 ATGCCTGGTCCCTGTTCCCAAGG - Intronic
1071224414 10:83511388-83511410 TTGCCTCCTCCTAGATCCCAAGG - Intergenic
1071734493 10:88283066-88283088 GTGCTGACTCCCATCTCCCAGGG + Intronic
1072562133 10:96586562-96586584 ATGCCTCCTCCACGCTCCCAAGG + Intronic
1073417057 10:103392932-103392954 ATCCCTTCTCCCTTCTCCCATGG - Intronic
1073452388 10:103617566-103617588 GAGCCGACTCCCTGCTCCCAGGG - Intronic
1073495838 10:103890257-103890279 CTGCCTTCTCTCAGCTCACAAGG + Intronic
1073690093 10:105799003-105799025 ATGCTTTCTCACAGGTCCCATGG - Intergenic
1075581817 10:123624513-123624535 ATGCCCACTGCCATCTGCCATGG - Intergenic
1075634412 10:124020454-124020476 ATGCTGCCTCCCAGATCCCACGG + Intronic
1076620169 10:131781973-131781995 ACACCAACTCACAGCTCCCAGGG - Intergenic
1076699550 10:132264402-132264424 ACGCCTACTCCCAGCTCGAGGGG - Intronic
1077183077 11:1225001-1225023 CTGCCTCCTCCCAGCCTCCATGG + Intronic
1085303513 11:75472478-75472500 GAGCCCAATCCCAGCTCCCAGGG + Intronic
1088617443 11:111645017-111645039 AGGCCAACTCCCAGCTCTCATGG + Intronic
1091222643 11:133938240-133938262 CTGCCTGCTCCCAGCTCCTCAGG + Intronic
1091397330 12:161949-161971 ATGCCTACCACCAGCTCCCTGGG - Exonic
1091450964 12:571576-571598 TTGCCAAGTCCCAGCTCCTAAGG + Intronic
1091464852 12:675058-675080 ATGCCTAGTCCCAGCTACTTGGG + Intergenic
1092189186 12:6505738-6505760 ATCTGTAGTCCCAGCTCCCAGGG + Intronic
1092516025 12:9213897-9213919 TTGCCTAATCCAAGGTCCCAAGG + Intergenic
1093013441 12:14132191-14132213 ATGCCTACTTCCAACTCTCTGGG + Intergenic
1094120912 12:26973298-26973320 ATGCCTACTCCCAGCTCCCAAGG - Exonic
1094509486 12:31087757-31087779 ATGCCAACCCCAACCTCCCATGG - Intronic
1095957480 12:47814794-47814816 ATGCCGTCTCCCACCTCCCCAGG - Intronic
1096973709 12:55686406-55686428 ATGCTTGCTCCCTGCTCCCATGG - Intronic
1097312852 12:58140056-58140078 ATTGCTACTCTGAGCTCCCACGG - Intergenic
1101213390 12:102557381-102557403 ATGCCTCCTTCCAACTCCAAAGG - Intergenic
1101578703 12:106022090-106022112 ATGGGCACTCCCAGCTCCTATGG - Intergenic
1101828019 12:108235852-108235874 CTGCCAACTCCAAGCTCCCAGGG - Intronic
1102148183 12:110670313-110670335 CAGCCAACTCCCAACTCCCATGG + Intronic
1104837676 12:131802103-131802125 ATGCCTGCTCCCTTCTACCAGGG - Intergenic
1108472308 13:50779697-50779719 ATGCCTGCATCCAGCCCCCAGGG + Intronic
1108854542 13:54776004-54776026 CCGCCTGTTCCCAGCTCCCACGG + Intergenic
1110408898 13:75182874-75182896 ATGCCTTCTTCCAGCTCCTCAGG + Intergenic
1111596579 13:90419780-90419802 ATGCCTAGTCCCAGCTACTCAGG - Intergenic
1112627402 13:101121218-101121240 TCGCCTCCTCCTAGCTCCCATGG + Intronic
1114394094 14:22341254-22341276 ATGCATAATCCCTGCCCCCAGGG + Intergenic
1114615151 14:24064404-24064426 CTGTGTCCTCCCAGCTCCCATGG + Intronic
1115690366 14:35837673-35837695 ATGCCTAGTCCCAGCTGCTTGGG - Intronic
1117007176 14:51432773-51432795 ATTCATACACCCAGCACCCAGGG - Intergenic
1118270011 14:64334388-64334410 AGGCCTACTCCCAACAGCCAGGG - Intronic
1121329131 14:93039089-93039111 CTGCATACGCCCAGCTCTCACGG + Intronic
1121339112 14:93094478-93094500 ATGGCTTCACCCGGCTCCCAGGG - Intronic
1124093960 15:26631103-26631125 ATGCCTGCTCCCGGCACTCAGGG - Intronic
1124597351 15:31102087-31102109 CCGCCTTCTCCCAGCTCCCCGGG - Intronic
1125395248 15:39240487-39240509 ATGCCAACTGTCAGATCCCAAGG + Intergenic
1126427900 15:48549362-48549384 ATGCCGCCTCCCTGCTCCCAAGG - Intronic
1127759632 15:62125861-62125883 ATCCCTACTCCCAGCTCTCTGGG - Intergenic
1129116242 15:73367036-73367058 ATGCCTGCTGTCAGCACCCAAGG + Intronic
1129332652 15:74835681-74835703 ATGCTCACACCCAGCCCCCAGGG - Intergenic
1129758783 15:78115155-78115177 TTCTCTACTCCCACCTCCCAGGG - Intronic
1130368645 15:83263878-83263900 AGGCCTCCTCCCAGCTACCCTGG - Exonic
1131084799 15:89567105-89567127 ATGGCTACTCCTAGCTGCAAGGG - Intergenic
1132281256 15:100617957-100617979 ATGCCTCCCCCCACCCCCCACGG + Intronic
1132387594 15:101411385-101411407 AGGCGGACTCCCCGCTCCCAGGG - Intronic
1133027048 16:2993061-2993083 ATTCCTATTCCCAAATCCCAGGG - Intergenic
1133234329 16:4380848-4380870 CTGCCTCCTCTCTGCTCCCAGGG + Exonic
1133321384 16:4915768-4915790 ATGCTAACACCCAGCTCTCAGGG - Intronic
1134822836 16:17260541-17260563 ATGCCTCTTACCAGTTCCCAAGG + Intronic
1135669772 16:24365442-24365464 TTGCACACTCCCAGTTCCCAGGG - Intergenic
1136234245 16:28904585-28904607 ATGGGGACTCCCAGCCCCCATGG + Exonic
1137565966 16:49532648-49532670 AGGACTACACCCAGCTCCCCAGG - Intronic
1143811295 17:9473966-9473988 AGGCCAACTCCCAACCCCCAGGG + Intronic
1145798724 17:27670423-27670445 ATCCCTACTCCGAGCTCCAGGGG + Intergenic
1147341349 17:39754755-39754777 ATGTCCACTCCCACCCCCCATGG + Intergenic
1147965250 17:44191207-44191229 ATGTCTGCCCCCAGCACCCAGGG + Exonic
1150438511 17:65172745-65172767 CTGCCTCCTACCAGCTGCCATGG - Intronic
1151358951 17:73576998-73577020 CTGCCATCTCCCAGGTCCCATGG + Intronic
1151756429 17:76077829-76077851 TTGCCTGCTTTCAGCTCCCAGGG + Intronic
1152358703 17:79819838-79819860 ATGCCCACACCCACCTCACAAGG + Intergenic
1153879936 18:9413063-9413085 AGGCCTTCTCTCACCTCCCATGG - Intergenic
1153943591 18:9997830-9997852 ATGCCAGCTCCCATCTCCCTAGG + Intergenic
1155046755 18:22109636-22109658 AGCCCTACTCCCATCTCCCCAGG - Intergenic
1155326388 18:24669202-24669224 AGGCCTCCTGCCAGCTTCCACGG + Intergenic
1157271439 18:46279385-46279407 TTGCCTCCTTCCAGCTTCCAGGG - Intergenic
1157572788 18:48724036-48724058 ATGACTACACCAAGCACCCAGGG - Intronic
1157575233 18:48739091-48739113 AAGTCTTCTCCCACCTCCCAGGG + Intronic
1157841788 18:50966096-50966118 ATGCCCACCCCCTGCTCCCAAGG + Intergenic
1158425218 18:57334013-57334035 CTCCCTAGTCCCAGCTCCCAGGG + Intergenic
1158616046 18:58987932-58987954 AAGCCTACTCCCACCACCCTAGG - Intergenic
1159817850 18:73099252-73099274 ATACCTCCTCCCAGGTCCCATGG + Intergenic
1160857778 19:1225060-1225082 CTGCCAACACCCAGATCCCAGGG + Intronic
1161366985 19:3885749-3885771 GTGCCTCTTCCCAGCTCCCATGG + Exonic
1161680506 19:5677641-5677663 CTGTCTGCTCCCTGCTCCCAGGG + Intronic
1162329281 19:10017530-10017552 ATGCCTAATCCCAGCTACTCGGG + Intronic
1162479410 19:10919991-10920013 CTGCCTCCTCCCCACTCCCAGGG + Intronic
1162490334 19:10987652-10987674 TTGCCTTCTCCCAGGACCCATGG + Exonic
1163020565 19:14478960-14478982 CTGCCACTTCCCAGCTCCCAGGG - Intronic
1163601746 19:18253424-18253446 ATGCCTAGTCCCAGCTACTCAGG + Intronic
1163913501 19:20217384-20217406 ATCCTTAGTACCAGCTCCCAGGG + Intergenic
1164170233 19:22718558-22718580 ATCCCTGCTCCCAGCTAACAGGG - Intergenic
1164550411 19:29206509-29206531 AAGCCCACTCCCAACTCCCAGGG + Exonic
1165020376 19:32919537-32919559 TTGCCTGCTACCAGCACCCAGGG + Intronic
1165124331 19:33583252-33583274 AGGGATATTCCCAGCTCCCATGG - Intergenic
1165224220 19:34342758-34342780 CTGCCTACTCCCGGCAGCCAAGG + Intronic
1165738464 19:38192333-38192355 CTCCCGACCCCCAGCTCCCAAGG + Intronic
1165827078 19:38711595-38711617 ATGCCACCACCCACCTCCCAGGG - Intronic
1166111662 19:40626716-40626738 GTCCCTAGTCCTAGCTCCCATGG + Intronic
1166251149 19:41571737-41571759 CTGTCAGCTCCCAGCTCCCAGGG - Intronic
1166692329 19:44830393-44830415 ATGCCTAGTCCCAGCTACTCAGG + Intergenic
1167098502 19:47389325-47389347 TTGCCTACTCCCGGCCCACAGGG - Intergenic
1167499512 19:49837207-49837229 ATGCCTCTTCCAGGCTCCCATGG - Intronic
1168490709 19:56806509-56806531 ATGCCTACTTCTAGCTGCAAGGG + Intronic
925195611 2:1922389-1922411 GTCCCTCCTCCCAGCTTCCATGG + Exonic
925361512 2:3283565-3283587 ATGCCTTCCCCCAGCTGCAAAGG + Intronic
926709389 2:15865435-15865457 AGGCATAGTCCCAGCTACCAGGG + Intergenic
926740787 2:16108938-16108960 ATGCCTCTTCCCAGGTCACATGG + Intergenic
927846776 2:26476309-26476331 ATGCCCACCCCCAGCTGCCAGGG - Exonic
928477595 2:31646386-31646408 GTTCCCACTCCCAACTCCCAAGG + Intergenic
930004194 2:46882916-46882938 TTGCTGACTCCCAGCTCCCATGG + Intergenic
932340993 2:70962597-70962619 CTGCCTACTCCCAGGAACCATGG + Intronic
932531508 2:72538928-72538950 ATGCCTATTCCCAGCTCAAGCGG - Intronic
935725547 2:106020907-106020929 ATGGCTGCTCCCATTTCCCAGGG - Intergenic
936033015 2:109087179-109087201 ATGGCCACGTCCAGCTCCCATGG - Intergenic
936520822 2:113211109-113211131 AGGACTCCTCCCAGCTCCCAAGG - Intergenic
937175415 2:119927236-119927258 ATGCGTAATCCCAGCTACTAGGG - Intronic
937210232 2:120263971-120263993 ATCTGTAATCCCAGCTCCCAGGG - Intronic
937997625 2:127706885-127706907 CTGCCTGCTCCCAGCCACCAGGG + Intronic
938823293 2:134979928-134979950 ATGGCAACCCCCAACTCCCAGGG - Intronic
938967249 2:136399412-136399434 CTACCCACTCCCAGCTCCAAGGG - Intergenic
939570271 2:143832457-143832479 ATGCATACACCCAGCTGCCTAGG - Intergenic
940190094 2:151031625-151031647 ATTCCTTCTCTCTGCTCCCAAGG - Intronic
944130066 2:196338075-196338097 ATGCCTGCTCCCCTCTACCATGG + Intronic
944725687 2:202469153-202469175 ATGCCTGATCCCAGCTACTAGGG - Intronic
945206080 2:207334029-207334051 ATGGATACTTCCAGCTTCCAGGG + Intergenic
945377859 2:209100274-209100296 ATACCTAGTCCCAGCTACTAGGG + Intergenic
948301193 2:236908762-236908784 CTGCTTTCTCCCTGCTCCCACGG + Intergenic
948543284 2:238704923-238704945 TTGCTTTCTCCAAGCTCCCAAGG + Intergenic
948759750 2:240183284-240183306 GTCCCTACTGCCACCTCCCAGGG + Intergenic
1169265031 20:4162247-4162269 CTCCCGACTCCCAACTCCCAGGG + Intronic
1170711242 20:18793135-18793157 AAGTCTACCCCCAACTCCCAAGG + Intergenic
1172515005 20:35527343-35527365 CAGTCTCCTCCCAGCTCCCAGGG - Intronic
1172633832 20:36395995-36396017 CTGCCTGGTCCCAGCTTCCAAGG + Intronic
1173185292 20:40835893-40835915 ATGCAGACTCCCACCCCCCAGGG + Intergenic
1173479009 20:43384454-43384476 ATGCCTTCTCCCCACCCCCATGG - Intergenic
1173964113 20:47098837-47098859 AAGCCTACCCCCAGCCTCCAAGG + Intronic
1173970007 20:47145381-47145403 ATGCCTTCTCTCTGATCCCAGGG - Intronic
1174610520 20:51794424-51794446 ATGCCTAATCCCAGCTACTCAGG + Intronic
1175321033 20:58088511-58088533 ATGGCCACTCCCAGCTGCCAGGG - Intergenic
1175522884 20:59613491-59613513 AAGGCTACTCCCAGCTGCCAGGG + Intronic
1175625191 20:60483883-60483905 TCTCCTGCTCCCAGCTCCCAAGG - Intergenic
1176317724 21:5263870-5263892 ATGCCTTCTACCAGCATCCATGG + Intergenic
1176475589 21:7200645-7200667 ATGCCTTCTACCAGCATCCATGG + Intergenic
1178482173 21:32989168-32989190 CTGCCTCCTCCCACCTCCCCGGG + Intergenic
1179801748 21:43814533-43814555 ATTTCTGCTCCCAGCTCCCTCGG + Intergenic
1179927404 21:44543768-44543790 ATGCTTTCTCCGAGCTCCAAGGG - Intronic
1181142693 22:20818509-20818531 ATGCCCCCTCCCAGTTCCCCTGG - Exonic
1181468370 22:23122910-23122932 ATGTCTTCACCCACCTCCCACGG - Intronic
1181894217 22:26092829-26092851 ATGCCTACTCCCTCCCTCCATGG - Intergenic
1182577724 22:31284514-31284536 GTGGCTGCTCCCAGCTCCCTTGG + Intronic
1183228610 22:36566755-36566777 CTGCCCACTTCCAGCTCCCACGG + Intronic
1185111288 22:48901545-48901567 AAGCCTCCTCCCTGCTTCCAGGG - Intergenic
1185260028 22:49856560-49856582 AAGCCGCCTCCCAGCTCCCCCGG + Intronic
1185267951 22:49914415-49914437 ATGGCTTCTCCCAGCCCCCAGGG - Intronic
949517637 3:4821620-4821642 CTGCCTAGTCCCATGTCCCAAGG + Intronic
950267414 3:11584899-11584921 CTGCCCTCTCCCAGCACCCAGGG + Intronic
950575140 3:13827811-13827833 ATCCCTGCCCCCAGCACCCATGG + Intronic
952857757 3:37786053-37786075 ATGCCCACACTCAGATCCCAGGG + Intronic
953987003 3:47451821-47451843 ATGCCTCCCCCTAGCTCTCAGGG + Intronic
954684525 3:52363186-52363208 CTGCCTGCTCCCAGCCTCCAGGG + Intronic
955176811 3:56623801-56623823 ATCCCAACTCCCAGCTCCAAAGG + Exonic
956009529 3:64816038-64816060 ATGCCCACCCACAGCTCCCCAGG + Intergenic
956392577 3:68789104-68789126 GTGCCTAGTCCCAGCTACTAGGG + Intronic
956860558 3:73319647-73319669 ATGGCTACATCAAGCTCCCAGGG + Intergenic
958516037 3:95117087-95117109 ATGCCCACACCCAGCTGCCAAGG - Intergenic
961639985 3:128359056-128359078 GTGCCTACTCCCATCTGACAGGG - Intronic
961705218 3:128779714-128779736 GTGCCTACTCCCAGCTACTCAGG - Intronic
962188418 3:133284594-133284616 ATGATGAATCCCAGCTCCCATGG + Intronic
964544166 3:157815168-157815190 ATGCCTAGGCCCAGACCCCAGGG + Intergenic
965354083 3:167652404-167652426 ATGGATACTCCAAGCACCCACGG + Intronic
965476635 3:169163768-169163790 ATGCCAACTCCCAATTACCAAGG - Intronic
966896170 3:184446862-184446884 GTGCCTACTCACAGCTCACATGG + Intronic
967110694 3:186290934-186290956 ATGCCTATTCCCACCAACCAGGG + Intronic
968278644 3:197459331-197459353 ATCCCTACTCACAGCCTCCAAGG - Intergenic
968547347 4:1205936-1205958 ATGCCCACCCCTAGCTCCCCTGG + Intronic
969358245 4:6644155-6644177 ATGCCTGGTCCCAGCTACCAGGG - Intergenic
970613205 4:17744404-17744426 AATCCTAGTCCCAGCCCCCAAGG - Intronic
971058520 4:22940622-22940644 ATGCTTTCTCTCAGCTCACATGG + Intergenic
973648181 4:52970583-52970605 TTGGCTACTCCCTGCCCCCAGGG - Intronic
975967141 4:79986833-79986855 ATGCCCAGTCCCAGTCCCCAAGG + Intronic
976119467 4:81763638-81763660 ATGCCTAGTCCCAGCTACTTGGG + Intronic
978027602 4:103896725-103896747 ATACCCACTCCAAGCTCCCATGG - Intergenic
980840104 4:138248917-138248939 ATCCCTACTCTCTGCCCCCATGG - Intergenic
982844505 4:160232779-160232801 ATACCTACTCCCAGCCCATAAGG + Intergenic
990281280 5:54253409-54253431 ACCTCTACTCCCAGCTCCCTGGG - Intronic
991556687 5:67902648-67902670 AAGCCTAAGTCCAGCTCCCATGG + Intergenic
994174764 5:96699681-96699703 ATGCCTTCACCCTGCTCCAAGGG + Intronic
995169562 5:109091447-109091469 ATGCCTCCACCCAGATTCCACGG + Intronic
995385279 5:111581788-111581810 ATGCCTACACTCAGCTCCAATGG + Intergenic
996587601 5:125107965-125107987 TTGTCAACTCACAGCTCCCAAGG - Intergenic
997236985 5:132278346-132278368 ATTCCAAATCCCAGCTCACAGGG + Intronic
997389582 5:133503179-133503201 ATGCTTACTCCCAGATTCCAAGG + Intronic
997453356 5:134000944-134000966 ATGCCTCCCACCAGATCCCAGGG + Intronic
998619500 5:143778934-143778956 ATGCCTAGTCCCAGCTACTTGGG - Intergenic
999757905 5:154679000-154679022 ATGCGTAATCCCAGCACCCTGGG + Intergenic
1001522573 5:172405162-172405184 ATGCCTAGTCTCTGTTCCCAAGG - Intronic
1003047341 6:2745798-2745820 ATGCCTAGTCCCAGCTACTTGGG + Intronic
1003882860 6:10494146-10494168 ATACCTGCACCCAACTCCCAGGG + Intronic
1003974272 6:11328063-11328085 AGGCCTGCTGCCTGCTCCCATGG + Intronic
1006559118 6:34894123-34894145 ATGCCTATCCCAAGCTCCCAAGG - Intronic
1006663207 6:35667300-35667322 AGACCTAGTCCCTGCTCCCAAGG + Intronic
1006751436 6:36380438-36380460 CTCCCGACTCCCAGCTCCCAAGG + Intronic
1007009282 6:38399693-38399715 ATGGCTACTCCTAGCTGCAAAGG - Intronic
1007261665 6:40568314-40568336 ATGCCAACTCACAGTTCCCCAGG - Intronic
1007951168 6:45873682-45873704 ATGCCTCCTCCCTCCTCACAGGG + Intergenic
1008074344 6:47130301-47130323 CTGACTACTCCCAGCCCACATGG + Intergenic
1011135623 6:84096873-84096895 ATGCCTGTTCCCAGCTGCTAGGG - Intergenic
1015204141 6:130616038-130616060 ATGCCCACTCCCTGGCCCCAAGG - Intergenic
1016319305 6:142824886-142824908 ATGCCTTCTACCAGCTCCAGAGG - Intronic
1016786413 6:148015500-148015522 ATGCCTGAGCTCAGCTCCCAGGG - Intergenic
1016891198 6:149008540-149008562 ATGCCTTCTCCCAGGTACAAGGG - Intronic
1016918094 6:149263964-149263986 CTGCCTCCTGCCAGCTCCCAGGG + Intronic
1017209570 6:151840187-151840209 ATATCTACTCCCACCTCCAAAGG + Intronic
1019621950 7:1996704-1996726 GTGCCTGCTCCTTGCTCCCAGGG - Intronic
1020088437 7:5323982-5324004 CTGCCTCCTCCCTGGTCCCAGGG + Intronic
1020290503 7:6719050-6719072 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1021063579 7:16144383-16144405 ATGACTTCTCCCAGCTCCCTTGG - Intronic
1023194793 7:37623244-37623266 CTGCCTCCTCCCTGCCCCCAAGG + Intergenic
1023825226 7:44004485-44004507 GTGCCTAGTCCCAGCTCCTCAGG - Intronic
1023854990 7:44177421-44177443 GTGCCTACCCCCAGCTGCCCAGG + Intronic
1023998039 7:45174020-45174042 GTGCCCACTCCCATCTCCCTAGG - Intronic
1025205876 7:56993130-56993152 CTGCCTCCTCCCTGGTCCCAAGG - Intergenic
1025488184 7:61077941-61077963 ATGCCTAATCCCAGCTCTTTGGG + Intergenic
1025666064 7:63583808-63583830 CTGCCTCCTCCCTGGTCCCAAGG + Intergenic
1026088777 7:67283256-67283278 GTGCCTAGTCCCAGCTCCTCAGG - Intergenic
1026725476 7:72867087-72867109 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1026747566 7:73024951-73024973 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1026751216 7:73053090-73053112 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1026754865 7:73081204-73081226 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1026758517 7:73109238-73109260 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1027033773 7:74910243-74910265 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1027088888 7:75284247-75284269 GTGCCTAGTCCCAGCTCCTCAGG - Intergenic
1027092531 7:75312175-75312197 GTGCCTAGTCCCAGCTCCTCAGG - Intergenic
1027096174 7:75340142-75340164 GTGCCTAGTCCCAGCTCCTCAGG - Intergenic
1027118368 7:75498574-75498596 GTGCCTAGTCCCAGCTCCTCAGG - Intergenic
1027273430 7:76536892-76536914 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1027323168 7:77027550-77027572 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1027326878 7:77055956-77055978 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1028640674 7:93039378-93039400 CTGCCTGCTTCCAGCCCCCAAGG - Intergenic
1029397176 7:100316412-100316434 GTGCCTAGTCCCAGCTCCTCAGG - Intronic
1029719122 7:102351446-102351468 GTGCCTAGTCCCAGCTCCTCAGG + Intergenic
1029753491 7:102557812-102557834 GTGCCTAGTCCCAGCTCCTCAGG - Intronic
1029771440 7:102656896-102656918 GTGCCTAGTCCCAGCTCCTCAGG - Intronic
1030219853 7:107086720-107086742 ATGCCTAATCCCAGCACTCTGGG - Intronic
1030675345 7:112379304-112379326 ATGAATATTCCCAGGTCCCAGGG + Intergenic
1032093328 7:128923048-128923070 ATGGCAAAGCCCAGCTCCCAGGG - Intergenic
1033595562 7:142855773-142855795 CTGACTCCTCCCAGCTCCAAGGG - Intronic
1035728933 8:1841583-1841605 CTCCCTACTCCCTGCCCCCAGGG - Intronic
1035790270 8:2297793-2297815 AAGCCTTCTCCCTGCTGCCATGG - Intergenic
1035802535 8:2423912-2423934 AAGCCTTCTCCCTGCTGCCATGG + Intergenic
1036627695 8:10485055-10485077 ATGCCTGCACACAGCTGCCATGG - Intergenic
1037194936 8:16177409-16177431 GTGCCTCCTCCCAGCTTCTACGG - Intronic
1037597364 8:20365498-20365520 ATGCCTAATCCCAGCTACTCAGG + Intergenic
1037688003 8:21159756-21159778 ATGCCTCCTGTCTGCTCCCATGG + Intergenic
1039288575 8:36069288-36069310 ATCCCTACTCCTGGCTCACAGGG - Intergenic
1042891046 8:73610409-73610431 ATGCCTAGTCCCAGCTACTCTGG + Intronic
1044170878 8:89050170-89050192 CTGCCTACTCCCACTTCCCTGGG + Intergenic
1046461738 8:114547484-114547506 ATCTTTACTCCCAGCTGCCATGG - Intergenic
1047230979 8:122997518-122997540 ATGCCTACTCCTAGCTGCAAGGG - Intergenic
1047586646 8:126280693-126280715 AGTCCTACTCCCAACACCCATGG - Intergenic
1049246307 8:141564579-141564601 TTTCCTCCTCCCAGCTCCCTGGG - Intergenic
1049349190 8:142154949-142154971 CTGCCCACACCCAGCCCCCAGGG + Intergenic
1050089566 9:2003794-2003816 ATTCCTACCTCCAGCACCCAAGG - Intergenic
1051578072 9:18640132-18640154 ATTCTTACTTCCAGCTGCCATGG - Intronic
1051845479 9:21447197-21447219 TTGCCTATTGCCAGCTCTCAAGG + Intergenic
1052487326 9:29118714-29118736 ATGACTCCTCCCAGGTCCCTTGG - Intergenic
1055506891 9:76957076-76957098 ATGCCATCTCCCTGCTCCCCAGG - Intergenic
1056705819 9:88952121-88952143 AGGCCTCGTCTCAGCTCCCAGGG - Intergenic
1056780709 9:89548131-89548153 CTGGCTATTCCCAGCTCCCACGG + Intergenic
1057082079 9:92180629-92180651 CTGCGTACTCGGAGCTCCCAAGG - Intergenic
1057366790 9:94430029-94430051 ATGCCTAGTCCCAGCTACTCGGG - Intronic
1058504331 9:105653287-105653309 ATGCGAACTCCCAGCCCACATGG - Intergenic
1059418892 9:114178915-114178937 ATGCCCACCCCAAGTTCCCATGG + Intronic
1060146299 9:121255360-121255382 ACGCCTACTCCCAGATACCCAGG - Intronic
1060212763 9:121720595-121720617 CTGCCCACTCCCTGCTCCCTGGG + Intronic
1061234377 9:129334153-129334175 ATGCCTGCTGCCAGCACCCAGGG + Intergenic
1061679871 9:132237691-132237713 ATACCTGCTCCCAGCTCCCTTGG - Intronic
1062339365 9:136087157-136087179 ATGCCGCCCTCCAGCTCCCAAGG - Intronic
1203411023 Un_KI270579v1:3334-3356 ATGCCTTCTACCAGCATCCATGG + Intergenic
1185963714 X:4576194-4576216 ATGAAAACTCCCAGCTGCCAAGG - Intergenic
1186153660 X:6703393-6703415 ATGTCTAATCCCAGCTCTCTGGG - Intergenic
1186204150 X:7183740-7183762 ATGCCTAATCCCAGCACTCTGGG + Intergenic
1189023782 X:37370547-37370569 CAGCCTGCTCCCAGCCCCCAAGG - Intronic
1189874700 X:45423618-45423640 ATGGCTCCACCCAGCTCCAAAGG + Intergenic
1190051874 X:47156632-47156654 AGGCCTCCTCCCAGTACCCATGG - Intronic
1190330514 X:49232390-49232412 AAGGCCACTCCCAGTTCCCATGG + Intronic
1192148074 X:68694936-68694958 ATGCTTACCCCCAAGTCCCAGGG + Intronic
1192460713 X:71314674-71314696 CTGCCTCCTCCCAGGTTCCAGGG - Intergenic
1194088219 X:89554991-89555013 TTGTCTACTGCCAGCTCTCAAGG + Intergenic
1197317189 X:124981624-124981646 ATGCCAAGTCCACGCTCCCATGG - Intergenic
1198030759 X:132751455-132751477 AGGGCTGCTCCTAGCTCCCAGGG + Intronic
1200801428 Y:7390587-7390609 ATGCCTAATCCCAGCTGCTTGGG + Intergenic