ID: 1094123286

View in Genome Browser
Species Human (GRCh38)
Location 12:26996636-26996658
Sequence CAATTTTACTACAGAGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 270}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094123285_1094123286 -10 Left 1094123285 12:26996623-26996645 CCAAAAATTAACTCAATTTTACT 0: 1
1: 1
2: 4
3: 42
4: 582
Right 1094123286 12:26996636-26996658 CAATTTTACTACAGAGAATTAGG 0: 1
1: 1
2: 2
3: 38
4: 270
1094123283_1094123286 -8 Left 1094123283 12:26996621-26996643 CCCCAAAAATTAACTCAATTTTA 0: 1
1: 0
2: 5
3: 73
4: 691
Right 1094123286 12:26996636-26996658 CAATTTTACTACAGAGAATTAGG 0: 1
1: 1
2: 2
3: 38
4: 270
1094123284_1094123286 -9 Left 1094123284 12:26996622-26996644 CCCAAAAATTAACTCAATTTTAC 0: 1
1: 0
2: 5
3: 67
4: 534
Right 1094123286 12:26996636-26996658 CAATTTTACTACAGAGAATTAGG 0: 1
1: 1
2: 2
3: 38
4: 270
1094123282_1094123286 -7 Left 1094123282 12:26996620-26996642 CCCCCAAAAATTAACTCAATTTT 0: 1
1: 0
2: 2
3: 48
4: 516
Right 1094123286 12:26996636-26996658 CAATTTTACTACAGAGAATTAGG 0: 1
1: 1
2: 2
3: 38
4: 270
1094123280_1094123286 30 Left 1094123280 12:26996583-26996605 CCAAATATTAATAGTGAAGTTTA 0: 1
1: 0
2: 2
3: 27
4: 347
Right 1094123286 12:26996636-26996658 CAATTTTACTACAGAGAATTAGG 0: 1
1: 1
2: 2
3: 38
4: 270
1094123281_1094123286 -6 Left 1094123281 12:26996619-26996641 CCCCCCAAAAATTAACTCAATTT 0: 1
1: 0
2: 1
3: 55
4: 578
Right 1094123286 12:26996636-26996658 CAATTTTACTACAGAGAATTAGG 0: 1
1: 1
2: 2
3: 38
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094123286 Original CRISPR CAATTTTACTACAGAGAATT AGG Intronic
902947813 1:19854987-19855009 CAATTAAATTGCAGAGAATTTGG - Intergenic
904367311 1:30022475-30022497 CTATTTTGCCAGAGAGAATTAGG - Intergenic
904571032 1:31465328-31465350 TACTTTTACTACGGAGATTTTGG - Intergenic
905593658 1:39187023-39187045 ATATTCTACTACAGAAAATTAGG + Intronic
905753757 1:40489385-40489407 CAACTTTACTACACATAGTTAGG + Intronic
906271849 1:44485488-44485510 AGATTTTACTACAGTGATTTCGG - Intronic
906815435 1:48873797-48873819 GAATTGGACCACAGAGAATTTGG + Intronic
907668609 1:56454482-56454504 CAACTTTTCTAGAGACAATTTGG + Intergenic
907932384 1:59012761-59012783 AAATTTTACTACAGTTAATTAGG - Intergenic
908285165 1:62589589-62589611 CAATTTAAGTACAAAGAGTTGGG + Intronic
909285553 1:73812315-73812337 GAATTTTATTACACAGACTTAGG - Intergenic
909542887 1:76810457-76810479 CTATATTACTACATAGAAATTGG - Intergenic
909817032 1:80007827-80007849 GAAATTTACTACAGATAAATAGG + Intergenic
910019690 1:82571533-82571555 TAATTTTCCTATATAGAATTTGG - Intergenic
910601272 1:89034821-89034843 CAATTTTTCACCAGAGAATAAGG + Intergenic
911170846 1:94769514-94769536 CAATTTAGCTACATAGAATGTGG - Intergenic
911526928 1:98999334-98999356 CAATTTTACAATAGAGAAAACGG + Intronic
915198083 1:154205354-154205376 CAATTTTTCTCCAGAGAATGAGG + Intronic
916289247 1:163146317-163146339 TAATTTTTCTAAAGACAATTTGG + Intronic
916930156 1:169569246-169569268 AAATTTTTGTATAGAGAATTTGG + Intronic
917552230 1:176044224-176044246 CAAATAAACTACAGTGAATTGGG + Intronic
918559709 1:185849957-185849979 AAATTTTTTTTCAGAGAATTTGG - Intronic
918864487 1:189877114-189877136 CAATTTTCTTACACTGAATTTGG - Intergenic
919512789 1:198487637-198487659 AAATTTTATTACAGAGCATGAGG - Intergenic
920000160 1:202792114-202792136 CAGTTCTACTACAGAAAACTGGG - Intronic
921348375 1:214210150-214210172 CAATTGTACTACATAAGATTAGG - Intergenic
921417681 1:214909736-214909758 CAATGTTACATCAGAGAATTTGG - Intergenic
922539943 1:226411005-226411027 CAAGTTGACTACAAAGCATTTGG - Intergenic
924026702 1:239841061-239841083 CAATTTTACAGCAGAGAGTCAGG - Intronic
924680502 1:246227113-246227135 CCATTTTACTACAAAGTATATGG - Intronic
1063359714 10:5441719-5441741 CAAGTTTAGTACTAAGAATTTGG - Intronic
1063714848 10:8516442-8516464 CATTATCATTACAGAGAATTAGG - Intergenic
1064176742 10:13081701-13081723 TACTTTTACTATAGAGACTTTGG - Intronic
1065116876 10:22491936-22491958 CATTTTTATTATAGATAATTTGG + Intergenic
1065225150 10:23536025-23536047 CAATTTTAATAGAGTAAATTTGG + Intergenic
1065685694 10:28282459-28282481 CAAATTTGCTACAGCAAATTAGG + Intronic
1068204140 10:53826915-53826937 CGATTTTAAACCAGAGAATTTGG + Intronic
1068652460 10:59537828-59537850 AAGTTTTACTGCAGAGAATGAGG + Intergenic
1069089147 10:64178163-64178185 AAATTTTACTACCAAGAACTAGG + Intergenic
1070278577 10:75031378-75031400 CAATATTAAAACAGATAATTTGG - Exonic
1071068319 10:81663170-81663192 CAATTTTACTAAATAGGATATGG - Intergenic
1071909097 10:90210869-90210891 CCACTTTACTTCAGGGAATTAGG - Intergenic
1072336755 10:94403959-94403981 AAATTTTACTACAAACATTTAGG + Intronic
1072372977 10:94784468-94784490 AAATTTTTCTACAGTGAATGTGG + Intronic
1072478654 10:95788295-95788317 CAAATTTACTAAAAAGAATATGG + Intronic
1073811918 10:107161537-107161559 CAGATTAACTACAGAGAATTAGG - Intronic
1074351578 10:112742749-112742771 CATTTATACTTCAGAGAATATGG + Intronic
1074732143 10:116390561-116390583 CAAGTTTACTATAGAGAGGTAGG - Intergenic
1074943291 10:118255575-118255597 TAATTTTATTTCAGAGATTTAGG - Intergenic
1075652657 10:124139456-124139478 GAATTTTAATATAGAGAACTAGG + Intergenic
1075789092 10:125070593-125070615 CAATTTTAATACGGAAAACTGGG + Intronic
1078077228 11:8173147-8173169 CAGTTATAGTACAGAGTATTTGG + Intergenic
1078621118 11:12909162-12909184 CATTGTTTCTACAGAGAATGAGG - Intronic
1078704634 11:13730360-13730382 AAGTTTTACTACAGAAAATCTGG - Exonic
1079634770 11:22722717-22722739 AAATTCTAATACAGAGTATTTGG + Intronic
1079862217 11:25687690-25687712 GGAGTTTACTACAAAGAATTTGG + Intergenic
1080907847 11:36564715-36564737 CAATTTTAAGACAGAGAAAGTGG + Intronic
1083791751 11:64990192-64990214 GAATTCTACCACAGGGAATTTGG - Intronic
1086537522 11:87866014-87866036 CAATTTTATAGAAGAGAATTCGG + Intergenic
1090158302 11:124464759-124464781 AAATCTTACTACAGAGAATATGG + Intergenic
1090502685 11:127276862-127276884 CATTTCTATAACAGAGAATTTGG - Intergenic
1091955724 12:4640363-4640385 CAATTTCACTATAAAAAATTAGG - Intronic
1093839987 12:23885813-23885835 GTATTTTACTAGAGAGAATGAGG - Intronic
1094123286 12:26996636-26996658 CAATTTTACTACAGAGAATTAGG + Intronic
1094336271 12:29358326-29358348 GAACTTTACTACAGATGATTTGG - Intronic
1094377295 12:29803478-29803500 CAATTTCACTAAAGATAATTTGG + Intergenic
1094614782 12:32026391-32026413 TACTTTTACTACAAAGACTTTGG - Intergenic
1095180193 12:39138343-39138365 GAATTTTACCAGAGAGAATCAGG + Intergenic
1095181867 12:39155138-39155160 CAATTTTATTTCAGACCATTGGG + Intergenic
1095755348 12:45759519-45759541 CAATTTTAAAACTGAGAATTTGG - Intronic
1095841901 12:46702421-46702443 CAGTTTTACTACAGAGGAGTAGG - Intergenic
1098965184 12:76780540-76780562 GAATTTTATTACAAAGAAGTTGG - Intronic
1099207869 12:79748718-79748740 CAATTACATTACAGAAAATTAGG + Intergenic
1099667740 12:85653540-85653562 CAATTCTACTGCAGAGGAATTGG + Intergenic
1099879017 12:88443666-88443688 CAATTTTTCTGCAGATATTTGGG + Intergenic
1101999685 12:109549212-109549234 TAATTTTTCTACAATGAATTTGG - Intergenic
1105556984 13:21456653-21456675 CATTTTAACTAGAGAGAATTTGG - Intronic
1105748031 13:23395360-23395382 TAATTTTACTAAGGATAATTTGG + Intronic
1107475283 13:40730055-40730077 CAATTTAACAACAGTGACTTTGG + Intronic
1108765732 13:53627064-53627086 CCATTTGACTACTGAGATTTGGG + Intergenic
1108887406 13:55204289-55204311 CAATTTTACAACTGCAAATTGGG + Intergenic
1109059913 13:57602385-57602407 TAATTTACCTACAGAGAAGTTGG + Intergenic
1110503350 13:76254779-76254801 AGATTTTGGTACAGAGAATTTGG - Intergenic
1110904774 13:80872779-80872801 CAATTTCACTACTGGGACTTAGG + Intergenic
1111034146 13:82648474-82648496 AAATTTTACTACATTGATTTAGG + Intergenic
1112029693 13:95445877-95445899 CAATTTGACTACAAAGTAGTTGG - Intronic
1112040632 13:95543774-95543796 CAATTTTTCTACAGATAGTTTGG - Intronic
1112139825 13:96626626-96626648 AAATTTTTCTACAGACAAATAGG - Intronic
1112424587 13:99286137-99286159 CAGATTTAGTACACAGAATTCGG - Intronic
1113095200 13:106655818-106655840 CAATTTTAACACATAGATTTGGG + Intergenic
1113263096 13:108587983-108588005 CAAGTTTACTGCAGAGTATCTGG + Intergenic
1115848443 14:37565423-37565445 AAAATTTACTACAGAGCAATCGG - Intergenic
1115877127 14:37873787-37873809 GATTTTTACTACAGTGGATTAGG - Intronic
1116733949 14:48664480-48664502 TAATTTTACTAAAAAGATTTTGG - Intergenic
1118667791 14:68089145-68089167 CATTAATACTCCAGAGAATTGGG - Intronic
1118712067 14:68527947-68527969 CACATTTACTAAAGAAAATTTGG - Intronic
1119874262 14:78043795-78043817 CAATTTTACTAGACAAAAATTGG + Intergenic
1120249695 14:82048158-82048180 CAGTATTTTTACAGAGAATTTGG - Intergenic
1121052481 14:90828509-90828531 CACTTTTACTAAAGAAAATGAGG - Intergenic
1121142258 14:91554096-91554118 CAATTTCTGTAGAGAGAATTGGG + Intergenic
1121593553 14:95139181-95139203 CAGTTATACTACAGAGGCTTGGG + Intronic
1121948184 14:98143393-98143415 CAAATATATTACAGAGAATTTGG + Intergenic
1122095973 14:99372653-99372675 CAATCTTACTTAGGAGAATTTGG + Intergenic
1122203139 14:100134638-100134660 CATGTTCACTGCAGAGAATTGGG - Intronic
1126486294 15:49185284-49185306 CCATTTTACTGCAAAGAATATGG + Intronic
1128049550 15:64651948-64651970 AAATTTTAGTACACAGAGTTGGG - Intronic
1129985550 15:79917149-79917171 TACTTCTACTACAGAGACTTTGG + Intronic
1133141773 16:3750238-3750260 CAACTAGACTAAAGAGAATTAGG + Intronic
1133632348 16:7632989-7633011 CTATTTTATTATGGAGAATTTGG - Intronic
1134337434 16:13313856-13313878 CAATTCTGCTATAGAAAATTGGG - Intergenic
1135603036 16:23799581-23799603 CAATTTTAGTAGAGAGAAACTGG - Intergenic
1138063850 16:53920103-53920125 GAATTTTGCTACTGAGATTTAGG - Intronic
1140277157 16:73520294-73520316 CAATTTTAATTTATAGAATTTGG - Intergenic
1148173709 17:45546453-45546475 CAATGTGGCTACAAAGAATTAGG - Intergenic
1148275560 17:46298995-46299017 CAATGTGGCTACAAAGAATTAGG + Intronic
1148297668 17:46516563-46516585 CAATGTGGCTACAAAGAATTAGG + Intronic
1148367407 17:47066614-47066636 TACTTTTACTATAGAGACTTTGG + Intergenic
1149119207 17:53141071-53141093 CAATTTTAACACAAAGAGTTAGG - Intergenic
1150404918 17:64893377-64893399 CAATGTGGCTACAAAGAATTAGG - Intronic
1150891439 17:69154779-69154801 CAACATTAATACAGAGAATCAGG + Intronic
1153011395 18:542897-542919 CAATTGTGCTACAGAGAATCTGG - Intergenic
1153900938 18:9615863-9615885 CCATTTTATTACACAGATTTAGG - Intergenic
1154020583 18:10661089-10661111 AAATTTTACTACATAAAATTGGG - Intergenic
1154963151 18:21329885-21329907 GAATTTGAATACAGAGAATCTGG - Intronic
1156974228 18:43197331-43197353 CAATTTCATGACAGAGGATTTGG - Intergenic
1158975467 18:62707584-62707606 CAATTTTACAACAGAGATATGGG + Intergenic
1159298971 18:66537502-66537524 CAATTTTACCCCAGAGAAATGGG - Intronic
1160498657 18:79391051-79391073 CAGTTCTACAACAGAGAATGGGG + Intergenic
1160712758 19:560238-560260 CAACTTTACTATACAGAATGGGG + Intergenic
1161647545 19:5462957-5462979 TAATTTTACTATAGTGAAATCGG + Intergenic
1165184275 19:34003445-34003467 CAGTTTTTCTACAGGAAATTAGG - Intergenic
925922806 2:8648449-8648471 CAATTTCACCAGAGAGAATTTGG - Intergenic
926066854 2:9847780-9847802 CATGTTTACTATAGAAAATTTGG + Intronic
926350887 2:11993382-11993404 AAATTTTGGTACTGAGAATTCGG + Intergenic
926740507 2:16106683-16106705 AAATCTAACTCCAGAGAATTTGG - Intergenic
926968949 2:18446854-18446876 TAATATTACTAAAGAGAATGAGG - Intergenic
930716354 2:54597292-54597314 CAACTTTACTACAGTGACTCAGG - Intronic
930730842 2:54725697-54725719 AAATTTTACTACTGGTAATTTGG + Intronic
933234176 2:79846461-79846483 CAGTTTTACTAATGAAAATTTGG + Intronic
933381502 2:81552438-81552460 GAACTATACTACACAGAATTTGG + Intergenic
935511463 2:103981191-103981213 GCATTTACCTACAGAGAATTTGG + Intergenic
936682165 2:114786556-114786578 AAATTTTACTTTAGAGAATCTGG - Intronic
937873868 2:126805407-126805429 TATTTTTAATACAGGGAATTAGG - Intergenic
939030529 2:137070525-137070547 AAATTTTAAAAAAGAGAATTTGG - Intronic
939705938 2:145453621-145453643 CAATTTTATTACAGAGAAGAGGG - Intergenic
939820950 2:146956273-146956295 CAATTTTTTTACAAAGAAATTGG + Intergenic
940558352 2:155261897-155261919 CAATTATGCCACAGAGTATTAGG + Intergenic
942002644 2:171664036-171664058 CATTTGTAGTACAGGGAATTTGG - Intergenic
942637490 2:178023514-178023536 AAATTTTACTATAAAGTATTGGG - Intronic
943776572 2:191772946-191772968 CAATTTTTCCACAGAGGAGTGGG - Intergenic
947116018 2:226771348-226771370 CAAAATTACTTCAGAGCATTCGG + Intronic
1169715508 20:8612467-8612489 GAATTTTACTACAGGGAGTTGGG - Intronic
1169820849 20:9708279-9708301 CTATGTTACTTCAGATAATTTGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1170970108 20:21107561-21107583 CAATTTAGCTGCAGAGGATTTGG - Intergenic
1171997400 20:31742486-31742508 CTTTTTTACTACAGAGAACTTGG + Intronic
1173904863 20:46619075-46619097 CAATTTGACTGCAAGGAATTTGG - Intronic
1174045654 20:47730781-47730803 CAATTTTACTACACTGCCTTTGG - Intronic
1175736504 20:61390937-61390959 CAAAATTATTTCAGAGAATTTGG - Intronic
1176956715 21:15113382-15113404 CATCTGTACTACAGAGACTTTGG + Intergenic
1177472779 21:21580252-21580274 ATAATTTACTACAGAGAATTTGG + Intergenic
1177637003 21:23800856-23800878 CAATTTTACTACAGAAAATTCGG + Intergenic
1178446970 21:32654083-32654105 CAGTCTTATTACAGAAAATTTGG + Intronic
1181377979 22:22475679-22475701 CAAGTTTACTACATAAAATCTGG + Intergenic
1182349574 22:29691785-29691807 CAGTTTTTCTACAGAGAGCTTGG - Intronic
1183837409 22:40466636-40466658 TAATTTTATTTCAGAGAATAAGG + Intronic
949797891 3:7870667-7870689 CAAAATTACCACAGAGAATTAGG - Intergenic
949963127 3:9331131-9331153 CAATTTTTCTGCAAAGAATGTGG + Intronic
949985574 3:9538037-9538059 CAAGTTTCTTACAGATAATTGGG - Intronic
951455353 3:22886114-22886136 CACTTTTCCTTCAGAGAATTAGG + Intergenic
952372454 3:32736471-32736493 CATATTTACTATAGAAAATTTGG + Intronic
953171590 3:40512173-40512195 CAAGTTTTCTTCAGAGAACTTGG - Intronic
954505946 3:51073163-51073185 TAATGTGACTACAGAAAATTTGG + Intronic
955689429 3:61576459-61576481 CAGTTTTTCTACAGAGGAATTGG + Intronic
955878177 3:63515710-63515732 CAAAATTATTATAGAGAATTTGG + Intronic
958728477 3:97935012-97935034 CAATTCTCTTAAAGAGAATTTGG - Intronic
959192063 3:103126468-103126490 CAATTTTACTTCAAAGATATTGG - Intergenic
959589188 3:108058057-108058079 CTATTTTGATACAGAGAGTTTGG + Intronic
960111816 3:113852082-113852104 AAATTTTTCTACTGAGAAGTGGG + Intronic
960209239 3:114939532-114939554 AAATTTTAATAAAGAAAATTTGG - Intronic
960626214 3:119684772-119684794 CAATTACACTAAAGAAAATTTGG + Intergenic
961316833 3:126042915-126042937 CAATTGTAATACATACAATTTGG + Intronic
961980261 3:131070089-131070111 AAAATTTACCACAGATAATTTGG - Intronic
965569855 3:170161404-170161426 CAATTTTTCCACAGAGAAGGTGG + Intronic
966086251 3:176070239-176070261 CAGTTTTATTACAAAGTATTTGG - Intergenic
966576873 3:181511978-181512000 CTATTTTACCACAGTGTATTTGG - Intergenic
969580804 4:8063793-8063815 GAATTATAGTACAGAGAATGGGG - Intronic
970269221 4:14325594-14325616 CAATATTACAAGACAGAATTTGG - Intergenic
970971004 4:21983924-21983946 CAATTCTACTCCAAATAATTTGG - Intergenic
971632265 4:29008638-29008660 CAAATTTAGTTTAGAGAATTGGG - Intergenic
973210210 4:47607012-47607034 CAATTTTGTTACAAATAATTTGG - Intronic
973879031 4:55250120-55250142 GAATTTGACTACAGATAATTTGG + Intergenic
974211613 4:58783941-58783963 TAATTTTACTAAAGAGCATTTGG + Intergenic
975742105 4:77439438-77439460 CAATTTTAATACAATGAATGAGG - Intergenic
975890849 4:79025128-79025150 CAATTTTATTACAGAGAAATGGG + Intergenic
976014237 4:80531450-80531472 CAATTTCACTCCAGGGAACTAGG + Intronic
976101949 4:81573873-81573895 AAATTTTACTCCAGACTATTAGG - Intronic
976260168 4:83137848-83137870 CATTTTTATTTCTGAGAATTTGG - Intergenic
977221989 4:94348576-94348598 CAATTTTACTACATATACTTTGG + Intergenic
977253953 4:94719728-94719750 CAATTTTACATCAGATTATTTGG - Intergenic
977564235 4:98565609-98565631 CAAATTTAATACAGAGCAATGGG - Intronic
981510142 4:145547576-145547598 CAAGTTTACTAAAAAGAGTTCGG - Intronic
982567611 4:157005792-157005814 CATTTTTACTACAGTTTATTGGG - Intergenic
984593142 4:181638642-181638664 CATTTTTACTACAGAGAAAATGG - Intergenic
984746778 4:183228574-183228596 CAAATTCACTACAGAGAATGTGG - Intronic
984831685 4:183981490-183981512 CAATTTTATTACACAGCATTTGG - Intronic
984941738 4:184938798-184938820 CAATTTTTCCACAGACAATGGGG + Intergenic
985168268 4:187121162-187121184 CATTTTTGCTAAAGAGAATATGG - Intergenic
985700344 5:1368049-1368071 CATTTTTCCAACAGATAATTGGG - Intergenic
987477559 5:18410224-18410246 AAATTTTACTTCACAGAATATGG + Intergenic
990128260 5:52546507-52546529 CAATTCTATTACAGTGAATCAGG + Intergenic
992073491 5:73170288-73170310 TTATTTTAATAGAGAGAATTTGG + Intergenic
992288898 5:75264375-75264397 AAGTTTTACTACAAATAATTGGG - Intergenic
992296249 5:75329781-75329803 CAATTTTACTATCAAGATTTTGG - Intergenic
993448877 5:88049032-88049054 CAGTTTTACTACTGAGAATTTGG + Intergenic
993760470 5:91789904-91789926 CATTTTTCTTACAGAGCATTTGG + Intergenic
994996702 5:107072768-107072790 TAATTTCAATACAGAGAATAGGG + Intergenic
995366224 5:111364384-111364406 CAAAGTTAATACAAAGAATTTGG - Intronic
995786697 5:115838609-115838631 AAAGTTTATTACAGAAAATTTGG - Intronic
1000155136 5:158543035-158543057 CAATTTAACTACAGAATATAAGG + Intergenic
1000486722 5:161854787-161854809 AAATTGTATTACAGAAAATTAGG - Intronic
1004450391 6:15739802-15739824 CGATTTTACTAAAGATAATGTGG + Intergenic
1005340157 6:24836210-24836232 CAATTTAATTCCAGAAAATTTGG - Intronic
1005721769 6:28609271-28609293 AAAACTTACTATAGAGAATTTGG + Intronic
1006217669 6:32459367-32459389 CACTTTTATTTCAGAGATTTCGG + Intergenic
1006237309 6:32645308-32645330 CAATTTTTCCACAGATAGTTGGG + Intronic
1007770689 6:44189641-44189663 CATTTTTACTGCAAAGAATGAGG + Intergenic
1007789103 6:44298740-44298762 AATTTTTACTAGACAGAATTTGG + Intronic
1007952020 6:45880955-45880977 TAATTTTACTAGAGGGAATGGGG + Intergenic
1008312857 6:49998480-49998502 TATTTTTAATATAGAGAATTTGG - Intergenic
1008429567 6:51399684-51399706 CAATTTTACGACACAAAAGTAGG - Intergenic
1009344316 6:62595239-62595261 TAATTTTTCTTCAGAGACTTGGG + Intergenic
1010161462 6:72861687-72861709 CAAAATTACAACAGACAATTTGG - Intronic
1010457489 6:76074772-76074794 CATTTTTTCTACATATAATTAGG - Intergenic
1012004628 6:93697163-93697185 CAATTTTAAAAGAAAGAATTAGG + Intergenic
1012029037 6:94035278-94035300 TAATTTTACTGAAGAAAATTTGG + Intergenic
1012124201 6:95406666-95406688 AAGTTTTTCTACTGAGAATTTGG + Intergenic
1012133637 6:95527549-95527571 CAATTTTCCTACAGGTAAGTTGG - Intergenic
1012874923 6:104714838-104714860 CAATTATACTATAGAGAATGAGG + Intergenic
1013858063 6:114598987-114599009 CAAAATTACTACAGAAAAATAGG - Intergenic
1014369630 6:120588201-120588223 CAATTTTTCTACACAGTATTTGG - Intergenic
1014512310 6:122338802-122338824 CAAATTTACTAGGGACAATTGGG + Intergenic
1015513292 6:134060478-134060500 GAAATTTAGCACAGAGAATTGGG + Intergenic
1015697266 6:135994842-135994864 AAATATTACTACAGAAAATGTGG + Intronic
1016473665 6:144402598-144402620 CAATCTTACTACAGGAAAATGGG + Intronic
1016725768 6:147365285-147365307 AAATTTTACTTCAGAAACTTAGG - Intronic
1017288609 6:152708571-152708593 TAATTATAATACAAAGAATTGGG - Intronic
1019113356 6:169736756-169736778 CATTTTAACTTCAGAGAATCTGG + Intergenic
1020611079 7:10398998-10399020 CATTTTTACTACAGAAATTGAGG + Intergenic
1022921146 7:35016084-35016106 CCTTTTTACTGAAGAGAATTAGG - Intronic
1023218326 7:37890263-37890285 CTGTTTTATTACAGTGAATTTGG - Intronic
1023300104 7:38761047-38761069 AAATTTTACTTCAGAAATTTGGG + Intronic
1024083010 7:45871788-45871810 CATTTTTATTACTGAGAATGAGG - Intergenic
1024350885 7:48362109-48362131 CTATTTTAGGGCAGAGAATTTGG + Intronic
1027598566 7:80209208-80209230 CAACTTTAGTGCAGAGAATGAGG - Intronic
1028224371 7:88232798-88232820 CAATTTTACTCGTCAGAATTAGG - Intergenic
1028422435 7:90648643-90648665 CAATTCTCCTCCACAGAATTGGG - Intronic
1028620749 7:92825574-92825596 TAATTTGTGTACAGAGAATTTGG - Intronic
1030322736 7:108186455-108186477 CCATTGTACTACAGAGAGTGTGG - Intronic
1031485167 7:122316166-122316188 CGATTTTACTACCCAGATTTGGG - Intergenic
1031892666 7:127313035-127313057 AAATTATACTACAGAGATATAGG + Intergenic
1033384356 7:140857176-140857198 GAATTTTACTATAGATGATTAGG + Intronic
1034048488 7:147956158-147956180 GAATTTTACAACATAGAATTTGG + Intronic
1037156651 8:15708653-15708675 CAGTTTTTAAACAGAGAATTGGG + Intronic
1038212427 8:25531978-25532000 CATTTTTACTAGAGTGAATTGGG - Intergenic
1039286545 8:36047859-36047881 CAAGTTGACTAAAGAGAAGTAGG + Intergenic
1042147824 8:65750395-65750417 CAATTTTATTACTGGCAATTAGG + Intronic
1042274641 8:66991542-66991564 CAATTTTACTGGGGAGAAGTGGG + Intronic
1042401670 8:68355908-68355930 CAATTATACTACAGAGAAACAGG - Intronic
1042447001 8:68896549-68896571 TAATTTTACTTCACAGCATTTGG + Intergenic
1042455242 8:68994217-68994239 CAAATTTATCACAGAGAATGAGG - Intergenic
1042660297 8:71147664-71147686 CAATTTTACTACAAAAAGTATGG - Intergenic
1042707930 8:71681219-71681241 CAATTTTTCAACAGAGAGGTTGG - Intergenic
1042954248 8:74231752-74231774 CAGTTTTACATCAGATAATTGGG - Intergenic
1043600639 8:81933547-81933569 AAATTATACTACAGAGCAATGGG + Intergenic
1045182423 8:99798856-99798878 GAATTTTAATACAGAGTACTTGG + Intronic
1046362653 8:113183171-113183193 AAATTTTACCACAGAGAATGTGG - Intronic
1046702067 8:117412671-117412693 CAATTGTATTTCACAGAATTTGG + Intergenic
1048325206 8:133433848-133433870 GAAATTTAATCCAGAGAATTAGG + Intergenic
1050043099 9:1515964-1515986 CATTTTAACTGCAGAGTATTGGG + Intergenic
1050829750 9:9996333-9996355 CAATATTACCATAGTGAATTAGG + Intronic
1051561484 9:18446268-18446290 ATATCTTCCTACAGAGAATTTGG - Intergenic
1051751221 9:20343415-20343437 CAATCTTAATACAGACAAATAGG - Exonic
1052086221 9:24269325-24269347 CAATTTGAAGGCAGAGAATTTGG - Intergenic
1052401322 9:28003778-28003800 CAATTTTACCACAGACCAATTGG - Intronic
1053330111 9:37197836-37197858 CAATTTCACTTCAGAATATTTGG - Intronic
1056739268 9:89239175-89239197 CAATGTTAGTAAAGAGAATGGGG - Intergenic
1060427394 9:123517945-123517967 CATTTTTAATGCAGAAAATTTGG - Intronic
1061562148 9:131411790-131411812 CAGTTTTACTTTACAGAATTTGG + Intronic
1061736744 9:132666481-132666503 CAAATTTATTATAGAAAATTAGG - Intronic
1186315709 X:8367755-8367777 CAATTCTATTTCAGAGAATTTGG + Intergenic
1186362727 X:8859416-8859438 CATTTTTATTTCATAGAATTTGG + Intergenic
1187036111 X:15541706-15541728 CAACTTTCCTACAGAGAATCAGG - Intronic
1188682998 X:33034582-33034604 CAACTTTAAAACATAGAATTTGG + Intronic
1188765549 X:34087369-34087391 CACTTTGACTACAGAAAATTAGG + Intergenic
1188823687 X:34804113-34804135 CAACTTCACTACTGGGAATTTGG + Intergenic
1189830704 X:44970022-44970044 GGATTTTACTAGAGAGACTTTGG + Intronic
1190106992 X:47568083-47568105 CAATTATGTTACAGAGAATAAGG + Intronic
1191645182 X:63472296-63472318 CAATTTTATTATAGATATTTGGG - Intergenic
1191912999 X:66171721-66171743 GAATATTACTACAAAGTATTAGG - Intronic
1192461516 X:71321168-71321190 AAATTTTACAACAGATAAGTAGG - Intergenic
1195235328 X:102891144-102891166 AAATTATACTACAGAGAAATTGG - Intergenic
1195739329 X:108046675-108046697 CAATTTTACCACTCAGATTTGGG + Intronic
1195991295 X:110685101-110685123 CATATTTACTATAGAAAATTTGG + Intronic
1198191244 X:134308833-134308855 CACTCTTACTACAGAGAAGCAGG - Intergenic
1198825471 X:140694016-140694038 CAACTTTTCTGCTGAGAATTTGG - Intergenic
1198920835 X:141724543-141724565 CAATTTGAATACAGATTATTAGG - Intergenic
1199165660 X:144672159-144672181 CAATTTAACAGCAGAAAATTTGG + Intergenic
1199435077 X:147804045-147804067 GACTTTTACTACAGAGAAAAAGG - Intergenic
1201645412 Y:16224405-16224427 TAATTTTACTAAACAGAACTAGG - Intergenic
1201657401 Y:16360907-16360929 TAATTTTACTAAACAGAACTAGG + Intergenic
1202019705 Y:20451734-20451756 CCATATTACTACAGATAAATAGG - Intergenic