ID: 1094126699

View in Genome Browser
Species Human (GRCh38)
Location 12:27031212-27031234
Sequence AAGGATACTCCCATTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094126699_1094126701 5 Left 1094126699 12:27031212-27031234 CCAATTTCAATGGGAGTATCCTT 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1094126701 12:27031240-27031262 TCATTCCTGACCTGTGATATTGG 0: 1
1: 0
2: 1
3: 20
4: 226
1094126699_1094126705 28 Left 1094126699 12:27031212-27031234 CCAATTTCAATGGGAGTATCCTT 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1094126705 12:27031263-27031285 CCATTAGAGCCTTTCAAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094126699 Original CRISPR AAGGATACTCCCATTGAAAT TGG (reversed) Intronic
904107172 1:28095338-28095360 AAGGAAACACATATTGAAATAGG + Intergenic
904780544 1:32943622-32943644 AAAGAAATTCCCATTTAAATGGG + Intronic
906752032 1:48273191-48273213 AAGGAAAATCTCCTTGAAATTGG - Intergenic
908656369 1:66393555-66393577 AAGGAGTCTGCCATTGAAAAAGG + Intergenic
910310523 1:85818855-85818877 CAGGATAATCCCACTAAAATGGG + Intronic
912771558 1:112468628-112468650 AATAATAATCCCATTAAAATGGG - Intronic
914743391 1:150483624-150483646 AAGTATACTCCCTTTAAAACAGG - Intergenic
915237284 1:154493273-154493295 AAGGTTACTCCCCTTGAAGAGGG - Intronic
915890350 1:159767713-159767735 ATGGATACTCCCATTTAAAAGGG + Intergenic
917642781 1:176998879-176998901 AAGGTTACACCCATAGAAAGTGG - Intronic
919040572 1:192382675-192382697 AAGGCTAATCACATTGAAGTAGG + Intergenic
919378238 1:196820341-196820363 AAGGATAATTCAATTGAAATGGG - Intronic
919387933 1:196944377-196944399 AAGGATAATTCGATTGAAATGGG - Intronic
920508174 1:206531646-206531668 AAGGAGAATCCCCTTGAAAAGGG + Intronic
921498223 1:215867044-215867066 AAGGACACTCGCAGTGAGATTGG + Exonic
921901016 1:220450912-220450934 TGAGATACTCCCACTGAAATGGG - Intergenic
1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG + Intergenic
1063787247 10:9399907-9399929 AAGTAGACGCCCAGTGAAATGGG - Intergenic
1068437535 10:57011986-57012008 AATGATGCTTCCATTGATATGGG - Intergenic
1070330791 10:75415523-75415545 ACTGATTCTCCCTTTGAAATGGG + Intergenic
1075494747 10:122910225-122910247 AAGCACACTTCCATTGACATGGG - Intergenic
1076084127 10:127610284-127610306 GAGGATACTCCCATAGAAGAGGG + Intergenic
1082645234 11:55715528-55715550 AAGGATAGTCCCATGGAAAATGG - Intergenic
1082646050 11:55726959-55726981 AAGGATAGTCCCATGGAAAATGG - Intergenic
1084502653 11:69544087-69544109 CAGGGTTCTCCCATGGAAATAGG - Intergenic
1085231715 11:74977425-74977447 AAGGAAACACATATTGAAATAGG - Exonic
1086500458 11:87447565-87447587 AAGGAGAACCCCATTTAAATTGG + Intergenic
1090208580 11:124899338-124899360 AAGGATACACCCACAGAATTTGG - Intergenic
1094126699 12:27031212-27031234 AAGGATACTCCCATTGAAATTGG - Intronic
1110804581 13:79739257-79739279 AATGTTAATCCCATTAAAATGGG + Intergenic
1115726946 14:36227464-36227486 AAGTATTCTCCCATAGATATGGG - Intergenic
1121583459 14:95047298-95047320 AAGGATATTGCCTTTTAAATGGG - Intergenic
1122407541 14:101509239-101509261 AAGCATACAGCCATGGAAATGGG + Intergenic
1123859246 15:24446644-24446666 AAGGATAGTTTCATTTAAATTGG + Intergenic
1124883763 15:33665125-33665147 CAGAATACGCCCAGTGAAATAGG - Intronic
1126177101 15:45745896-45745918 CAGGAAACTCCCAAAGAAATTGG + Intergenic
1126853496 15:52814328-52814350 AAAGACAGTCACATTGAAATAGG + Intergenic
1130626464 15:85520679-85520701 AAGCAGCCTCCTATTGAAATAGG + Intronic
1132037596 15:98499994-98500016 AAGCATACTGACATTGACATAGG - Intronic
1140611127 16:76600359-76600381 AATGATTCCCCCATTTAAATAGG - Intronic
1148517245 17:48231606-48231628 AAGGGTTGTCCCATAGAAATAGG + Intronic
1154963102 18:21329498-21329520 AAAGATACTCCTTTTGAACTTGG + Intronic
1155094250 18:22540868-22540890 CAGGATAATCCCATTAAAATGGG + Intergenic
1159577363 18:70195880-70195902 AGTGAAACTCCCAATGAAATAGG + Intronic
1166505406 19:43368450-43368472 AAGGATACTTCAATAAAAATGGG - Intergenic
929705429 2:44207165-44207187 AACTTTACTCCCATTGAATTAGG + Intronic
930594778 2:53373649-53373671 AAGCATACTTACATAGAAATTGG + Intergenic
933078432 2:77957951-77957973 AATGAAATTCCTATTGAAATAGG + Intergenic
933876984 2:86629876-86629898 ATAGATCCTCCCAGTGAAATGGG - Intronic
935577188 2:104723238-104723260 AGGGATGCTGCCAATGAAATGGG + Intergenic
936804152 2:116305884-116305906 AAGGATGCTCACATTACAATTGG + Intergenic
938666668 2:133545831-133545853 AAGCATAATCCCAATGACATTGG + Intronic
939117229 2:138074328-138074350 AAGGATAATAGAATTGAAATGGG + Intergenic
939595873 2:144121550-144121572 AAAGACACTACCATTGCAATGGG + Intronic
940456529 2:153908625-153908647 AAGCACACTCCCATTGAATAGGG + Intronic
941369874 2:164651764-164651786 AAGAATAGCCCCATTGAAATGGG - Intergenic
944591810 2:201224964-201224986 GAGGATACACTCATTGAAAAAGG - Intronic
1168842682 20:919791-919813 AGGCCTACTCCCATTGAAGTGGG - Intergenic
1169724291 20:8712604-8712626 AAGATTACTTCCATTGAATTTGG - Intronic
1170992009 20:21311431-21311453 AATGATACTCCCATTGTATATGG + Intronic
1177553357 21:22655303-22655325 AAAGAAAATCCAATTGAAATGGG - Intergenic
1178175877 21:30097738-30097760 AAGGAAACAGCCATTGAAAGAGG + Intergenic
1179330989 21:40401374-40401396 AAGGATATTCTCAATAAAATTGG + Intronic
1182085989 22:27561545-27561567 CAAGAGACTGCCATTGAAATTGG + Intergenic
949653976 3:6195003-6195025 ATGCATACTCATATTGAAATAGG - Intergenic
950417223 3:12875586-12875608 AAGAAAACTCCCATAGAGATAGG - Intergenic
953843621 3:46409595-46409617 AAAGTTACTCCCATATAAATGGG - Intronic
960133131 3:114078614-114078636 AAGGATACTCAACTTGTAATAGG - Intronic
960293498 3:115914955-115914977 AAGAATAATCACATTGAAAGAGG + Intronic
960466446 3:118001631-118001653 AAGGAGACTCCAAATGAAAGAGG - Intergenic
960775216 3:121242963-121242985 AAGAATGGTCACATTGAAATGGG + Intronic
962128409 3:132647186-132647208 AATGATCCTCCCATGCAAATGGG - Intronic
963802842 3:149694485-149694507 AATAATAATCCAATTGAAATGGG + Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967550092 3:190782651-190782673 GAGGATACTCACATTCAAACTGG - Intergenic
969115999 4:4871265-4871287 AAGGAATCTCCCATTGAGAGGGG + Intergenic
970094141 4:12443495-12443517 AAGGATACTTCACTTGAATTGGG - Intergenic
972274624 4:37545531-37545553 AAGGATTCTACCATCTAAATTGG + Intronic
974674376 4:65071575-65071597 ATGAATACTCCCATTCAAAAGGG + Intergenic
979204224 4:118015975-118015997 AAGGATATTCCCATTTACACTGG + Intergenic
981216296 4:142172891-142172913 AAGGATGCACACATTGAAAGTGG + Intronic
981863844 4:149389887-149389909 AAGAATCCTCCAATTCAAATGGG + Intergenic
981962843 4:150562409-150562431 AAGTATACTCTCATTGCTATGGG + Intronic
982419276 4:155175903-155175925 AAAGATCATGCCATTGAAATGGG + Intergenic
983617196 4:169720577-169720599 AAGGATACACCGATTTAAAGAGG - Intronic
986036596 5:3946645-3946667 AAGGATAGTTACATTGAATTAGG + Intergenic
987477664 5:18411540-18411562 AAGAAGACTACCTTTGAAATTGG + Intergenic
988733507 5:33997108-33997130 AAGGAAACTGCCGTTGAACTTGG - Intronic
988960261 5:36363877-36363899 ATGGGTACTCCCATTCAAAAAGG + Intergenic
991726885 5:69544669-69544691 ATGGCTACTCCCCTTTAAATTGG + Intronic
991868072 5:71083205-71083227 ATGGCTACTCCCCTTTAAATTGG - Intergenic
993450703 5:88069680-88069702 AAGGAGGCTCCCATGGAAAGTGG + Intergenic
995691969 5:114837041-114837063 AAGGAAAGTCCCATTTAAAATGG + Intergenic
998763524 5:145458719-145458741 AATTATACTCCAATTGTAATAGG + Intergenic
1001761309 5:174210414-174210436 AAGGAAACTCCAACTGAGATTGG - Intronic
1004636034 6:17468714-17468736 AAGGATTCTCACATGGAAAATGG + Intronic
1013055043 6:106575146-106575168 AAGGTTACTCACAGTGAAGTAGG + Intronic
1013336681 6:109170154-109170176 AAATATAATCCCATTGTAATGGG + Intergenic
1016257008 6:142119317-142119339 CAGGATACCCCCATCTAAATAGG + Intergenic
1017858613 6:158374658-158374680 AAGGATACTGCTATTGGAAAAGG - Intronic
1021831749 7:24619168-24619190 AAGAATACTCCCATTAAAAAAGG - Intronic
1023081022 7:36526401-36526423 AAGGATCTTCCCTTTGACATTGG - Intronic
1023360872 7:39414227-39414249 AAGGAAACCCCCATTGGAAGAGG - Intronic
1024291199 7:47805774-47805796 AAGGTCACTCACATTGATATAGG - Intronic
1024780198 7:52838875-52838897 AAGGGTACTGCCAGAGAAATAGG - Intergenic
1024912527 7:54462173-54462195 AAGTATTCAGCCATTGAAATGGG - Intergenic
1026321270 7:69269376-69269398 AAGGAAACTCTCACTGAGATGGG - Intergenic
1028415359 7:90574657-90574679 AAGGAAACTGTCATTCAAATGGG + Intronic
1031034050 7:116767556-116767578 AAAGATACTCCCCCTGAAGTAGG - Intronic
1031396334 7:121278734-121278756 TAGGGTACTCCCTTTGAAACAGG - Intronic
1032347080 7:131126343-131126365 AAGGATAGTACCATTGAATGGGG + Intronic
1032668067 7:134057113-134057135 AAGGATAGTGCCATTGACAAAGG + Intronic
1033390355 7:140922198-140922220 AAGGATACTCTCATTTTACTTGG - Intronic
1035007804 7:155681731-155681753 AAAGCTACTCCCATTGCAAATGG - Intronic
1036125580 8:6058924-6058946 AAGGATACCCCCTTTCAAAGAGG + Intergenic
1037293632 8:17378085-17378107 TAGAATACTACCATTGAGATGGG + Intronic
1040996065 8:53403941-53403963 AAGGATTCTGACATTTAAATTGG - Intergenic
1045846936 8:106648334-106648356 AAGAATAGTCCCCTTAAAATAGG + Intronic
1047044707 8:121039020-121039042 AAGTCTACTCCCATTGCAAATGG + Intergenic
1058110026 9:101022461-101022483 CATGATACTCCTATTAAAATGGG - Intergenic
1058489448 9:105481022-105481044 AAGAATACAGCCATTGAAATTGG - Intronic
1060338479 9:122750596-122750618 AATAATACTCCCATAGAAAAGGG - Exonic
1060852881 9:126891668-126891690 ATGAATACTCCCATTTAAAAGGG + Intergenic
1185885349 X:3777432-3777454 AAGTATAATCCCATTGACACTGG - Intergenic
1186088360 X:6016055-6016077 AAAGATAATCCAATTAAAATAGG + Intronic
1189595418 X:42559837-42559859 AAGGATACTGACCTTGAGATGGG - Intergenic
1194163305 X:90483035-90483057 AAGTCAACTGCCATTGAAATGGG + Intergenic
1196356269 X:114797032-114797054 AAGGTTAGTTTCATTGAAATTGG + Intronic
1197704151 X:129622019-129622041 AAGCATGCTCCCATTGACATAGG - Intergenic
1200509575 Y:4060760-4060782 AAGTCAACTGCCATTGAAATGGG + Intergenic