ID: 1094126771

View in Genome Browser
Species Human (GRCh38)
Location 12:27031917-27031939
Sequence GCCCCACTTGGAAAGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 384}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094126766_1094126771 -2 Left 1094126766 12:27031896-27031918 CCAAGGCGTGCGTACCCCTTGGC 0: 1
1: 0
2: 0
3: 0
4: 51
Right 1094126771 12:27031917-27031939 GCCCCACTTGGAAAGCTGTGTGG 0: 1
1: 0
2: 2
3: 24
4: 384
1094126764_1094126771 7 Left 1094126764 12:27031887-27031909 CCAGGTCAGCCAAGGCGTGCGTA 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1094126771 12:27031917-27031939 GCCCCACTTGGAAAGCTGTGTGG 0: 1
1: 0
2: 2
3: 24
4: 384
1094126762_1094126771 17 Left 1094126762 12:27031877-27031899 CCAGTTAAGTCCAGGTCAGCCAA 0: 1
1: 0
2: 2
3: 9
4: 78
Right 1094126771 12:27031917-27031939 GCCCCACTTGGAAAGCTGTGTGG 0: 1
1: 0
2: 2
3: 24
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094126771 Original CRISPR GCCCCACTTGGAAAGCTGTG TGG Intronic