ID: 1094126771

View in Genome Browser
Species Human (GRCh38)
Location 12:27031917-27031939
Sequence GCCCCACTTGGAAAGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 384}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094126764_1094126771 7 Left 1094126764 12:27031887-27031909 CCAGGTCAGCCAAGGCGTGCGTA 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1094126771 12:27031917-27031939 GCCCCACTTGGAAAGCTGTGTGG 0: 1
1: 0
2: 2
3: 24
4: 384
1094126762_1094126771 17 Left 1094126762 12:27031877-27031899 CCAGTTAAGTCCAGGTCAGCCAA 0: 1
1: 0
2: 2
3: 9
4: 78
Right 1094126771 12:27031917-27031939 GCCCCACTTGGAAAGCTGTGTGG 0: 1
1: 0
2: 2
3: 24
4: 384
1094126766_1094126771 -2 Left 1094126766 12:27031896-27031918 CCAAGGCGTGCGTACCCCTTGGC 0: 1
1: 0
2: 0
3: 0
4: 51
Right 1094126771 12:27031917-27031939 GCCCCACTTGGAAAGCTGTGTGG 0: 1
1: 0
2: 2
3: 24
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094126771 Original CRISPR GCCCCACTTGGAAAGCTGTG TGG Intronic
900700449 1:4045462-4045484 GCCCCTCTTGGAAAGCTGCCTGG + Intergenic
900852322 1:5153782-5153804 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
905212830 1:36386002-36386024 GCCCCAATCCGAAAGCCGTGGGG - Intergenic
905313990 1:37069493-37069515 GCCCCATTTGGAACTCTGTGAGG - Intergenic
905496243 1:38390131-38390153 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
906463812 1:46058342-46058364 GCCCCAGTAGGAACTCTGTGTGG - Intronic
907320879 1:53601586-53601608 GCCTCCCTTGGACAGCAGTGGGG - Intronic
907343999 1:53759139-53759161 GCCCCACTAGGGACTCTGTGTGG + Intergenic
907632122 1:56093094-56093116 GCCCCATTTGGGAAGCTGCATGG - Intergenic
907673471 1:56497350-56497372 GTGCCACTTGCAAAGGTGTGAGG + Intronic
908729234 1:67208764-67208786 GCCCCACTAGGGACTCTGTGTGG - Intronic
908885216 1:68780994-68781016 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
909250267 1:73344442-73344464 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
909257239 1:73439306-73439328 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
909274440 1:73666386-73666408 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
909500378 1:76328541-76328563 GCCCCATTTTAAAAGCAGTGTGG + Intronic
910409364 1:86924414-86924436 GCCCCAGTAGGGAATCTGTGTGG + Intronic
911082783 1:93949968-93949990 GCCCCAGTTGGGACTCTGTGGGG + Intergenic
911515759 1:98866430-98866452 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
912488839 1:110050065-110050087 GCCCCACATTGATTGCTGTGGGG + Intronic
912861122 1:113214826-113214848 GACCCAGTGGGGAAGCTGTGTGG + Intergenic
912907055 1:113718480-113718502 GCCCCAGTAGGGACGCTGTGTGG + Intronic
913336961 1:117717397-117717419 GCCCCACTAGGGACTCTGTGTGG - Intergenic
914857427 1:151362865-151362887 GCCCCACTGGGGACTCTGTGTGG - Intergenic
915058405 1:153158639-153158661 GCCCCAGTTGGGACACTGTGTGG + Intergenic
919262026 1:195208574-195208596 GCCCCAATGGGGAATCTGTGTGG - Intergenic
919366651 1:196669762-196669784 GCCCCACTGGGACCTCTGTGTGG - Intronic
921013573 1:211166783-211166805 GCAACACTTGGAATGCTGCGTGG + Intergenic
923126170 1:231036487-231036509 GGCCCACTTGGAAAGCTTCAAGG - Intronic
924241459 1:242045029-242045051 GCCCCAGTGGGAAGCCTGTGTGG - Intergenic
1062801680 10:385737-385759 GCACCACCTGGCAGGCTGTGTGG + Intronic
1063256090 10:4329033-4329055 GCTCCACTTTGAATGCAGTGTGG + Intergenic
1063310245 10:4945444-4945466 GCCCCAGTGGGAACTCTGTGTGG - Intronic
1065373345 10:25012296-25012318 GCCCCAGTGGGAATTCTGTGTGG - Intronic
1067266436 10:44749389-44749411 GCCCCACTTGGACAGTTTTGTGG - Intergenic
1068235826 10:54231503-54231525 GCCCCAGTGGGAACTCTGTGTGG - Intronic
1068580153 10:58730509-58730531 GCCCCAGTTGGGACTCTGTGTGG + Intronic
1068934038 10:62618855-62618877 GCCACACTGGGAAAGCTGAGTGG - Intronic
1069671455 10:70208378-70208400 GCCCCAGTTGGAGTGCAGTGGGG + Intronic
1070349912 10:75582191-75582213 GCCCCACTGGGGACTCTGTGTGG + Intronic
1071873418 10:89818871-89818893 GCCCCACTGGGGATTCTGTGTGG + Intergenic
1073065965 10:100759395-100759417 GCCCCTCTCGGCAGGCTGTGAGG + Intronic
1073883257 10:108007744-108007766 GCCCCATTAGGAACTCTGTGTGG + Intergenic
1074709733 10:116167297-116167319 GCCCCACCTGCAATGCTGGGTGG - Intronic
1074976885 10:118588266-118588288 GCCCCACTGGGAGAGCCCTGTGG + Intergenic
1076086194 10:127634353-127634375 GCCCCACAGGGAACTCTGTGTGG + Intergenic
1077740804 11:4843245-4843267 GCCCCAGTGGGAACTCTGTGTGG + Intronic
1078826952 11:14938762-14938784 GCCCCAGTTGGGTATCTGTGTGG + Intronic
1079123611 11:17702740-17702762 GTCCCACTTGGGAGGCTGAGAGG - Intergenic
1079521187 11:21328525-21328547 GCCCCAGTGGGAACTCTGTGTGG - Intronic
1079819324 11:25105500-25105522 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
1080889372 11:36396201-36396223 GCCAAGCTTGGAAAGCTGTCAGG - Intronic
1082626764 11:55496135-55496157 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
1082947969 11:58780425-58780447 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
1083727906 11:64637897-64637919 GCCCCACTGGGCAGGCAGTGAGG + Intronic
1084702633 11:70797289-70797311 GCTCCACTCGGAAGGCTGGGTGG - Intronic
1088178509 11:107082078-107082100 GCCCCAGTGGGGAATCTGTGTGG + Intergenic
1088850962 11:113703001-113703023 GCCCCAGTGGGAACTCTGTGTGG - Intronic
1089528012 11:119109328-119109350 GCCCCACCTGGAGAGCAGTGCGG - Intronic
1090572972 11:128068099-128068121 GCCCCAGTAGGGAATCTGTGAGG + Intergenic
1093207090 12:16263998-16264020 GCCCCATTAGGAACTCTGTGTGG - Intronic
1094024180 12:25945187-25945209 GCCCAACCTGGAATGCAGTGGGG + Intergenic
1094044542 12:26153005-26153027 GCCAGCCTTGGAATGCTGTGGGG - Intronic
1094126771 12:27031917-27031939 GCCCCACTTGGAAAGCTGTGTGG + Intronic
1094489220 12:30948308-30948330 GCCCCAGTAGGAACTCTGTGTGG + Intronic
1096959931 12:55567927-55567949 GCCCCACTGGGAACTCTGTGTGG - Intergenic
1097174750 12:57136146-57136168 GCCCCACTGGGCCAGCTGTGAGG - Intronic
1098238605 12:68442917-68442939 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
1098327319 12:69316272-69316294 GCCCCAGTGGGGACGCTGTGTGG + Intergenic
1098661067 12:73094370-73094392 GCCCCAGTAGGAACACTGTGTGG - Intergenic
1098944375 12:76573683-76573705 GCCCCAGTGGGGAATCTGTGTGG + Intergenic
1099536844 12:83855864-83855886 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
1099724804 12:86412191-86412213 GCCCCAGTGGGGAATCTGTGGGG - Intronic
1099932666 12:89091771-89091793 GCCCCATTGGGGATGCTGTGTGG - Intergenic
1099963654 12:89421563-89421585 GCACCACTTAGAACGCTGTGTGG - Intronic
1100147727 12:91698314-91698336 GCCCCAGTGGGGAATCTGTGTGG + Intergenic
1100348303 12:93753925-93753947 GCCCCAGTGGGAACTCTGTGAGG + Intronic
1100578085 12:95911784-95911806 GCCCCATGTGGAAAGCAGTTTGG + Intronic
1100937886 12:99690847-99690869 GCCCCAGTGGGAACTCTGTGTGG + Intronic
1102528698 12:113530498-113530520 GCCCCAGTGGGAACACTGTGTGG - Intergenic
1103305572 12:119961304-119961326 GCCCCACACTGCAAGCTGTGAGG + Intergenic
1107330736 13:39296739-39296761 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1108270619 13:48756091-48756113 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
1109013139 13:56975449-56975471 GCCCCAGTGGGAACCCTGTGTGG + Intergenic
1110926838 13:81164476-81164498 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
1111222326 13:85220768-85220790 GCCCCACTGGGGACGCTGTGTGG - Intergenic
1113645322 13:111990892-111990914 GCCCCAGTGGGAATTCTGTGTGG - Intergenic
1114944899 14:27668547-27668569 GCCACACTAGGAAAGGAGTGAGG - Intergenic
1115121423 14:29941974-29941996 GCCCCAGTGGGAACTCTGTGTGG - Intronic
1116080278 14:40162656-40162678 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
1116293530 14:43074153-43074175 GCCCCAGTAGGGACGCTGTGTGG - Intergenic
1116387413 14:44348456-44348478 GCCCCAGTAGGGAACCTGTGTGG - Intergenic
1116536664 14:46040310-46040332 GCCCCACTTAAAAGGCAGTGTGG - Intergenic
1116854213 14:49937662-49937684 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1118402828 14:65395307-65395329 GCCCCAGTTGGAACTCTGTGTGG + Intergenic
1120417922 14:84243446-84243468 GCCCCATTGGGAACTCTGTGTGG + Intergenic
1120443333 14:84564540-84564562 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1120637007 14:86965255-86965277 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1120840804 14:89083285-89083307 CCCCCACTTGGAAAGCAGCCAGG - Intergenic
1121511444 14:94515934-94515956 TCCCCACTTGCAAAACTCTGTGG - Exonic
1124385381 15:29204182-29204204 GCCTCATTTGCAAAGCTCTGCGG - Intronic
1124461649 15:29897487-29897509 GCCCCAGTAGGGAATCTGTGTGG - Intronic
1128233599 15:66052215-66052237 GCCCCACCTGGAGAGCAATGAGG - Intronic
1128870300 15:71150078-71150100 ACGCCACTTGGAAAGGAGTGTGG + Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1130986538 15:88848148-88848170 TTCCCACCTGGAAAGCTGGGTGG - Intronic
1131198780 15:90379006-90379028 GCCCCATTGGGAACTCTGTGTGG + Intergenic
1132061298 15:98694406-98694428 TCCCCACTTGAACTGCTGTGTGG + Intronic
1132222651 15:100116683-100116705 GCCCAACTTTGTAAGTTGTGGGG - Intronic
1132272454 15:100538314-100538336 GCCCCAGTGGGAATTCTGTGTGG + Intronic
1135208908 16:20507384-20507406 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
1136070135 16:27782569-27782591 GCCCCCCTTGGCAGGCTCTGGGG - Intergenic
1137772939 16:51031881-51031903 GACCTACTTAGAAAGCTGTATGG + Intergenic
1137818548 16:51422148-51422170 GCCCCACTAGGGACTCTGTGTGG + Intergenic
1138425824 16:56931663-56931685 GCCCCACGTGGAAACCTACGGGG - Intergenic
1139327604 16:66164310-66164332 GCCCCATTTGAGGAGCTGTGAGG - Intergenic
1139371398 16:66471550-66471572 GCTCCCCTGGGAAAGCTGTTAGG + Intronic
1141272748 16:82555948-82555970 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
1142281210 16:89148659-89148681 GCCCCACTGGGGACTCTGTGTGG + Intronic
1143256513 17:5561801-5561823 TCCCCACTTGGACAGCAGAGGGG + Intronic
1143598026 17:7927296-7927318 GCTCCATTTGGAAGGCTGAGAGG - Intronic
1144793406 17:17874737-17874759 ACCCCAGTGGGAAGGCTGTGGGG - Intronic
1147021724 17:37539892-37539914 GCCCCAGTTATAACGCTGTGTGG + Intronic
1148103013 17:45104177-45104199 CCCACGCTGGGAAAGCTGTGAGG - Intronic
1148484722 17:47983232-47983254 GGCCCCCTTGGTAAGCAGTGTGG + Intergenic
1149114650 17:53078324-53078346 GCACCCCTTGGAGAACTGTGAGG + Intergenic
1149896589 17:60433136-60433158 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
1150007855 17:61480571-61480593 GCAACACTTGGAAAGGTGTCTGG - Intronic
1150829835 17:68509697-68509719 GCACCATTTGGAAAGCACTGAGG + Intergenic
1153108010 18:1550257-1550279 GCCCCAGTGGGAATTCTGTGTGG - Intergenic
1153140677 18:1969166-1969188 GCACAACTTGGAAAGCCTTGTGG + Intergenic
1155514876 18:26614582-26614604 GACCCAGCTGGAAATCTGTGTGG + Intronic
1156750416 18:40446826-40446848 GCCCCTCTTCCAAAGCAGTGAGG + Intergenic
1158258801 18:55586237-55586259 GCCCCACTTGGAAGGCGGTTTGG + Intronic
1159388205 18:67754701-67754723 GACCCCCTGGGAAAGCTGAGTGG + Intergenic
1159609620 18:70511140-70511162 GCCCCACAGGGAAATGTGTGTGG - Intergenic
1159641235 18:70864971-70864993 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1159756361 18:72370858-72370880 GCCCCAGTTGGGACTCTGTGTGG - Intergenic
1160021608 18:75185837-75185859 GCCCCACTGGTAAAGCTGCCAGG + Intergenic
1160082062 18:75737178-75737200 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1160632097 18:80253993-80254015 GCCCCACGTGGGATGCGGTGGGG + Intergenic
1160739478 19:679362-679384 GCCCCACTTCCAAGGCAGTGCGG - Intronic
1161963665 19:7536036-7536058 GCCCCTCTTGGGAGGCTGTATGG + Intronic
1162000948 19:7744822-7744844 GCTCCACTTGGAAAGAAGGGAGG - Intronic
1163819423 19:19487553-19487575 GCCCTTCTTGGGAAGCTCTGGGG + Intronic
1165135044 19:33662550-33662572 GCCCCACGGGGAATGCTGTGAGG + Intronic
1167570097 19:50281586-50281608 CCGCCACTCGGAAAGCTGAGGGG - Exonic
925061806 2:897238-897260 GCCCCATTGGGGATGCTGTGTGG - Intergenic
925147006 2:1588401-1588423 GCCCCTCTTGGAGAGCTTTGGGG - Intergenic
925235626 2:2274902-2274924 CCTCCACTCGGAGAGCTGTGAGG + Intronic
925898912 2:8494650-8494672 ACCCCACTGCAAAAGCTGTGTGG - Intergenic
926431010 2:12785773-12785795 GCCCCAGTGGGGACGCTGTGTGG + Intergenic
926810922 2:16754837-16754859 GCCCCACTTTGAAGGATGAGGGG - Intergenic
928048913 2:27968518-27968540 GCCCCAGTAGGAACTCTGTGTGG - Intronic
928384942 2:30859082-30859104 AGCCCCCTTGGAAATCTGTGGGG - Intergenic
930152412 2:48072087-48072109 GCCCCACTTGATAAGCTCAGCGG - Intergenic
930346238 2:50185467-50185489 GCCCCACTTAGGAAGAAGTGGGG - Intronic
930408497 2:50993591-50993613 GCCCCACTTTAAAAGTTGCGAGG + Intronic
930419698 2:51135179-51135201 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
931075093 2:58702090-58702112 GCCTCTCTTGGAGAGCTTTGTGG + Intergenic
934067102 2:88350572-88350594 GCCCCACTTGGAGGTCTGGGTGG + Intergenic
938093467 2:128447749-128447771 GCCCCCATTGTAACGCTGTGGGG - Intergenic
938183786 2:129209438-129209460 GCCCCAGTTGTGGAGCTGTGAGG + Intergenic
938968258 2:136407521-136407543 TGCCCACTTGAAAAGATGTGAGG + Intergenic
939050257 2:137298930-137298952 GCCCCACTAGGGACTCTGTGTGG - Intronic
939364670 2:141216473-141216495 GCCCCACTGGGAACTCTGAGTGG - Intronic
941430569 2:165409148-165409170 GCCCCAATGGGGAATCTGTGTGG - Intergenic
941952204 2:171167136-171167158 GCACCACTTGTTAAGCTGGGTGG + Intronic
942825411 2:180169529-180169551 GCCCCAGTGGGAACTCTGTGGGG + Intergenic
942889042 2:180964937-180964959 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
943395578 2:187328901-187328923 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
943817707 2:192277318-192277340 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
946434934 2:219645043-219645065 ACCCCACTCGGAAAGCAGTAAGG - Intergenic
946644148 2:221815544-221815566 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
947067549 2:226246182-226246204 GTCCCACTTGTAAAGCTTAGAGG - Intergenic
947488157 2:230571337-230571359 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
947593539 2:231397647-231397669 GCCCCCCTTGGGAGGCTGGGTGG - Intronic
948789624 2:240370517-240370539 GGGCCACTTTGCAAGCTGTGGGG + Intergenic
1169252129 20:4068897-4068919 GGCCAACTTGTCAAGCTGTGTGG + Intergenic
1170079036 20:12450913-12450935 GCCCCACTAGGGACACTGTGTGG - Intergenic
1170364905 20:15587963-15587985 GCCCCAGTAGGAACTCTGTGTGG + Intronic
1171493320 20:25537605-25537627 GCCCCACATGCACAGCAGTGTGG + Intronic
1172917119 20:38451376-38451398 GCTGCACTTGGAGAGCTCTGGGG + Intergenic
1175089406 20:56489526-56489548 GCCCCACTTTCCCAGCTGTGTGG + Intronic
1175907839 20:62390368-62390390 GCTCCACTTGGGATGCAGTGAGG + Exonic
1177204818 21:17998451-17998473 GCCCCAGTAGGGAACCTGTGTGG + Intronic
1182813530 22:33137958-33137980 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1183004525 22:34890177-34890199 GCCCCACTGGGGATGCTGTGTGG - Intergenic
1184366868 22:44057485-44057507 GCCCCCCTTGGACAGCTCTCAGG - Intronic
1184489680 22:44801413-44801435 CCCACACATGGACAGCTGTGGGG - Intronic
1185387386 22:50541281-50541303 TCCCCACTGGGCAAGCTGAGAGG - Intergenic
949322129 3:2823329-2823351 GTCCTATTTCGAAAGCTGTGCGG + Intronic
950244977 3:11407496-11407518 GCCCCAGTAGGAACTCTGTGTGG + Intronic
950443126 3:13021365-13021387 TCCCCAGCTGGACAGCTGTGGGG - Intronic
950507559 3:13404720-13404742 GCCCATCCTGGAAAGCTGTGAGG - Intronic
952608701 3:35181434-35181456 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
953336097 3:42095193-42095215 GCCACACTTGGAAACCTGCCAGG - Intronic
953383946 3:42494071-42494093 GCCCCACTGGGGAAGGTTTGAGG - Intronic
953456571 3:43047082-43047104 GCCCCACTGGGAACTCTGTGTGG - Intronic
953459770 3:43073034-43073056 GCCCACCCTGGGAAGCTGTGGGG + Intergenic
953861121 3:46544868-46544890 GACCCACTTGGATACCTCTGTGG - Intronic
955066138 3:55535155-55535177 GCCCCACTTGGAAAGCTGGTTGG - Intronic
955973299 3:64457404-64457426 GCCATATGTGGAAAGCTGTGAGG + Intergenic
956348838 3:68311833-68311855 GCCCCACTAGGGACTCTGTGTGG + Intronic
956563980 3:70615083-70615105 GCCCCAATGGGAACTCTGTGTGG + Intergenic
956938563 3:74131743-74131765 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
957477091 3:80739306-80739328 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
958065976 3:88545158-88545180 GCCCCACTGGGGACTCTGTGTGG - Intergenic
958506189 3:94980437-94980459 GGCCCAGTTGGAAAGCAATGAGG - Intergenic
958553287 3:95643389-95643411 GTCCCAGTTGGAACTCTGTGTGG + Intergenic
958728499 3:97935204-97935226 TCCACAGTTGGAAAACTGTGTGG - Intronic
958745315 3:98127187-98127209 GCCCCACTTGGGAGTCTCTGTGG + Intergenic
959119163 3:102212204-102212226 GCCCCAGTGGGAGTGCTGTGTGG + Intronic
959172007 3:102854997-102855019 GCCCCAGTGGGGAATCTGTGTGG + Intergenic
959368262 3:105490917-105490939 GCCCCAATGGGAACTCTGTGTGG + Intronic
959769227 3:110072553-110072575 GCCCCATTGGGAACCCTGTGTGG - Intergenic
961678462 3:128582988-128583010 GCCCGAGTTGTAGAGCTGTGGGG + Intergenic
963011641 3:140775752-140775774 GCCCCAGTAGGAACTCTGTGGGG + Intergenic
963539456 3:146566954-146566976 GCCCCAGTGGGGATGCTGTGTGG + Intergenic
965728227 3:171743139-171743161 TCCTCCCTTGGGAAGCTGTGAGG + Intronic
966320321 3:178694923-178694945 GCCCCAGTGGGAACTCTGTGTGG + Intronic
966990661 3:185226844-185226866 ATCTCACTTTGAAAGCTGTGGGG + Intronic
967482934 3:189995277-189995299 GCCACACATGGTAAGCTCTGTGG - Exonic
967559942 3:190905849-190905871 GCCCCACTGGGGACTCTGTGTGG - Intergenic
967908340 3:194520287-194520309 GCCCCAGTTGGGACTCTGTGTGG - Intergenic
968489566 4:882805-882827 GCCACACTCGGAGACCTGTGGGG + Exonic
968902278 4:3437342-3437364 GCCCCACATGGACAGATGGGAGG - Intronic
969230387 4:5826517-5826539 GCCCCACTGGGAAAGGGTTGTGG + Intronic
969441668 4:7220704-7220726 GCCCCATTTTGCACGCTGTGGGG + Intronic
969570923 4:8007801-8007823 GCACACCTTGGAAATCTGTGAGG + Intronic
969890978 4:10259873-10259895 GCCCCATTCTGAAAGCTATGGGG - Intergenic
970302110 4:14692315-14692337 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
971021952 4:22546107-22546129 GCCCCAGTTGGGACACTGTGTGG + Intergenic
972002650 4:34058417-34058439 GCCCCATTAGGAACACTGTGTGG + Intergenic
972397756 4:38672378-38672400 GCACCACTGGGAAAGCTAAGAGG + Intronic
972982194 4:44718895-44718917 GCTCCATTTAGAAAGCTGTAAGG - Intronic
974679021 4:65137161-65137183 GCCCCAGTGGGAAATCTGTGTGG + Intergenic
976050771 4:81009390-81009412 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
976726755 4:88222708-88222730 GCCCCACTGGGGACTCTGTGTGG - Intronic
977041431 4:92024323-92024345 GCCCCACTGGGGATTCTGTGTGG + Intergenic
977270993 4:94917227-94917249 GCCCCACTGGGAATGCTGTGTGG - Intronic
977443865 4:97103228-97103250 GCCCCATTTGGAGAGATGAGAGG - Intergenic
978492418 4:109323217-109323239 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
979065902 4:116132710-116132732 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
979969291 4:127114435-127114457 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
980280054 4:130707355-130707377 GCCCCAGTGGGGACGCTGTGTGG + Intergenic
981347824 4:143697234-143697256 GCCTCACTTGGATATCTCTGAGG + Exonic
981356850 4:143799054-143799076 GCCCCACTGGGGACTCTGTGTGG + Intergenic
981368378 4:143929651-143929673 GCCCCACTGGGGACTCTGTGTGG + Intergenic
981370418 4:143952824-143952846 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
981378175 4:144039936-144039958 GCCCCACTGGGGACTCTGTGTGG + Intergenic
981380175 4:144062748-144062770 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
981978294 4:150759028-150759050 CAGCTACTTGGAAAGCTGTGAGG - Intronic
983006778 4:162493554-162493576 GCCCCAGTTGGGAATCTGTTTGG - Intergenic
983089501 4:163487132-163487154 GCCCCAGTGGGGAATCTGTGTGG + Intergenic
983261449 4:165461265-165461287 GCCATACTTAGAAGGCTGTGCGG + Intronic
983952813 4:173662202-173662224 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
985171043 4:187150480-187150502 GCCCCACTTCCAACGCTGGGGGG + Intergenic
987610702 5:20199093-20199115 GCCCCAGTGGGAACTCTGTGTGG - Intronic
988204353 5:28115236-28115258 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
988754448 5:34231834-34231856 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
989673384 5:43946248-43946270 GCCCCATTTGGGACTCTGTGTGG + Intergenic
989696940 5:44212631-44212653 GCCCCATTGGGAACTCTGTGTGG - Intergenic
990197211 5:53331694-53331716 GATCAACTTGGAAGGCTGTGTGG + Intergenic
990286090 5:54302091-54302113 CTCCCACTGGGAAAGTTGTGTGG - Intronic
990794545 5:59525047-59525069 GCCCCAGTGGGAATTCTGTGTGG - Intronic
991742658 5:69697527-69697549 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
991755036 5:69857677-69857699 GCCCCAGTGGGGAATCTGTGTGG + Intergenic
991764324 5:69958304-69958326 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
991794231 5:70277265-70277287 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
991822048 5:70572840-70572862 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
991834363 5:70732825-70732847 GCCCCAGTGGGGAATCTGTGTGG + Intergenic
991843556 5:70833376-70833398 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
991886609 5:71276807-71276829 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
992603102 5:78424918-78424940 TCCCCACTTAAAAAGCTGTGCGG + Intronic
992639890 5:78760179-78760201 GACCCACTTGGATTGTTGTGAGG + Intronic
993225950 5:85167378-85167400 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
994450093 5:99930096-99930118 GCCCCAATTGGGAAGGGGTGAGG + Intergenic
994535504 5:101025228-101025250 GCCCCAGTGGGAACTCTGTGGGG + Intergenic
995009414 5:107240662-107240684 GCCCCAGTTGGGACTCTGTGTGG - Intergenic
995220404 5:109641499-109641521 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
995462408 5:112418621-112418643 GCCCCTCTTTGAGAGCTGCGGGG + Intronic
995703563 5:114961877-114961899 GCCCCAGTGGGGATGCTGTGTGG + Intergenic
995793659 5:115920429-115920451 GCCCCAGTTCAAAAGCAGTGAGG + Intergenic
995971200 5:117973593-117973615 GCCCTAGTTGGAATTCTGTGTGG + Intergenic
996122872 5:119691305-119691327 GCCCCACTGGGGACTCTGTGTGG + Intergenic
997834017 5:137177852-137177874 TCCCTACTTGGAAAGCTTTTTGG - Intronic
999132852 5:149297815-149297837 GCCTCCCTTGGCAGGCTGTGAGG - Intronic
1000229069 5:159298269-159298291 GCCCCAGTAGGAACTCTGTGCGG + Intergenic
1000467574 5:161598913-161598935 GCCCCATCAGGAAAGCTGTTTGG + Intronic
1000848986 5:166316789-166316811 AGTCCACTTGGAAAGCTGAGAGG + Intergenic
1000981879 5:167825050-167825072 TCCCCACTTGGAAATCTGGTTGG + Intronic
1003403089 6:5806958-5806980 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1004449677 6:15733686-15733708 GCCTCCCTTGGAAATGTGTGAGG - Intergenic
1005553063 6:26943544-26943566 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
1007201476 6:40113412-40113434 GCCCCACTTGGAAAAACCTGGGG + Intergenic
1007849724 6:44791620-44791642 GGGCCACTAGGAAAGCTGAGTGG - Intergenic
1008242264 6:49127756-49127778 GCCCCAGTGGGAATTCTGTGTGG - Intergenic
1008876050 6:56329342-56329364 GCCCCAGTTGCATGGCTGTGGGG + Intronic
1009656294 6:66549470-66549492 GCCCACCTTGGAAAGCTTTTGGG + Intergenic
1010611897 6:77963230-77963252 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1010735830 6:79443003-79443025 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
1011671489 6:89687816-89687838 GGCCCACCTGGAAGGCTGGGAGG + Intronic
1012068199 6:94577191-94577213 GCCCCAGTGGGAACTCTGTGGGG + Intergenic
1012202504 6:96424040-96424062 GCCCCAGTGGGAATTCTGTGTGG + Intergenic
1012235298 6:96806963-96806985 GCCCCACTTGGAAGCCCGTAAGG + Intronic
1013091152 6:106901900-106901922 GCACCAGTGGGAAATCTGTGTGG - Intergenic
1013717220 6:112976261-112976283 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1013829520 6:114255499-114255521 GCCCCAGTGGGAACTCTGTGTGG + Intronic
1014709826 6:124793922-124793944 GCCCCACATGGGAAGGAGTGGGG + Intronic
1015039881 6:128703857-128703879 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1015667513 6:135648444-135648466 GCCCCACTGGGGACTCTGTGGGG + Intergenic
1016241271 6:141934463-141934485 GCCCCAGTTGGGACTCTGTGTGG - Intergenic
1017065764 6:150527778-150527800 ACCCCACCTGGAAAGCTCTGTGG + Intergenic
1018510549 6:164520111-164520133 GCCCCACTGGGGAATATGTGTGG - Intergenic
1018585210 6:165350038-165350060 GCCCCAATGGGAACTCTGTGTGG - Intronic
1018837325 6:167494731-167494753 GTCCCACTTCGAAGGCTATGAGG - Intergenic
1019477477 7:1251034-1251056 GCCCCACTCTGAATGCTGAGGGG + Intergenic
1019731175 7:2630448-2630470 GCCCGACTTGGCCAGCTCTGTGG - Intergenic
1020537833 7:9424151-9424173 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
1021917905 7:25454302-25454324 GCCACACTTGCACAGCTGTCTGG + Intergenic
1023213060 7:37829311-37829333 GCCCACTTTGGGAAGCTGTGAGG - Intronic
1023683855 7:42715519-42715541 GTTCCAGTTGGAAAGCTGAGGGG - Intergenic
1024539837 7:50467249-50467271 TCCCCGCTTTGAAATCTGTGTGG - Exonic
1024860564 7:53835217-53835239 GCCCCACTGGGGACTCTGTGCGG - Intergenic
1025015343 7:55434893-55434915 TCCCCACCTAGAAGGCTGTGGGG - Intergenic
1026278698 7:68902905-68902927 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1026477977 7:70753212-70753234 AGCCCACTGGGAGAGCTGTGTGG - Intronic
1027492807 7:78851344-78851366 GCCCCTCCTGGAGTGCTGTGAGG + Intronic
1028814684 7:95130508-95130530 GCCCCAGTAGGAATTCTGTGTGG - Intronic
1028957804 7:96713306-96713328 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
1029655048 7:101918673-101918695 GACCAACCTGGAAATCTGTGGGG + Intronic
1030784732 7:113645571-113645593 GCCCCACTGGGGACACTGTGGGG + Intergenic
1031290543 7:119928669-119928691 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1031315917 7:120257279-120257301 GCCCCAGTAGGGAATCTGTGTGG - Intergenic
1031783327 7:125997704-125997726 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1033796821 7:144855095-144855117 GCTCCCCTTGGAATGATGTGTGG + Intergenic
1034040713 7:147874211-147874233 GCCCCAGTGGGAACTCTGTGTGG + Intronic
1034173332 7:149080216-149080238 ACCCCACTGTAAAAGCTGTGAGG + Intronic
1034874488 7:154713361-154713383 GCCCCACTGGGGACTCTGTGTGG + Intronic
1036282055 8:7408749-7408771 GCCCCACTGGGGACACTGTGTGG - Intergenic
1036339414 8:7902822-7902844 GCCCCACTGGGGACACTGTGTGG + Intergenic
1036756417 8:11474219-11474241 GCACCACCTGGAAAGGGGTGTGG + Intronic
1037048856 8:14343253-14343275 GCCCCAGTAGGAACTCTGTGTGG - Intronic
1038027884 8:23608451-23608473 GCCCCAGATAGAAAGCTGAGTGG - Intergenic
1038783349 8:30587959-30587981 GCCCCAGTTGGAAATCATTGTGG - Intronic
1039253225 8:35689616-35689638 GGCCCAGTTGGAAGGCTGTCAGG + Intronic
1039650266 8:39333912-39333934 GCTTCACTTGGACAGCAGTGTGG - Intergenic
1041965150 8:63667628-63667650 GCCCCATTTGGGACTCTGTGTGG - Intergenic
1042646057 8:70987730-70987752 GCCCCAGTAGGAATTCTGTGTGG + Intergenic
1042761541 8:72276613-72276635 GCCCCAGTAGGGAATCTGTGTGG - Intergenic
1042789331 8:72586184-72586206 TAGCCACTTGGAAATCTGTGAGG + Intronic
1043065701 8:75567743-75567765 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
1043080629 8:75760917-75760939 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1043370355 8:79583978-79584000 GCCCCAATGGGGAATCTGTGTGG - Intergenic
1043464704 8:80493147-80493169 GCCCCAGTTGGAGTGCAGTGGGG - Intronic
1045383167 8:101646846-101646868 GGCTCCCTGGGAAAGCTGTGGGG + Intronic
1045784262 8:105902576-105902598 GCCCCAGTAGGGATGCTGTGTGG + Intergenic
1046372216 8:113324666-113324688 GCCCCAGTAGGAGCGCTGTGTGG - Intronic
1047918026 8:129603726-129603748 GCCCCACTGGGGACTCTGTGTGG + Intergenic
1048043298 8:130751013-130751035 GCCCCAGTGGGGAAACTGTGTGG + Intergenic
1048116741 8:131532071-131532093 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
1048304445 8:133273817-133273839 GCTCCAGTTGGAGAGCTTTGTGG - Intronic
1048306514 8:133288525-133288547 GCCACACTTGCTAAGCCGTGAGG - Intronic
1049085733 8:140477298-140477320 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
1049489602 8:142888302-142888324 GCCCCAGTGGGAAATCTGTGTGG + Intronic
1050121587 9:2314037-2314059 GCCCCAGTTGGGACTCTGTGTGG - Intergenic
1050508524 9:6371073-6371095 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1050939362 9:11439776-11439798 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
1052210149 9:25894059-25894081 GCCCCACTAGGGACTCTGTGTGG + Intergenic
1052414205 9:28157078-28157100 GCCCCAATAGGGAATCTGTGTGG + Intronic
1054868294 9:70025425-70025447 GCCCCACTGGGGATTCTGTGTGG + Intergenic
1055223853 9:73970200-73970222 GCCCCAGTTGGAATTCTGTGTGG - Intergenic
1056855489 9:90125087-90125109 GAAACACTTGGACAGCTGTGGGG + Intergenic
1057794397 9:98145175-98145197 TCCCCACTTGGTCACCTGTGGGG + Intronic
1058210434 9:102161388-102161410 GCCCCAATTGGGACACTGTGTGG + Intergenic
1058292202 9:103256764-103256786 GCTCCAGTTGGAACTCTGTGTGG + Intergenic
1059069467 9:111120351-111120373 GCCCCAGTGGGAACTCTGTGTGG + Intergenic
1059628343 9:116091794-116091816 GCCCCAGTGGGGAATCTGTGTGG - Intergenic
1060424941 9:123496688-123496710 GACCCACTTGGAAGAGTGTGTGG + Intronic
1060545777 9:124458245-124458267 GCGCCACCTGGAGGGCTGTGAGG + Intronic
1061398420 9:130355657-130355679 GCCTCGCTTGGAAGGCTCTGGGG + Intronic
1061619422 9:131801854-131801876 GCCCCTCTGGGAAAGATGTAGGG - Intergenic
1186241123 X:7567520-7567542 GCCCCAGTTTGAAAGCTGACAGG - Intergenic
1187639628 X:21274023-21274045 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
1187734422 X:22289731-22289753 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
1187894395 X:23966849-23966871 GCCCCACTGGGGACTCTGTGTGG + Intergenic
1191095098 X:56665395-56665417 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
1193226486 X:78989879-78989901 GCCCCAGTAGGAACTCTGTGTGG - Intergenic
1193286848 X:79723907-79723929 GCCTCTCTTGGAAAGTGGTGGGG - Intergenic
1193320432 X:80115048-80115070 GCCCCACTGGGGATTCTGTGTGG - Intergenic
1193981370 X:88185649-88185671 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1193998761 X:88400465-88400487 GCCCCATTTGGAACTCTGTGTGG - Intergenic
1194147335 X:90280252-90280274 GCCTCTCTTGGAAAGCAGTGAGG + Intergenic
1194572877 X:95574568-95574590 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1194920628 X:99760178-99760200 GCCCCACTGGGGACTCTGTGTGG - Intergenic
1196032350 X:111104051-111104073 GCCCAACTTGCAAAGCTGCTGGG - Intronic
1196169814 X:112574987-112575009 GCCCCAGTAGGAAATCTGTGTGG - Intergenic
1196522238 X:116687306-116687328 GCCCCAGTAGGGAATCTGTGTGG - Intergenic
1197223169 X:123932575-123932597 GCCCCAGTGGGAACTCTGTGTGG - Intergenic
1197510193 X:127361576-127361598 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
1197871333 X:131065439-131065461 GCCTCACATGAACAGCTGTGAGG + Intronic
1198707251 X:139462472-139462494 GCCCCAGTTGGGACTCTGTGTGG - Intergenic
1199071186 X:143477198-143477220 GCCCCAGTGGGAACTCTGTGGGG - Intergenic
1199072735 X:143497890-143497912 GCCCCAGTGGGGAATCTGTGTGG + Intergenic
1199113249 X:143959311-143959333 GCCCCAGTAGGAACTCTGTGTGG + Intergenic
1199220513 X:145311016-145311038 GCCCCAGTAGGCAATCTGTGTGG + Intergenic
1199561924 X:149172361-149172383 GCCCCACTGGGGACTCTGTGTGG + Intergenic
1200108637 X:153727644-153727666 GCCTCGGCTGGAAAGCTGTGTGG + Intronic
1200493740 Y:3857014-3857036 GCCTCTCTGGGAAAGCAGTGAGG + Intergenic
1201460878 Y:14222605-14222627 GCCCCAGTTTGAAAGCTGAAAGG - Intergenic