ID: 1094128258

View in Genome Browser
Species Human (GRCh38)
Location 12:27046334-27046356
Sequence AGGAGTTACCTGGGGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094128258_1094128262 -5 Left 1094128258 12:27046334-27046356 CCTTCTATCCCCAGGTAACTCCT 0: 1
1: 0
2: 1
3: 26
4: 239
Right 1094128262 12:27046352-27046374 CTCCTGATTTGCTTTCTGATAGG 0: 1
1: 0
2: 1
3: 26
4: 259
1094128258_1094128264 29 Left 1094128258 12:27046334-27046356 CCTTCTATCCCCAGGTAACTCCT 0: 1
1: 0
2: 1
3: 26
4: 239
Right 1094128264 12:27046386-27046408 TTTCTAGAATTTTATATAAATGG 0: 59
1: 223
2: 607
3: 1382
4: 2950

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094128258 Original CRISPR AGGAGTTACCTGGGGATAGA AGG (reversed) Intronic
900140893 1:1139155-1139177 GGGAGTTTCCTGGGGTCAGAAGG + Intergenic
900842496 1:5065751-5065773 AGTACTTACCTGTGGGTAGATGG + Intergenic
900984574 1:6065986-6066008 AAGAGTTTCTTGGGGACAGATGG + Intronic
902242621 1:15099095-15099117 AGGAGTTCACTGGGGGAAGAGGG + Intronic
904360959 1:29971495-29971517 TGGAGTCACCTGGGGATGGGAGG - Intergenic
904421688 1:30398363-30398385 TGAAGTGACCTGGGGATTGAAGG + Intergenic
905872115 1:41410669-41410691 AGGAGTTTTCTGGGCAAAGAAGG + Intergenic
906290758 1:44617896-44617918 AGGAGTCAGCAGGGGAAAGAAGG - Intronic
906658195 1:47564006-47564028 AGGAGTTTGCTGGGCAAAGATGG - Intergenic
907684130 1:56593341-56593363 AGGAACTACCTAGGGCTAGAGGG - Intronic
911150117 1:94590349-94590371 AGGAGGGCCCTGGGGAGAGAGGG - Intergenic
911623834 1:100097925-100097947 AGTAGTTGCCTAGGGCTAGAAGG + Intronic
911678428 1:100685698-100685720 AGCAGTTACCGGGGGTTAGTGGG - Intergenic
913177713 1:116290264-116290286 AGAAGCTACCTGGTCATAGAGGG + Intergenic
914749051 1:150520335-150520357 AGGAGTTATCAGGGGCTAAAGGG - Intergenic
916492670 1:165315691-165315713 AGGTTTTTCCTGGGGGTAGAGGG - Intronic
916980413 1:170129815-170129837 AAGAGTTGCCTGGGGAGAGCAGG - Intergenic
917223866 1:172761163-172761185 ATGAGTAACCTGGTGAGAGAGGG + Intergenic
917948504 1:180002913-180002935 AGTAGTTGCCAGGGGATGGAGGG + Intronic
920186123 1:204160501-204160523 AGGAGAGGCCTGGGGACAGAAGG + Intronic
920797613 1:209155681-209155703 AGAAGGTGCCTGGTGATAGAAGG - Intergenic
921462327 1:215444240-215444262 AGGAGTTAACTGGGTTGAGATGG - Intergenic
921522745 1:216176723-216176745 AGTAGTTACCTGGGGTTGGGGGG - Intronic
923173739 1:231443060-231443082 AGGAGTCATCTGGATATAGATGG + Intergenic
1062805587 10:417336-417358 AGGATTTACCTGGGGAACAAAGG + Intronic
1062846137 10:707195-707217 AGGAGATGACTGGGGAGAGAAGG - Intergenic
1067309159 10:45095954-45095976 AGGAGCTTCCTGGGGATTGGAGG - Intergenic
1067527752 10:47048543-47048565 AGGAGTTGCCTGGGCCAAGAAGG + Intergenic
1068323773 10:55456282-55456304 AGTAGTTACCTATGGAGAGAGGG + Intronic
1069078076 10:64059343-64059365 GGGAGGTCCCTGGGGATAGTGGG + Intergenic
1069676481 10:70252353-70252375 AGTAGTTACCAGGGGCTAGGAGG + Exonic
1071264675 10:83954457-83954479 AGGAGGGGCCTGGGGCTAGATGG - Intergenic
1071467900 10:85957762-85957784 AAGAGTTACCTGGGAATGGGTGG - Intronic
1071551855 10:86572122-86572144 AGAGGTTACCAGGGGTTAGAGGG + Intergenic
1071556097 10:86602841-86602863 AGTAATTGCCAGGGGATAGAGGG + Intergenic
1073505548 10:103985259-103985281 ATGTATTCCCTGGGGATAGAGGG + Intronic
1073926030 10:108517838-108517860 TGGAGATACCTGGAGATAGCTGG - Intergenic
1074033390 10:109712050-109712072 AGTAGTTGCCTGGGGGTATACGG - Intergenic
1076907145 10:133368448-133368470 AGGAGAACCCTGGGGTTAGAGGG + Intronic
1080288892 11:30648410-30648432 AGTAGTTAGCAGGGGTTAGAGGG - Intergenic
1081547848 11:44084408-44084430 AGGAGCTTCCTGGAGATTGAGGG - Intergenic
1083155441 11:60820130-60820152 AGTTGTTACCTGGGGCTGGAAGG - Intergenic
1083888157 11:65582708-65582730 AGGAGATATCTGGGGATTTAGGG + Exonic
1084039395 11:66532597-66532619 AGAAGTTTCCTGGGGAGAGGAGG - Exonic
1085049972 11:73375414-73375436 ATAAGTCAGCTGGGGATAGATGG - Intergenic
1087764408 11:102134673-102134695 AGAAGTTACCTCTGGATAGAGGG - Intronic
1089720438 11:120414274-120414296 AGGAGTTATTTTGGGGTAGATGG + Intronic
1089984195 11:122797747-122797769 AGAAGTTAGCTGGGCAAAGAAGG + Intronic
1091465424 12:679895-679917 GGGGGTTACTTAGGGATAGAAGG - Intergenic
1094128258 12:27046334-27046356 AGGAGTTACCTGGGGATAGAAGG - Intronic
1095241550 12:39865865-39865887 AGGGATTACTTGGGGGTAGAGGG + Intronic
1097363662 12:58686643-58686665 AAGAGATACCTGGGGAGAGTAGG - Intronic
1097833103 12:64246342-64246364 AGCAGTTACCTAGGGCTGGATGG - Intergenic
1103608486 12:122106250-122106272 AGGAGTTAACCAGGGAAAGAAGG - Intronic
1106029266 13:25985105-25985127 AGCAGTGCCCTGGGGATGGAGGG - Intronic
1107100663 13:36587302-36587324 GGGAGTTGTCTGGGTATAGACGG - Intergenic
1107444851 13:40461066-40461088 AGTGGTTACCTGGGGACAGTGGG - Intergenic
1107716955 13:43209629-43209651 AGAAGTTACCAGAGGTTAGAAGG + Intergenic
1108435174 13:50395425-50395447 AGTAGTTGCCTGGGGATAGGGGG + Intronic
1108548246 13:51518061-51518083 TAGAATTACCTGGGGATGGAAGG - Intergenic
1108861102 13:54860146-54860168 AGAAGTTAGCTGGGCAGAGAAGG - Intergenic
1109128472 13:58548882-58548904 AGGGCTTACCTGGGGATTGTTGG + Intergenic
1109177960 13:59178589-59178611 GGGAGTTAACTGGGGAAGGAGGG - Intergenic
1111537772 13:89626555-89626577 AGGAATTACCTTGGGGTAGGGGG + Intergenic
1112794311 13:103038702-103038724 AGCAATTAGGTGGGGATAGAGGG - Intergenic
1115433423 14:33346962-33346984 TGGAGTAACCTTGGGATAAATGG - Intronic
1117389440 14:55249073-55249095 TGGAGTTACATGGGGAAGGAGGG + Intergenic
1117439520 14:55746529-55746551 AAAAGTTACCTGTGGGTAGAGGG + Intergenic
1119775009 14:77242889-77242911 AGGTGTTTCCTGGGGAAGGATGG - Exonic
1120976106 14:90249474-90249496 AGCAGGTATCTGGGGATACAAGG + Intergenic
1121444467 14:93969824-93969846 AGATGTCACCTGGGGAAAGATGG - Intronic
1121598131 14:95181509-95181531 AGGAGTAAGATGGGGACAGAGGG - Intergenic
1121888390 14:97565888-97565910 TGGAATTTCCTGGGGAGAGAAGG - Intergenic
1122536016 14:102463558-102463580 AGCAGTTACCTCAGGGTAGAGGG + Intronic
1122822421 14:104354281-104354303 TGGAGGTCCCTGGAGATAGAGGG + Intergenic
1123480514 15:20627204-20627226 AGGAGTTACCTGATAACAGATGG + Intergenic
1123637494 15:22373163-22373185 AGGAGTTACCTGATAACAGATGG - Intergenic
1124681085 15:31731527-31731549 AGTGGTTACCAGGGGCTAGAGGG + Intronic
1125608426 15:40955485-40955507 AGGAGCATCTTGGGGATAGAAGG - Exonic
1127841716 15:62837615-62837637 AGGAGTTCCCTGGGGCTAGATGG + Intronic
1129217616 15:74109110-74109132 AGCAGTTACTTAGGGAGAGAAGG - Intronic
1129470251 15:75749737-75749759 AGCAGTTATTTGGGGAGAGAAGG + Intergenic
1129644950 15:77420800-77420822 AGGAGTTACCTGTGGAAAGGTGG + Exonic
1129734778 15:77953405-77953427 AGTAGTTACTTGGGGAGAGAAGG - Intergenic
1129770864 15:78202602-78202624 AGGAGAAACCTAGGGAGAGAGGG - Intronic
1129840812 15:78742586-78742608 AGTAGTTACTTGGGGAGAGAAGG + Intergenic
1130506955 15:84553158-84553180 ATCAGTTAACTGGGGATAGCTGG - Intergenic
1131346483 15:91654016-91654038 AGGAGTTAATTAGGGATACAAGG + Intergenic
1132794698 16:1713976-1713998 AGTGGTTACCTGGGGACAGGTGG - Intronic
1138354022 16:56363396-56363418 AGGTGTGTCCTGTGGATAGAGGG - Intronic
1140030273 16:71331511-71331533 AGTGGTTACCAGGGGATAGGGGG + Intergenic
1140454890 16:75099249-75099271 AGGAGTTACCTGCATATAGCTGG + Intronic
1141428586 16:83959246-83959268 GGCCGTTACCTGGGGAGAGAGGG - Exonic
1144096225 17:11903013-11903035 AGTAGTTTCCTGGAGCTAGAGGG + Intronic
1147452143 17:40512319-40512341 TGGGGTCACCTGGGGACAGAGGG + Intergenic
1148473424 17:47910893-47910915 AGCAGTTACCTGGTGATCTATGG + Intronic
1148740786 17:49891114-49891136 AGGAGCTACCTGAGGAGGGAAGG - Intergenic
1149525591 17:57353112-57353134 GGGAGCTATCTGGGGAAAGATGG - Intronic
1149814831 17:59713506-59713528 ATGAGTCACCTGGGGAGATAGGG + Intronic
1150280850 17:63928996-63929018 GGGAGTTCTCTGGGGATGGACGG - Exonic
1150921162 17:69484898-69484920 AGTAGTTGCCAGGGGCTAGAGGG + Intronic
1152707742 17:81853764-81853786 AGGAGGGACCTGGGGAGTGAGGG - Intronic
1155417049 18:25610129-25610151 AGAAGTTACATGGGGACAGAGGG + Intergenic
1156558067 18:38089830-38089852 AAGGCTTATCTGGGGATAGATGG - Intergenic
1157733733 18:50028000-50028022 AGAGGTTACCTGGGGATGGAGGG + Intronic
1158640643 18:59200843-59200865 AGTAGTTACCTGTTAATAGATGG - Intergenic
1159189716 18:65025992-65026014 AAGAGTTTCCTGGGAATAGCTGG - Intergenic
1159934542 18:74352221-74352243 AGAGGTTACCAGGGGCTAGAAGG + Intronic
1160389131 18:78517395-78517417 AGGAGTTACCAGGAGAAGGATGG - Intergenic
1160842587 19:1152841-1152863 GGGATTTACCTGGAGACAGAGGG - Intronic
1161160201 19:2757512-2757534 AGGGGTCAGCTGGGGATGGACGG - Intronic
1161623972 19:5315108-5315130 AGGAGTTAACTGGGCAGTGAGGG - Intronic
1161777749 19:6273028-6273050 TGGAGTTCCCTGGGAAAAGAGGG + Intronic
1161800749 19:6415739-6415761 AGGAGATACCTCGGGTGAGACGG + Intronic
1162534509 19:11254834-11254856 TGCAGTTACCTGAGGGTAGAGGG + Intronic
1162726736 19:12694568-12694590 AGGAGTCAGGTGGGGATAGGAGG - Intronic
1166326189 19:42052499-42052521 AGGAGTTCCCTAGGGACTGAGGG + Intronic
1168299876 19:55398263-55398285 AGGAGTTACCCCGGCATGGATGG + Intronic
1168316904 19:55488509-55488531 AGGAGGCAGCTGGGGAGAGAGGG - Intronic
927108138 2:19845065-19845087 AGGTCTAACCTGGGGACAGAAGG - Intergenic
927261540 2:21096362-21096384 TGAAGTTACCTGGGGTTAGACGG - Intergenic
927584414 2:24287371-24287393 AGTGGTTACCAGGGGTTAGAGGG - Intronic
928193229 2:29193477-29193499 AGGGGTAACCTGGGGCTGGAGGG - Exonic
928433398 2:31238698-31238720 AGGAGTGACCAGGGGCCAGATGG - Intronic
930086780 2:47503388-47503410 AGGAGCTACCTGGGGGTTGAGGG + Intronic
930458538 2:51638823-51638845 AGGATGTACCTGGGATTAGAAGG + Intergenic
930582746 2:53231951-53231973 ACCAGTTACCTAGGGATAGATGG + Intergenic
931666527 2:64613140-64613162 AGGGATCACCTGGGGATACAGGG - Intergenic
931809843 2:65844234-65844256 AGGAGGTTCCTGGGGTTGGAGGG - Intergenic
931988201 2:67761512-67761534 AGGAGTTGTCTGGTGGTAGACGG - Intergenic
932433448 2:71689028-71689050 AGGAGTCCCCTGGGGGTACATGG + Intergenic
934982975 2:98862015-98862037 GGGAGTCACCTGGGGCTGGAGGG - Intronic
937020223 2:118643663-118643685 AGGAGTGGCCTGAGTATAGAAGG + Intergenic
937265654 2:120613285-120613307 AGGGGTTCTCTGGGGATACAGGG - Intergenic
937505002 2:122526995-122527017 CAGGGTTACCTGGGCATAGAAGG - Intergenic
938317598 2:130340847-130340869 AAGTGTTCCCTGTGGATAGAGGG + Intronic
938968784 2:136412424-136412446 AGGAGATTCCTGGGGACTGATGG + Intergenic
942602126 2:177652345-177652367 AGGAGTTGCATGGGGAGAGGAGG + Intronic
945571963 2:211479318-211479340 AGGCATTACCCAGGGATAGAAGG - Intronic
945941178 2:215951932-215951954 AGTCGTTGCCAGGGGATAGAGGG - Intronic
947196423 2:227572669-227572691 AGGAGTTACCTGGGGGAAAAGGG + Intergenic
948891635 2:240909679-240909701 ATGAGTTTCCTGGGGACAGTGGG - Intergenic
1170760106 20:19241387-19241409 AGGAGATGCCTGGGGAGTGAGGG - Intronic
1172844820 20:37923619-37923641 AGGAGTTACCTGAGCAGGGAGGG + Intronic
1173406531 20:42771178-42771200 AGGAGTTTCCTGGGGTCAGATGG - Intronic
1173653108 20:44680067-44680089 GGCAGTTACCTGGGGCCAGAGGG - Intergenic
1173867448 20:46321648-46321670 AGGAGTTAGCTGGGGGAAGTAGG - Intergenic
1174180492 20:48671393-48671415 AGGAGATGCCTGGGTACAGACGG + Intronic
1175467537 20:59200643-59200665 AGCGGTTACCTGGGGATGGAAGG - Intronic
1175664678 20:60848327-60848349 AGGTCTTACTTGGGAATAGAAGG - Intergenic
1176024182 20:62977482-62977504 AGGAGGAAGCTGGGGACAGATGG + Intergenic
1177152911 21:17472576-17472598 CGGAGTTCCCAGAGGATAGAAGG - Intergenic
1179049556 21:37877228-37877250 AGGAGAGACCTGGGGAGAAAAGG - Intronic
1179495817 21:41770735-41770757 ATGAGCTGCCTGGGGAAAGAGGG - Intergenic
1180141525 21:45896194-45896216 AGGCGTCACCTGGAGAGAGAAGG - Exonic
1182116288 22:27758315-27758337 AGGAGTCACCTGGGGTGAGGAGG - Intronic
1182877258 22:33702946-33702968 AGGAGTTACCCTGGCAAAGAAGG + Intronic
1184248795 22:43248865-43248887 AGGAGGTGCCCGGGGATGGATGG - Intronic
1184339992 22:43880831-43880853 AGGAGCTATCTGGGGTTGGAGGG + Exonic
1185127539 22:49019881-49019903 AGCAGGTCCCTGGGGACAGACGG + Intergenic
1203289539 22_KI270735v1_random:20993-21015 AAGAGTTACCTGTGGATAAAGGG - Intergenic
950661282 3:14468494-14468516 AGGAGTTTGCTGGGGAAGGACGG - Intronic
951714582 3:25626736-25626758 AGTGGTGACCTGGGGAAAGAAGG - Intronic
952831874 3:37571777-37571799 AGGAGATACTTGGGGCTGGAAGG + Intronic
954320099 3:49826724-49826746 AGAAGTTAGCATGGGATAGAGGG - Intergenic
956115790 3:65917154-65917176 AGGAGTTACATGGGGCTACAGGG + Intronic
959592267 3:108093165-108093187 AGGAGTTTCTTGGGTAGAGAGGG + Intergenic
962846085 3:139275122-139275144 AGGGGATACCAGGGGCTAGAAGG - Intronic
963411168 3:144930054-144930076 AGGACTTACTTGAGGATGGAGGG + Intergenic
965339744 3:167474525-167474547 AGGAGTTTCCTGTGGATATAAGG + Intronic
967606893 3:191457618-191457640 AGGATTTACCTCAGGATACATGG - Intergenic
967781452 3:193444849-193444871 AGGAGCTACCTGAGGCTGGAAGG + Intronic
968055660 3:195689844-195689866 AGGAGTGACCTGGGGCTGGCTGG + Intergenic
968100128 3:195958754-195958776 AGGAGTGACCTGGGGCTGGCTGG - Intergenic
970380301 4:15500847-15500869 AGGAGTTTCCTGAGGAGAGAAGG - Intronic
971412752 4:26392643-26392665 AGTGGTTTCCTGGGGATAGGGGG + Intronic
973761045 4:54116085-54116107 AGGACCTACCTGAGGGTAGAGGG - Intronic
975787340 4:77906007-77906029 AGAAGTTATCAGTGGATAGATGG + Intronic
976043042 4:80910661-80910683 AGGGGCTACCTGAGGGTAGAGGG + Intronic
977329468 4:95619335-95619357 AGGGCTTACTTGAGGATAGAGGG + Intergenic
979399508 4:120231615-120231637 AGGAGTTAACCAGTGATAGAAGG + Intergenic
980587595 4:134837276-134837298 AGGTTTTCCCTGGGGATGGAGGG + Intergenic
982387448 4:154826067-154826089 AGCAGTTACTTGGGAATACATGG + Intronic
985047813 4:185957997-185958019 AGGAGTTGAGTGGGGAAAGAAGG - Intergenic
985503576 5:264620-264642 AGGAGTGACCTGGGGCTGGCTGG + Intergenic
986797095 5:11223050-11223072 AGGAGTCACCTTGGCAGAGATGG - Intronic
988620015 5:32813369-32813391 AGTGGTTACCAGGGGCTAGATGG - Intergenic
989398508 5:40984061-40984083 ACAAGTTACCTGGGCAGAGAAGG + Intergenic
991627373 5:68617875-68617897 AGTAGTTGCCTGGGAATGGAGGG + Intergenic
997210526 5:132074357-132074379 AGGAGTCACCAGGGGACAGGTGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998268488 5:140685272-140685294 AGCAGTTACCAGGGGCTGGAGGG + Intronic
998772059 5:145556853-145556875 AGGAGTTACCTAGGCATATAGGG - Intronic
1000216401 5:159161257-159161279 AGGAGTTACCTGATAACAGATGG + Exonic
1000558008 5:162750896-162750918 AGGTGTTTTCTGGGGATATAGGG + Intergenic
1002908694 6:1471705-1471727 AGGCGTTACCTGAGTCTAGAGGG + Intergenic
1002917024 6:1537597-1537619 AGGAGTTACGTGGTGATAATGGG + Intergenic
1003646136 6:7914260-7914282 AGGAGTGACGTGGGGATGGTAGG - Intronic
1003860666 6:10319382-10319404 AGGTTTTCCGTGGGGATAGAGGG + Intergenic
1005809018 6:29502254-29502276 AGGTGTGGCCTGGGGATTGAAGG - Intergenic
1006269126 6:32950493-32950515 AGGAGTTTTCTGGGGAGTGAAGG - Intronic
1006334987 6:33415796-33415818 AGGGGTGACCTAGGGAGAGAAGG - Exonic
1006594523 6:35183045-35183067 ATGGGTTACCTGGAGATGGAGGG - Intergenic
1006635363 6:35457775-35457797 GGAAGTTACCTGGGGTTAGATGG - Intronic
1007466371 6:42054493-42054515 AGAAGTTACCAGGGGATGGAGGG - Intronic
1007715468 6:43853091-43853113 AGGAGTTACCTGGGGCAAAGTGG + Intergenic
1009627577 6:66155675-66155697 AGGACTTTCCTGGCTATAGAGGG + Intergenic
1010116249 6:72316281-72316303 AGGTGATACCTGGTGACAGATGG + Intronic
1010383550 6:75251488-75251510 AGGAGTTATTTGGGGAGTGATGG + Intergenic
1010888471 6:81273371-81273393 AGTAGTTACCAGGGGCTGGAGGG + Intergenic
1011596793 6:89024294-89024316 AAGAGTTAACTGGGCAAAGAGGG + Intergenic
1012669822 6:102030173-102030195 AGTAGTTACCAGGGGTTTGAGGG + Intronic
1013307447 6:108862677-108862699 AGGAGATAACTGGAGAGAGAGGG + Intronic
1014250290 6:119108680-119108702 AGGAGTCACCCAGGGATTGATGG + Intronic
1017133827 6:151130723-151130745 AGGACTTTTCTGGGGATAGCAGG + Intergenic
1019013001 6:168857625-168857647 AGTGGTTGCCTGGGGATAGAGGG + Intergenic
1019755285 7:2764223-2764245 AGAAATTAGCTGGGGATAGGTGG - Intronic
1020372556 7:7448974-7448996 AGAAGTTACAGAGGGATAGAAGG + Intronic
1022317163 7:29256242-29256264 AGAAGTTATCTGGGGCTTGAGGG - Intronic
1022405822 7:30088940-30088962 TGGAGTTTGCTGGGGAGAGATGG + Intronic
1024148902 7:46547507-46547529 AGTGGTTCCCTGGGGATGGAAGG + Intergenic
1027723416 7:81771961-81771983 AGGAGCCACCTTGGGAAAGAGGG - Intergenic
1028194668 7:87892256-87892278 AGGAGTTATCTGGGGTTTAAGGG - Intronic
1029598573 7:101550652-101550674 AGGAGTTCCCTTTGGAGAGAGGG + Intronic
1029923729 7:104294155-104294177 AGGATCTACCTTGGGATGGACGG - Intergenic
1030347753 7:108454165-108454187 AGGAGTTACATGGGAATAAAAGG + Intronic
1032499221 7:132387539-132387561 TAGAGTTACCTGGCGACAGATGG - Intronic
1033660013 7:143396611-143396633 AGGAGTCACCTTGGGAAACAGGG - Intronic
1035108852 7:156463821-156463843 AGGTGTCACCTGGGGGAAGAGGG + Intergenic
1037786775 8:21908069-21908091 AGGAGTTCCATGGAGATAAAGGG - Intergenic
1039414165 8:37379333-37379355 AGGGGTCACCTGGGGATAAGTGG - Intergenic
1041846181 8:62331251-62331273 AGGAGTTAGCTGGGGACAGGAGG - Intronic
1042440213 8:68817348-68817370 AAGAGTTAGCTGGGGTTAGTTGG + Intronic
1044843087 8:96354740-96354762 AGCAGTGACCTGGGGCTATAGGG + Intergenic
1046547495 8:115669336-115669358 AGGACTTACCTTGGGGTAGTGGG + Intronic
1048668716 8:136693432-136693454 AGGATGTACTTGAGGATAGAGGG - Intergenic
1051647659 9:19285475-19285497 AATAGTTACCTAGGGGTAGAAGG - Intronic
1053084457 9:35206387-35206409 AGTGGTTACCAGGGGATAGAGGG - Intronic
1054735718 9:68748053-68748075 AGGGGTTACCTCGGGCTACAGGG - Intronic
1055092217 9:72374550-72374572 AGTGGTTGCCAGGGGATAGAGGG + Intergenic
1055279433 9:74657564-74657586 AGGAGTTGCCTGGGTCTTGAAGG - Intronic
1056461068 9:86810357-86810379 GGGGGTTCCCTGGGGATGGAGGG + Intergenic
1057944641 9:99314641-99314663 AGTTGTTTCCTGGGGATGGATGG + Intergenic
1059137223 9:111818704-111818726 AGTGGTTACCAGGGGCTAGAGGG + Intergenic
1060111719 9:120911327-120911349 AGGTGTTACCTGGGGAGAAGAGG + Exonic
1060948043 9:127581893-127581915 AGGGATTACATGGGGAGAGAGGG - Intergenic
1060948084 9:127582024-127582046 AGGGATTACATGGGGAGAGAGGG - Intergenic
1060948093 9:127582051-127582073 AGGGATTACATGGGGAGAGAGGG - Intergenic
1061970481 9:134042131-134042153 AGGAATTGCCTGGGGAGGGAGGG - Intronic
1188341108 X:29003099-29003121 AGGAGTTTCCTGGGAAAATAAGG + Intronic
1188665727 X:32818640-32818662 AGGAGTTAACTGGGCCAAGAAGG + Intronic
1188703201 X:33291484-33291506 AGGCATTACATGGGGATAAATGG - Intronic
1189057580 X:37714512-37714534 AGGACTTACCTGGGGAGAAAGGG + Intronic
1189083205 X:37995452-37995474 ATGAGTTGCCTGGGAATATAAGG - Intronic
1190455895 X:50627655-50627677 AGGAATTTCCTGGGGACAAATGG - Exonic
1191902446 X:66054437-66054459 AGGAGTTATGTGGGAAGAGAGGG - Intergenic
1193693955 X:84683139-84683161 AGGAGTTACCTGTTTATATATGG + Intergenic
1193892615 X:87069062-87069084 GGGAGTTAGCTGGGTAAAGATGG - Intergenic
1196375925 X:115032390-115032412 AGGAGTAAAGTGGGGCTAGAGGG - Intergenic
1196458128 X:115904029-115904051 TGGAGTTCCCAGGGAATAGATGG + Intergenic
1197039205 X:121915259-121915281 AGGAGTGACTGGAGGATAGAAGG - Intergenic
1198338678 X:135692902-135692924 AAGAGTTTCTTGGGGATAGAAGG + Intergenic
1199071712 X:143483566-143483588 AGTAGTTGCCAGGGGTTAGAGGG - Intergenic
1202169583 Y:22027861-22027883 AGCAGTTATTTGAGGATAGATGG + Intergenic
1202221782 Y:22558512-22558534 AGCAGTTATTTGAGGATAGATGG - Intergenic
1202321336 Y:23637162-23637184 AGCAGTTATTTGAGGATAGATGG + Intergenic
1202549431 Y:26032894-26032916 AGCAGTTATTTGAGGATAGATGG - Intergenic