ID: 1094133182

View in Genome Browser
Species Human (GRCh38)
Location 12:27097022-27097044
Sequence TGCCTTGACCTCCCAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094133182_1094133185 16 Left 1094133182 12:27097022-27097044 CCAGTTTCTGGGAGGTCAAGGCA No data
Right 1094133185 12:27097061-27097083 CTCTGCAGCCCACTGACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094133182 Original CRISPR TGCCTTGACCTCCCAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr