ID: 1094140640

View in Genome Browser
Species Human (GRCh38)
Location 12:27178303-27178325
Sequence ATGAACAAAAAGAAGGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094140640_1094140645 26 Left 1094140640 12:27178303-27178325 CCTCCAACCTTCTTTTTGTTCAT No data
Right 1094140645 12:27178352-27178374 TAGATCTTGGCTAAATAGAGTGG No data
1094140640_1094140644 13 Left 1094140640 12:27178303-27178325 CCTCCAACCTTCTTTTTGTTCAT No data
Right 1094140644 12:27178339-27178361 ATCATTAGTGAAGTAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094140640 Original CRISPR ATGAACAAAAAGAAGGTTGG AGG (reversed) Intergenic
No off target data available for this crispr