ID: 1094143155

View in Genome Browser
Species Human (GRCh38)
Location 12:27201573-27201595
Sequence AATGCACAATACGATACTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094143155_1094143157 20 Left 1094143155 12:27201573-27201595 CCGCTAGTATCGTATTGTGCATT No data
Right 1094143157 12:27201616-27201638 AAAAGACGCAGTCTAAAGTCCGG No data
1094143155_1094143158 30 Left 1094143155 12:27201573-27201595 CCGCTAGTATCGTATTGTGCATT No data
Right 1094143158 12:27201626-27201648 GTCTAAAGTCCGGTGTAGTACGG No data
1094143155_1094143156 -6 Left 1094143155 12:27201573-27201595 CCGCTAGTATCGTATTGTGCATT No data
Right 1094143156 12:27201590-27201612 TGCATTGCGCAGAGAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094143155 Original CRISPR AATGCACAATACGATACTAG CGG (reversed) Intergenic
No off target data available for this crispr