ID: 1094143158

View in Genome Browser
Species Human (GRCh38)
Location 12:27201626-27201648
Sequence GTCTAAAGTCCGGTGTAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094143155_1094143158 30 Left 1094143155 12:27201573-27201595 CCGCTAGTATCGTATTGTGCATT No data
Right 1094143158 12:27201626-27201648 GTCTAAAGTCCGGTGTAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094143158 Original CRISPR GTCTAAAGTCCGGTGTAGTA CGG Intergenic
No off target data available for this crispr