ID: 1094147353

View in Genome Browser
Species Human (GRCh38)
Location 12:27244323-27244345
Sequence TCCGCGAACTCACCTGCCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094147353_1094147355 -5 Left 1094147353 12:27244323-27244345 CCGGAGGCAGGTGAGTTCGCGGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1094147355 12:27244341-27244363 GCGGATGTAGCGCTCGGCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 45
1094147353_1094147356 -4 Left 1094147353 12:27244323-27244345 CCGGAGGCAGGTGAGTTCGCGGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1094147356 12:27244342-27244364 CGGATGTAGCGCTCGGCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094147353 Original CRISPR TCCGCGAACTCACCTGCCTC CGG (reversed) Exonic