ID: 1094157689

View in Genome Browser
Species Human (GRCh38)
Location 12:27354687-27354709
Sequence GTGACTTCCATATTTACGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094157689 Original CRISPR GTGACTTCCATATTTACGCT TGG Intronic
903162447 1:21498877-21498899 GTGACTTCCATATATCACCTGGG + Intergenic
910416046 1:86999818-86999840 GTGAATTCCATACCTACTCTAGG - Intronic
915031707 1:152885346-152885368 GGGACTTACATATTTTTGCTTGG - Intergenic
915773854 1:158460928-158460950 GTGACTTCAAAATTTATGCATGG + Intergenic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
922846905 1:228693430-228693452 GGGACTTCTATATTTCAGCTGGG - Intergenic
1071408774 10:85365848-85365870 GTGTCTTCCATTTTCAGGCTTGG + Intergenic
1071951812 10:90711840-90711862 GTGACTGGCATATTTGCTCTAGG - Intergenic
1080756512 11:35205322-35205344 GTGAATTCCATATTCTCACTTGG + Intronic
1084053701 11:66617375-66617397 GTCACTTCCCAATTTCCGCTGGG - Intronic
1084674751 11:70627674-70627696 GTGAATTTCATATTTAGACTTGG - Intronic
1085918741 11:80925470-80925492 GTGACTTCAATAATTACGAAAGG + Intergenic
1088045147 11:105441981-105442003 GTGAATTTTATATTTACACTTGG - Intergenic
1089809398 11:121119294-121119316 GTGACTTCCTTAGTGAGGCTTGG + Intronic
1094157689 12:27354687-27354709 GTGACTTCCATATTTACGCTTGG + Intronic
1099235798 12:80080997-80081019 TTGACTTCCATGTTTAGTCTTGG + Intergenic
1099839049 12:87943120-87943142 GTGGCTTCCAGATTCACCCTGGG + Intergenic
1100266016 12:92977383-92977405 GTGACTGCCTTATTTCCGTTTGG + Intergenic
1100959646 12:99948098-99948120 GTTACTTCCATAATTATGTTAGG - Intronic
1101249279 12:102916366-102916388 GTGACCTACATATTTACCCATGG - Intronic
1108875207 13:55039224-55039246 GTGATTTTCATATTTAAGTTAGG + Intergenic
1109249737 13:60004946-60004968 GTGACTTCCATAACTACGGAAGG + Intronic
1109793197 13:67276590-67276612 GTGACTTACATTATTACACTTGG - Intergenic
1135252182 16:20910055-20910077 GAGACATCCATATTTTCACTGGG + Intronic
1140516297 16:75544720-75544742 GTGTCTTCCATACACACGCTTGG - Intronic
1144105480 17:11981167-11981189 GTGACTTCCACAATTATTCTAGG + Intronic
1144193419 17:12867480-12867502 GTGACTTGCAAATTTCCCCTGGG - Intronic
1152501388 17:80712223-80712245 ATGATGTCCATATTTACACTAGG + Intronic
1157744148 18:50120252-50120274 GAGTCTTCCACATTTACACTCGG - Intronic
1167927201 19:52830959-52830981 GTAATTTGCATATTTAAGCTTGG - Intronic
930326042 2:49919389-49919411 GTAACTTTAAAATTTACGCTGGG + Intronic
945988477 2:216372830-216372852 GTGACTTCCACAATGAAGCTGGG + Intergenic
951103396 3:18715225-18715247 GTGACTTCCATGTTGAGGATAGG - Intergenic
952093828 3:29924220-29924242 GTGACATCCATTTTTCCGGTGGG - Intronic
957907909 3:86581447-86581469 GTTACTTACACATTTACCCTAGG + Intergenic
967786492 3:193502616-193502638 ATGAATTCCAAATTTACTCTTGG - Exonic
969292541 4:6249278-6249300 GAGAGTTCCATATTTATGCAGGG - Intergenic
971903286 4:32692074-32692096 GTGATTTCCTTATATACCCTTGG - Intergenic
975981303 4:80162817-80162839 TTGACTTACATATTTATCCTTGG + Intergenic
976872882 4:89817113-89817135 GAGACTGACATATTTACCCTGGG - Intronic
977935190 4:102793924-102793946 TTGATTTCCACATTTACACTTGG - Intergenic
979911811 4:126376766-126376788 GTCACTTCCAAATTTAATCTAGG + Intergenic
982661569 4:158213650-158213672 CTGACTTCCATATTAAAGCCAGG + Intronic
995493175 5:112713267-112713289 GTGCTTTCCATCTTTATGCTTGG + Intronic
1002192159 5:177483924-177483946 GTGACTTCAAGATCGACGCTGGG - Exonic
1008288912 6:49688219-49688241 GTGACATGCATATTTACAGTTGG + Intergenic
1021317273 7:19164256-19164278 GTGACTTCCATTTTTAGGCAAGG + Intergenic
1023376458 7:39560963-39560985 GTGACATCAAAATTTACGCAGGG + Intergenic
1024418556 7:49136249-49136271 CTGACTTCCCTACTTACGTTAGG + Intergenic
1027400866 7:77805019-77805041 GTGACTTGCACATGTAGGCTTGG + Intronic
1030710360 7:112741812-112741834 GTGAATTCCATGTTTAGACTTGG - Intergenic
1030790887 7:113727117-113727139 GTGAAATCCATATTTACGGAGGG - Intergenic
1031131436 7:117837604-117837626 GTGAATTTCATATTTAGACTTGG - Intronic
1032611702 7:133422343-133422365 GTGATTTCCATGTTTAAGCTTGG + Intronic
1046679540 8:117153142-117153164 GTGTCTTCCACTTTTACCCTTGG - Intronic
1055756100 9:79559147-79559169 ATGACTTCCATATTAAAGCTGGG - Intergenic
1188804322 X:34569363-34569385 GTGACCTGCATATATACGCCCGG + Intergenic
1189943479 X:46152692-46152714 GTCAATTCCATACTTTCGCTGGG - Intergenic
1190422066 X:50295089-50295111 GTGACTACCACATTAACCCTGGG + Intronic
1192179942 X:68910144-68910166 GTGACTTCCCTATTTCCCATGGG + Intergenic
1192894838 X:75431424-75431446 GTGACGGCCATATTTCCCCTGGG - Intronic
1195993870 X:110711915-110711937 GTGACTTCCATTTTCTCCCTGGG + Intronic
1202082906 Y:21103214-21103236 GTGTCTAACATATTTAAGCTAGG + Intergenic