ID: 1094162333

View in Genome Browser
Species Human (GRCh38)
Location 12:27404842-27404864
Sequence GTCACCCCTTTGACTAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 3, 1: 9, 2: 2, 3: 10, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094162333_1094162339 0 Left 1094162333 12:27404842-27404864 CCTTTCCTAGTCAAAGGGGTGAC 0: 3
1: 9
2: 2
3: 10
4: 79
Right 1094162339 12:27404865-27404887 AGATGGGCACCTGGAAAATCGGG 0: 1
1: 0
2: 8
3: 60
4: 830
1094162333_1094162338 -1 Left 1094162333 12:27404842-27404864 CCTTTCCTAGTCAAAGGGGTGAC 0: 3
1: 9
2: 2
3: 10
4: 79
Right 1094162338 12:27404864-27404886 CAGATGGGCACCTGGAAAATCGG 0: 1
1: 0
2: 3
3: 17
4: 204
1094162333_1094162337 -9 Left 1094162333 12:27404842-27404864 CCTTTCCTAGTCAAAGGGGTGAC 0: 3
1: 9
2: 2
3: 10
4: 79
Right 1094162337 12:27404856-27404878 AGGGGTGACAGATGGGCACCTGG 0: 1
1: 0
2: 0
3: 34
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094162333 Original CRISPR GTCACCCCTTTGACTAGGAA AGG (reversed) Intronic
902187255 1:14734667-14734689 GTCCACACTTTGACTAGCAAAGG + Intronic
910339381 1:86168239-86168261 GTCACAGCTTTGCTTAGGAAAGG + Intergenic
912561282 1:110553369-110553391 GTCAGCACTTTGACTTGGAGTGG + Intergenic
913721844 1:121604066-121604088 GTCATCCCTTTGTCTAGGAAAGG + Intergenic
920826853 1:209430712-209430734 TTCTTCCCTTTGACTGGGAATGG + Intergenic
924125505 1:240846505-240846527 GTCACCCTCTTCACTGGGAAGGG + Intronic
1064682580 10:17825867-17825889 GTCATCCCAGTGACTAAGAATGG + Intronic
1077655707 11:4016979-4017001 GGCTTCCCTTTGGCTAGGAAAGG + Intronic
1079181309 11:18196152-18196174 GACACCCCCATGACTAGGAGTGG - Intronic
1079466965 11:20740283-20740305 GTCACTCCTCAAACTAGGAAAGG + Intronic
1080254061 11:30269039-30269061 GTCACCGCTTTGACTAGGAAAGG + Intergenic
1082122243 11:48391785-48391807 GTCACTCCTTTGACTAGGAAAGG + Intergenic
1082556224 11:54566027-54566049 ATCGCCCCTTTGACTAGGAAAGG + Intergenic
1083006311 11:59350066-59350088 GCCATTTCTTTGACTAGGAAAGG + Intergenic
1084404187 11:68961462-68961484 GACACCCCTGTGGCCAGGAAGGG - Intergenic
1087687488 11:101281231-101281253 GTCACCCCTTTGATTAGGAAAGG + Intergenic
1089319579 11:117615858-117615880 GTCACTTCTATGACTAGGGATGG + Intronic
1089788517 11:120925247-120925269 GTCAGCCCTGTAATTAGGAATGG - Intronic
1091811010 12:3397987-3398009 ATCACCCCTTTGACTAGGAAAGG + Intronic
1094162333 12:27404842-27404864 GTCACCCCTTTGACTAGGAAAGG - Intronic
1095535581 12:43242727-43242749 GTACCCCCTTTGTCTAGGACAGG + Intergenic
1095959381 12:47824533-47824555 GTCACCCCCTTGACTATGCCAGG + Intronic
1096393561 12:51248327-51248349 GTCCCCTCTTTGTCTAGGAATGG + Intronic
1096497866 12:52049123-52049145 GTCACCCCTTGGTTTATGAAGGG + Intronic
1099881035 12:88467134-88467156 GTCACCCCTTTGACTCGGAAAGG + Intergenic
1106437613 13:29737582-29737604 ATCAACCCTTGGACTAAGAAAGG - Intergenic
1106890598 13:34241556-34241578 GTCTACCTATTGACTAGGAAAGG - Intergenic
1110919881 13:81069990-81070012 GTCACCCCTTTGACTAGGAAAGG + Intergenic
1111744828 13:92254432-92254454 CTCACCTCTTTGACCAGAAAAGG + Intronic
1113458330 13:110464609-110464631 GTCATGCCTTTGACAAGGAAGGG + Intronic
1120846353 14:89129423-89129445 GTCACTTCTTGGACCAGGAAAGG + Intronic
1123896139 15:24832339-24832361 GTAATCCCTTTGAGTAGCAATGG - Intronic
1125593937 15:40872692-40872714 CTCACCCCTGTGCCAAGGAAGGG + Exonic
1134197121 16:12167848-12167870 GTAACCCATTTGTTTAGGAATGG + Intronic
1134876174 16:17700931-17700953 GTCATCCATTTGATTAGAAATGG - Intergenic
1134878770 16:17726047-17726069 GTGACCAATTAGACTAGGAAGGG - Intergenic
1135926486 16:26698252-26698274 TCCACCCATTTTACTAGGAAGGG - Intergenic
1137325004 16:47425353-47425375 GGCTTCCCTTTGGCTAGGAAAGG + Intronic
1148149519 17:45388420-45388442 TTAACCCCTTAGACCAGGAAGGG + Intergenic
1149565646 17:57639033-57639055 GCCACCTCTTTGACCATGAAAGG - Intronic
1156581843 18:38386245-38386267 CTCTCCCCTCTGACTTGGAATGG + Intergenic
1157180326 18:45492052-45492074 GGAACCCCTGTGACTAGGAATGG - Intronic
1161320296 19:3637897-3637919 GTCACCCCTTTTCCTGGGACTGG - Intronic
1162810041 19:13158632-13158654 GTCACCCCATTGCCTTGGCAAGG + Intergenic
1167307842 19:48719378-48719400 GGGACCCCTGTGTCTAGGAAAGG + Intronic
1167914917 19:52733038-52733060 GTCTCCCCTTTTCCTAGGATGGG - Intronic
936873004 2:117156259-117156281 GTCACCCCTTTCTTTGGGAAAGG - Intergenic
938594818 2:132777273-132777295 TTCACCCCTGTTTCTAGGAAGGG + Intronic
939554848 2:143661786-143661808 GTCACCCCTTTGACTCGGAAAGG - Intronic
941381214 2:164794579-164794601 GTCATCCCTGTGCCTAGTAAAGG - Intronic
941624000 2:167810180-167810202 GTCACCGCTTTGACTAGGAAAGG + Intergenic
941638760 2:167964420-167964442 GTCACACCTTTGACTAAGAGCGG - Intronic
942228176 2:173835051-173835073 GCCTCGCCTTTGACTATGAATGG + Intergenic
945072112 2:206002073-206002095 ATCAGCCCTTTGACAAGGAAGGG - Exonic
946472893 2:219979214-219979236 GTCACCCCATGGACTAGCACAGG - Intergenic
946662360 2:222015098-222015120 GTCAACCCTTTGACTCTGACTGG + Intergenic
948144396 2:235697511-235697533 GTCACCCCTGTGCCTGGGAGGGG + Intronic
948855027 2:240726109-240726131 GTCACCTCTTGCACTTGGAAGGG + Intronic
1170423097 20:16211819-16211841 GTGTCCACTTTGACCAGGAAAGG + Intergenic
1172603175 20:36197496-36197518 GTCACCTCTGTGACTAAGACCGG + Intronic
1180915684 22:19484820-19484842 GTCACCCCTTTCACTAGGTTTGG + Intronic
950631342 3:14284128-14284150 TTCACCCCTTTTTCTAGGAGGGG + Intergenic
950835227 3:15913130-15913152 GCCACCCCTTTGACTAGGAAAGG + Intergenic
951311698 3:21134036-21134058 ATCACCCCTTTCACTTTGAAAGG - Intergenic
951442937 3:22743510-22743532 GTCACCCCATTGACTAGGAAAGG + Intergenic
951504989 3:23435438-23435460 CTCACCCCTTTGACAAGGGAAGG + Intronic
956215340 3:66843023-66843045 CTCATTTCTTTGACTAGGAAAGG - Intergenic
958688444 3:97428992-97429014 CTCACCCCTTTGACTTGGACAGG + Intronic
958923868 3:100136561-100136583 GTTACAACTTTCACTAGGAAAGG - Intronic
960055122 3:113271478-113271500 GTCACTCCTTTGAATTGGCAGGG - Intronic
965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG + Intronic
966497705 3:180599883-180599905 GACACCCCTTTGACTTTGAAGGG - Intergenic
966537139 3:181047442-181047464 TTCACCCCTGACACTAGGAACGG + Intergenic
969879037 4:10157803-10157825 GTCACCCCTTCTCCTAGGAAAGG - Intergenic
972370791 4:38421307-38421329 TTCACTTCTTTGACTAGGCAAGG - Intergenic
978343406 4:107740529-107740551 GTGACTCCTATGCCTAGGAAAGG - Intergenic
982470871 4:155788478-155788500 GTCACCCATGTGACTAGGTTGGG + Intronic
985187478 4:187333117-187333139 GTAAGCCCTTGGAGTAGGAAAGG - Intergenic
988984444 5:36603115-36603137 GGCTCCCCATTGACTAGGAGTGG + Intergenic
990331883 5:54735843-54735865 TTCATCCCATTGACTAGGGAGGG + Intergenic
1000736586 5:164909902-164909924 GTCACAGCTGTGACAAGGAAGGG - Intergenic
1004099101 6:12590739-12590761 TTCACCCTTTTGACAAAGAAGGG - Intergenic
1009940429 6:70282702-70282724 ATGACCCCTTGGTCTAGGAAGGG - Intronic
1010144631 6:72652778-72652800 CTCAGTCCTTTGACTAGGATTGG - Intronic
1010603632 6:77862315-77862337 CTCATTTCTTTGACTAGGAAAGG - Intronic
1016150239 6:140732019-140732041 GTTACTACTTTTACTAGGAAAGG + Intergenic
1016866778 6:148775446-148775468 GCCACCCCTCAGACTTGGAAAGG + Intronic
1021921605 7:25490788-25490810 GTGACTCCTTTGAGTAAGAAAGG - Intergenic
1024944670 7:54796760-54796782 GTGACCCCATTGTCTAGGGAAGG + Intergenic
1026556272 7:71411408-71411430 GTCACCCCCTTGGCCAGGCACGG - Intronic
1034918498 7:155060130-155060152 TTCACCCCATTGATGAGGAAGGG - Intergenic
1036095744 8:5723778-5723800 GTCACCCCGTTACTTAGGAATGG - Intergenic
1041879710 8:62735849-62735871 CTCCCCCCTTTCCCTAGGAATGG + Intronic
1042487028 8:69357169-69357191 GTCACCCCTTTGACTAGGAAAGG + Intergenic
1043120470 8:76316249-76316271 GTCAACCATATGACTAGAAATGG - Intergenic
1044505397 8:93011570-93011592 ACCACCTCTTTGACCAGGAAGGG - Intronic
1049789030 8:144464658-144464680 GTCACCCTTTTAAACAGGAAAGG + Intronic
1061565418 9:131436038-131436060 GTCAGCCCTCTGAGTAGGTATGG + Intronic
1062577803 9:137216676-137216698 GCCACCACCTTGACTGGGAAGGG - Exonic
1193426782 X:81349139-81349161 GTAACCCCATTGTGTAGGAAAGG + Intergenic
1193609010 X:83605992-83606014 GTCACCGCCTTGCCTAGAAATGG - Intergenic
1195700278 X:107700167-107700189 GTAACCCATTTGAGTAGGGAAGG - Intergenic
1197797735 X:130316380-130316402 ATCACCCCTTTGATGATGAAAGG + Intergenic