ID: 1094165455

View in Genome Browser
Species Human (GRCh38)
Location 12:27438367-27438389
Sequence CTGGAGCTAAGGAGAAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094165455_1094165458 2 Left 1094165455 12:27438367-27438389 CCTGATCTTCTCCTTAGCTCCAG No data
Right 1094165458 12:27438392-27438414 CAATGCAGCCGACAGCCTACTGG No data
1094165455_1094165461 26 Left 1094165455 12:27438367-27438389 CCTGATCTTCTCCTTAGCTCCAG No data
Right 1094165461 12:27438416-27438438 CATATCTGTTAATATGTTCCAGG No data
1094165455_1094165462 27 Left 1094165455 12:27438367-27438389 CCTGATCTTCTCCTTAGCTCCAG No data
Right 1094165462 12:27438417-27438439 ATATCTGTTAATATGTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094165455 Original CRISPR CTGGAGCTAAGGAGAAGATC AGG (reversed) Intergenic
No off target data available for this crispr