ID: 1094169857

View in Genome Browser
Species Human (GRCh38)
Location 12:27480225-27480247
Sequence CTGCCAGCACAGCTGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094169857_1094169865 12 Left 1094169857 12:27480225-27480247 CCTTGTTCCAGCTGTGCTGGCAG 0: 1
1: 0
2: 2
3: 24
4: 282
Right 1094169865 12:27480260-27480282 TGTCCACCCACACTGAGGGTGGG 0: 4
1: 40
2: 250
3: 785
4: 1290
1094169857_1094169863 8 Left 1094169857 12:27480225-27480247 CCTTGTTCCAGCTGTGCTGGCAG 0: 1
1: 0
2: 2
3: 24
4: 282
Right 1094169863 12:27480256-27480278 ATGGTGTCCACCCACACTGAGGG 0: 5
1: 53
2: 289
3: 770
4: 1257
1094169857_1094169864 11 Left 1094169857 12:27480225-27480247 CCTTGTTCCAGCTGTGCTGGCAG 0: 1
1: 0
2: 2
3: 24
4: 282
Right 1094169864 12:27480259-27480281 GTGTCCACCCACACTGAGGGTGG 0: 4
1: 43
2: 258
3: 800
4: 1386
1094169857_1094169862 7 Left 1094169857 12:27480225-27480247 CCTTGTTCCAGCTGTGCTGGCAG 0: 1
1: 0
2: 2
3: 24
4: 282
Right 1094169862 12:27480255-27480277 GATGGTGTCCACCCACACTGAGG 0: 7
1: 66
2: 290
3: 909
4: 1505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094169857 Original CRISPR CTGCCAGCACAGCTGGAACA AGG (reversed) Intronic
900174584 1:1286143-1286165 CTGCCAGCAGAGCGCGACCAGGG - Exonic
902399560 1:16150598-16150620 CTGTCAGCCCTTCTGGAACATGG + Intronic
903009592 1:20320343-20320365 CTGCCCGCCTAGCTGGCACAGGG + Intronic
904007729 1:27372633-27372655 CTGCCGGCACTGACGGAACATGG - Intronic
905937718 1:41838003-41838025 CTGAAAGGAGAGCTGGAACATGG - Intronic
906495823 1:46303167-46303189 CCGCCCGCACAGCTCGAACAGGG + Exonic
908525611 1:64984886-64984908 CTGCCATCACAGCTGGGCCAGGG + Intergenic
909388973 1:75095845-75095867 CTGCCAGTGCAGCTAGAAAAAGG + Intergenic
911339479 1:96619296-96619318 CTGCCAGCAAGGCTAGAATAAGG - Intergenic
911473324 1:98345414-98345436 CTCCCATCACAGCTAGAAAACGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912272944 1:108229018-108229040 CTGCGACTACAGCTGGATCAAGG - Exonic
912295276 1:108465304-108465326 CTGCGACTACAGCTGGATCAAGG + Exonic
915145861 1:153795389-153795411 CAGCCAGCACAGCCTGAACACGG - Intergenic
915264795 1:154709113-154709135 CGGCCGGCACCCCTGGAACACGG - Intronic
916730656 1:167563836-167563858 CTGCCTGCACAGCTGCATCAGGG - Intergenic
917525644 1:175786030-175786052 CTGCCATGACAGCTGGGCCAGGG + Intergenic
917750311 1:178047324-178047346 CTACCACCACTCCTGGAACATGG + Intergenic
917887223 1:179398571-179398593 GAGGCAGCACAGCTGGAAGAGGG + Intronic
918199980 1:182257821-182257843 CTACCAGCATTGCTGGAAGAAGG + Intergenic
918210817 1:182349451-182349473 ATGCCAGAACAGCTAGAAGATGG - Intergenic
919805524 1:201379065-201379087 CTGCCAGCACATCTGTGGCAGGG + Intronic
920049063 1:203152345-203152367 CCGCCAGCCCAGCTGGCACATGG - Intronic
921778361 1:219129675-219129697 CTTCCAGCATATCTGGCACATGG - Intergenic
923387845 1:233483332-233483354 CTACCAGCACAGCTGCAATTGGG - Intergenic
1063553120 10:7052059-7052081 CTACCAGCATGGCTGGAACAAGG - Intergenic
1065378860 10:25068817-25068839 CCACCACCCCAGCTGGAACAAGG + Intergenic
1066963623 10:42242394-42242416 CGCGCAGCACGGCTGGAACATGG - Intergenic
1067052149 10:43027837-43027859 CTGCCAGCACAGCAGGAAAGTGG + Intergenic
1067378861 10:45753964-45753986 CAGCCCGCACAGCAGGCACAAGG - Intronic
1067661508 10:48239396-48239418 CTGACAGCACAGCTGCCACCAGG + Intronic
1067886564 10:50094626-50094648 CAGCCCGCACAGCAGGCACAAGG - Intronic
1070284654 10:75073931-75073953 GTCCCAGAACAGCTAGAACAGGG + Intergenic
1070734726 10:78855645-78855667 CCGCTAGTTCAGCTGGAACATGG - Intergenic
1070892024 10:79948172-79948194 CTGCCAGAACAGGTGTAACAAGG - Intronic
1071308834 10:84324630-84324652 CTGCCAGCACGGCTAGAATAAGG + Intergenic
1071598815 10:86946312-86946334 CTGCCAGGGCAGCTGGAATGGGG - Intronic
1072443156 10:95475178-95475200 ATGCCAGCAGATCTGGCACATGG + Intronic
1072807584 10:98434206-98434228 CTGCCCACACAGCTGGGAAAGGG + Intronic
1075552591 10:123403060-123403082 TTCCAAGCACAGCTGGAATATGG + Intergenic
1077308495 11:1878299-1878321 CTGCCTCCTCAGGTGGAACAAGG + Intronic
1077662899 11:4085029-4085051 CTCCCAGCCCAGATGGAAGAAGG - Intronic
1080668664 11:34357373-34357395 CCGCCACAACAGCTGGGACACGG - Exonic
1081627840 11:44666182-44666204 CTGCCAGCAGAGCCGGGCCAGGG - Intergenic
1083140614 11:60718306-60718328 CAGCCAGCACAGGTGTACCATGG - Intergenic
1084012515 11:66360537-66360559 CTGTCGGCAGAGCTGTAACAGGG + Intronic
1085201448 11:74704617-74704639 CTCCCAGCATCACTGGAACATGG + Exonic
1085454810 11:76659830-76659852 CTGGCAGCCCAGCTGCACCAGGG - Exonic
1086552486 11:88069148-88069170 CTGCCAGCACCGCTGGCTCTGGG + Intergenic
1087840396 11:102914785-102914807 CTCCCAGAATAGTTGGAACATGG - Intergenic
1088853659 11:113726610-113726632 CTGCCAGCAAAGCAGTAAGAAGG - Intergenic
1090003410 11:122980740-122980762 CTGCCAGCATTGCTGGAGCCGGG - Intronic
1090640121 11:128722877-128722899 CAGCCTGAACAGCTAGAACAGGG - Intronic
1091270795 11:134310500-134310522 CTGCCAGCGGTGCTGAAACAGGG + Intronic
1092695958 12:11171466-11171488 CTGCCAGGCCAGCTCGAAGAAGG - Intronic
1092881894 12:12893131-12893153 CTCCCAGCTCCGCAGGAACATGG + Intronic
1093822438 12:23637929-23637951 CTACCACCACAGCTCTAACAGGG + Intronic
1094169857 12:27480225-27480247 CTGCCAGCACAGCTGGAACAAGG - Intronic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1097371140 12:58782878-58782900 CTGCCAGCGCAGCTAGAATAAGG + Intronic
1098438787 12:70497081-70497103 CTGCCAGCACAGCAGTCAGAAGG - Intergenic
1100232375 12:92621295-92621317 CTGCCAGCACACTTGTAACGGGG + Intergenic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1101681867 12:106976170-106976192 CAGCCAGTACAGTTGGAGCAGGG - Intronic
1103020635 12:117531170-117531192 CTACCTGCTCAGCTGGACCAGGG + Intronic
1104133448 12:125916364-125916386 CTACCAGCATGGCTGGAACAAGG + Intergenic
1104381513 12:128311983-128312005 CTTTCAGCACAGCTGGAAGTTGG - Intronic
1104700343 12:130898303-130898325 CTGCCAGCGCGGCTGGGACAAGG - Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1106722939 13:32454884-32454906 CTACCAGCTCAGCTGGAATCAGG + Intronic
1107181786 13:37469829-37469851 CTGCCAGTGCAGCTGGAACAAGG + Intergenic
1107274284 13:38659380-38659402 ATGGCAGCACAGATGAAACATGG - Intergenic
1108002046 13:45912664-45912686 CTGGAAGCACAGCTTGAAGATGG - Intergenic
1109929049 13:69188318-69188340 TTGCCATCTCAGCTGGAAAAAGG + Intergenic
1110744696 13:79038875-79038897 GTGCCAGCAGATTTGGAACATGG + Intergenic
1112418104 13:99221680-99221702 CTACCATCCCAGGTGGAACAGGG - Intronic
1113346549 13:109483425-109483447 CTGCCAGGTCAGCTGGAAGTGGG - Intergenic
1114672255 14:24417506-24417528 CTGAGAGCACTGCTGGGACAGGG - Exonic
1116508546 14:45715359-45715381 CTGCCAGCAGACTTGTAACAGGG + Intergenic
1118120767 14:62839444-62839466 GTGACAGCACAGATGGCACAGGG - Intronic
1119153544 14:72387746-72387768 TTGCCAGCACTGCCGTAACAAGG + Intronic
1119526060 14:75323393-75323415 GAGCCAGGACAGCTGGAGCAGGG - Intergenic
1121467595 14:94126095-94126117 CTGCCTGCACAGCTGAACCCAGG - Intergenic
1122724178 14:103739730-103739752 CTCCCAGCACAGCCTGACCAAGG + Intronic
1124075265 15:26438062-26438084 CAGCCAGCCCAGCTGGAGTAAGG - Intergenic
1124621167 15:31274896-31274918 CTCCCAGAACAGCTGGAGAAGGG + Intergenic
1125423797 15:39530143-39530165 TTGCCAGCACAGCTAGAATAAGG - Intergenic
1129182552 15:73886368-73886390 CTCCCAGGGCAGCTGGAAAAGGG + Intronic
1129469101 15:75740471-75740493 CTGCCACCACTGCTGGCACCAGG + Intergenic
1129706669 15:77798378-77798400 CTGCCAGCTCAGGTGGAGCTGGG - Intronic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1131237566 15:90710367-90710389 CTGCCAGTACAGCAGGATCCAGG + Intergenic
1131533881 15:93217508-93217530 ATGCCACCACAGCTGGCCCAGGG - Intergenic
1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG + Intergenic
1132682742 16:1150054-1150076 GTGCCCGCACGCCTGGAACATGG - Intergenic
1132898245 16:2238904-2238926 CTGTGAGCACAGCTGGGACAGGG + Intergenic
1133969212 16:10555129-10555151 CTCACAGCAAAGCAGGAACAAGG + Intronic
1134288796 16:12886586-12886608 CTGCCACCATTGCTGGCACATGG - Intergenic
1136843104 16:33554927-33554949 CGAGCAGCACAGCGGGAACATGG - Intergenic
1137620102 16:49870497-49870519 CTGTCAGGACAGCTGGACCCTGG - Intergenic
1137629158 16:49930083-49930105 CCTTCAGCACAGCTGGACCAAGG - Intergenic
1140316403 16:73902056-73902078 CTGCCAGCGCGGCTAGAAAAAGG + Intergenic
1141684656 16:85563458-85563480 CTTCCAGCACAGCTGTAATTGGG - Intergenic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1142262522 16:89049619-89049641 GTGCCCGCACAGCTGGCACTGGG + Intergenic
1203153269 16_KI270728v1_random:1855225-1855247 CGAGCAGCACAGCGGGAACATGG - Intergenic
1143364895 17:6400627-6400649 CTGCCAGTGCAGCTAGCACAAGG + Intronic
1144390503 17:14789238-14789260 CTGACAGTCCAGCGGGAACATGG - Intergenic
1144731591 17:17529242-17529264 CTGGCAGGACAGGTGGAACTGGG - Intronic
1146571852 17:33959694-33959716 CTGCCAGCATGGCTAGAATAAGG - Intronic
1146656039 17:34635907-34635929 ATCCCAGCACTGCTGGAAGAGGG - Intronic
1147614452 17:41819953-41819975 CTCCCAGCACAGCTGGGTCCTGG - Intronic
1148132520 17:45270652-45270674 ACCCCAGCACAGCGGGAACAGGG - Intronic
1149314388 17:55424796-55424818 CTGGGAGAACAGCTTGAACAAGG + Intergenic
1150992581 17:70277106-70277128 CTGCCACTGCATCTGGAACAGGG + Intergenic
1151232755 17:72696375-72696397 CTACCAGGACAGCTGCAAGAGGG + Intronic
1151294943 17:73178172-73178194 CTGGCAGCACAGCTGAGACTAGG - Intergenic
1151592232 17:75053003-75053025 CCTCCAGCACACCTGGAACAAGG - Exonic
1152097070 17:78278534-78278556 CTTCAAGCACAGCTGGCACCTGG - Intergenic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1154335559 18:13462146-13462168 CTGCAAGCACAGCAGAACCAAGG + Intronic
1157291975 18:46416110-46416132 TTGCCAGCACATCTGGGAAAAGG + Intronic
1160251168 18:77204618-77204640 CTGCCATCACAGCTAAAAAAAGG - Intergenic
1160628253 18:80228172-80228194 CTCTGAGCACAGCTGGAAAAGGG + Intronic
1160949536 19:1658794-1658816 GAGCCTGCAAAGCTGGAACAGGG + Intergenic
1161014440 19:1976687-1976709 CTGCCAGTCCAGCTGCAGCAGGG + Intronic
1161300800 19:3542317-3542339 CTGCCATGAGAGCTGGAACCGGG + Intronic
1161951789 19:7471604-7471626 CTGCCAGCACAGTGGGAGAAGGG - Exonic
1162081852 19:8222831-8222853 CTCACAGCACAGGTGGAAGACGG + Intronic
1162086806 19:8254358-8254380 CAGAGAGCACAGCTGGCACATGG - Intronic
1163389593 19:17022234-17022256 CTGCCACCACAGCTAGGTCAGGG + Intronic
1164500917 19:28819573-28819595 CTGCCAGCACAGAGGGCAGAGGG - Intergenic
1165257997 19:34591653-34591675 TGGCCAGTGCAGCTGGAACAAGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
925832570 2:7910533-7910555 CTGCCAGCACAGCTTACCCAAGG + Intergenic
926197841 2:10774470-10774492 CCGTCACCACAGCTGGCACAGGG - Intronic
927202104 2:20584252-20584274 CTGCCAGCATGGCTGGGCCATGG - Intronic
927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG + Intronic
927939849 2:27096623-27096645 CTGCCAGCAGTGCAGGCACAGGG + Intronic
927943168 2:27118548-27118570 CCCCCAGGACTGCTGGAACACGG + Intronic
929236903 2:39615238-39615260 CTTCAAGCACAGCTGGATTAAGG - Intergenic
929640144 2:43569963-43569985 CTCCCTCCACAGCTGGACCATGG + Intronic
929919355 2:46161528-46161550 CTGCCAGTACAGCTGGGGCCTGG - Intronic
931431952 2:62215481-62215503 CTCCCAGCACTGCTGGCAGATGG - Intronic
936393056 2:112093140-112093162 TTGCCAGCACACCTGAAAAATGG - Intronic
936411672 2:112263795-112263817 CTGTCTTCACAGCTGCAACAAGG + Intergenic
937840260 2:126518212-126518234 CTGCCATCACAGTGGGAAAAGGG + Intergenic
937876279 2:126827746-126827768 CTGCCAGCACAGCTCCCACTGGG - Intergenic
939041480 2:137194127-137194149 ATCCCAGCATAACTGGAACATGG + Intronic
941835607 2:170015334-170015356 GTGCAAGCACAGCTGGCAAAAGG + Exonic
942042868 2:172082564-172082586 CGGCCAGTTCAGCTGGAAGAGGG - Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
942974977 2:182005316-182005338 CTGCCAGAAAATCTGGAGCATGG + Intronic
943757207 2:191569209-191569231 CTGCCACCTCAGCTGAAACTGGG - Intergenic
943865021 2:192918150-192918172 CTCCCAGCCAAGGTGGAACAAGG - Intergenic
943896005 2:193360494-193360516 CTGTCAGTACAGCTGGATGAGGG + Intergenic
945259160 2:207828328-207828350 CTGGTAGGACAGCTCGAACATGG + Exonic
948811484 2:240480670-240480692 ATCCCTGCAGAGCTGGAACATGG - Intronic
1169092247 20:2868122-2868144 CTGCCAGAACACCTGCAACATGG + Intronic
1169918954 20:10713036-10713058 CTCCCAGCACTGGTGGACCAAGG - Intergenic
1170745858 20:19098371-19098393 CTGCAAAGAAAGCTGGAACATGG + Intergenic
1173185599 20:40837512-40837534 AGGCCAGCATGGCTGGAACATGG - Intergenic
1173270515 20:41530077-41530099 CTGCCAGCACTGCAGGCACTCGG - Intronic
1173705336 20:45106197-45106219 CTCACAGAACTGCTGGAACAGGG + Intergenic
1174255192 20:49249229-49249251 CTGGCAGCAGAGCCGGAGCATGG + Exonic
1174264908 20:49324280-49324302 CTGGCTGGACAGCTGGACCAAGG - Intergenic
1174400636 20:50273975-50273997 CAGCCAGCAGGGCTGGAGCAGGG - Intergenic
1174629943 20:51947791-51947813 CTGCCAGAAAAACTGAAACAAGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175592150 20:60201677-60201699 ATGACAGCACACCTGGAAGAAGG + Intergenic
1175698279 20:61118796-61118818 CTGCCTACACACCTGCAACAAGG + Intergenic
1175789578 20:61732923-61732945 CTCCCAGCACATGTGGCACAGGG - Intronic
1175993552 20:62801914-62801936 CTGCCAGCAGAGCATGAACTGGG - Intergenic
1176045551 20:63090909-63090931 CTGCCAGGATGGCTGGCACAGGG - Intergenic
1176057255 20:63155320-63155342 CTGGCAGGGCAGCTGGAATACGG + Intergenic
1177760105 21:25393579-25393601 CTTCCAAAACAGCTGGAAGATGG + Intergenic
1177814061 21:25956827-25956849 CTGCCATCTCAGGTGGAACGAGG + Intronic
1178834542 21:36085401-36085423 AGGCCAGCACAGCTGGGACCTGG - Intergenic
1179078991 21:38152582-38152604 TGGCCAGTGCAGCTGGAACAGGG + Intronic
1179181824 21:39051769-39051791 CTGCCTGCAGAGCTGGAATCAGG + Intergenic
1179211350 21:39327136-39327158 CTGCCGGCACAGCTCTAGCAGGG + Intergenic
1179505341 21:41836112-41836134 CTACAAGCACAGCAGGAACGAGG - Exonic
1180065609 21:45410730-45410752 CTGCCAGCACAGCTGCTCCTGGG + Intronic
1180560965 22:16613966-16613988 GTGCCTGCACAGATGGGACATGG - Intergenic
1181801071 22:25348350-25348372 CTGCCAGCCCAGCTGGGAAGTGG + Intergenic
1183500000 22:38173171-38173193 TTCCCAGCACAGCTGCAAGAGGG + Intronic
1183698734 22:39437931-39437953 CTGCCAGCACAGGAGGAGCCTGG - Intergenic
1183859736 22:40661257-40661279 CTTCCAGGACTTCTGGAACAAGG - Intergenic
1184875148 22:47269663-47269685 CTCCCACCACAACTGGGACACGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG + Intergenic
950275904 3:11660464-11660486 CTGCTAGCACAGCTAGCACTGGG - Intronic
953911865 3:46897276-46897298 CTGTCAGCCCATCTGGAAAATGG + Intronic
954579836 3:51697233-51697255 CTGGCAGAACAGGTGGCACAGGG + Intronic
957056172 3:75444675-75444697 CTGCCAGCCCCGCTGGACCCAGG - Intergenic
958103495 3:89044631-89044653 CTGCCAGCTAAGAGGGAACATGG - Intergenic
961140458 3:124551461-124551483 GTGCCAGCACAGCTGGAGATGGG + Intronic
961188827 3:124940157-124940179 CATCCAGAACAGCTGGCACATGG + Intronic
963043489 3:141085842-141085864 CTGCAAACAGAGCTGGCACATGG + Intronic
965257788 3:166438598-166438620 CTGCCAGCAAAGATGTAACTTGG + Intergenic
967920050 3:194607832-194607854 CTGCCAGCCCAGCTGGACAGTGG + Intronic
967966570 3:194964961-194964983 CTCCCAGGAGAGTTGGAACAGGG + Intergenic
968279190 3:197462738-197462760 TGGCCAGCACAGCTGGAGCCAGG + Intergenic
968544725 4:1192959-1192981 CTGCCACCTCATCTGGCACAGGG + Intronic
968591770 4:1463168-1463190 CTGCCAGCACGGCCGCCACAAGG - Intergenic
969180117 4:5433936-5433958 CTTCCAGAAAAGCAGGAACATGG - Intronic
971003202 4:22345823-22345845 GTGCCAGCACTGCTGGAGCTAGG + Intronic
971857357 4:32060322-32060344 CTGCCAGGCAAGCTAGAACAAGG - Intergenic
972338425 4:38129203-38129225 CTACAAGCTCAACTGGAACAGGG - Intronic
973070211 4:45849350-45849372 CTGCCAGTATGGCTAGAACAAGG + Intergenic
974055173 4:56977034-56977056 CAGCCAGCAGCGCTGGCACACGG + Exonic
978516515 4:109574440-109574462 CTGCCAACACAGCTAGAGCCTGG + Intronic
978651661 4:111012910-111012932 CAGCCACCATAGCTGTAACATGG - Intergenic
984578844 4:181486299-181486321 CTGCCAGCACAGCTGAAATCCGG + Intergenic
985843714 5:2329175-2329197 CTGCCTGCTCAGCTGGACCTGGG - Intergenic
987290690 5:16505635-16505657 CCTTCAGGACAGCTGGAACAGGG + Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
987812002 5:22849088-22849110 CTACAGCCACAGCTGGAACATGG - Intronic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
989161823 5:38398648-38398670 GAGCCAGCACAGCTGGAGCACGG + Intronic
989456185 5:41646986-41647008 CTGCCAGTGGAGCTGGAGCAAGG - Intergenic
992955259 5:81901689-81901711 TGGCCAGCACACTTGGAACAAGG + Intergenic
993307615 5:86290943-86290965 CTGCGACTACAGCTGGATCAAGG + Intergenic
994594005 5:101807748-101807770 CTGCCAGGCCAGATGTAACAAGG + Intergenic
997587235 5:135050647-135050669 TTGCCAGCAGAGCTGGCGCAGGG + Intronic
999111549 5:149125733-149125755 CTGTGAGGAAAGCTGGAACATGG + Intergenic
999446050 5:151640239-151640261 CTCCCAGCATGGCTGGATCAAGG - Intergenic
999824484 5:155260936-155260958 CTGCTTGCACAGCAGGAACTGGG + Intergenic
1000521495 5:162300059-162300081 ATGCCAGCAAAGCTGTAGCAGGG + Intergenic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1001480562 5:172086464-172086486 CTGAGAGCACAGGTGGACCAGGG - Intronic
1002566298 5:180114204-180114226 CGGCCAGCACAGGTGAAGCAGGG - Intronic
1002763097 6:217193-217215 CTGGTAGCAGAGCTCGAACAAGG - Intergenic
1003053834 6:2802108-2802130 ATGCCAGCAAAGCTGGCAGATGG - Intergenic
1003242563 6:4357579-4357601 GGGCGAGCACAGCTGGACCAGGG + Intergenic
1005944272 6:30584278-30584300 CTTCAGGGACAGCTGGAACAAGG + Exonic
1006112608 6:31757637-31757659 CTGTGAGCACATCTGGGACAGGG + Intronic
1007115134 6:39337927-39337949 ATGCCAGCACTGCTGGTCCATGG - Intronic
1007667409 6:43523392-43523414 CTGCCAGCCCAGCAGCAAAAGGG + Exonic
1007762127 6:44139346-44139368 CTGCCAGATCAGCTGGAGCTAGG + Intronic
1008453731 6:51684065-51684087 CTTTCAGAATAGCTGGAACATGG - Intronic
1009622020 6:66089701-66089723 CCGCCAGTGCAGCTAGAACAAGG - Intergenic
1009678132 6:66854389-66854411 CTGCCAGTATATCTAGAACAAGG + Intergenic
1012096830 6:94972766-94972788 CTGCCAGTGCAGCTGGAAGAAGG - Intergenic
1016144746 6:140655947-140655969 CTGCCAGCACAGGAGAAAGATGG - Intergenic
1016558982 6:145373143-145373165 CTTGCTGCACAGCTGGAATAAGG + Intergenic
1016641827 6:146358530-146358552 CTCACAGCACAGCTGGAGCTGGG + Intronic
1018208797 6:161460574-161460596 CTGCCAGCACATGTGGCACCTGG - Intronic
1018234584 6:161711718-161711740 CTGCCAGCACAGCTAGAATAAGG + Intronic
1018295976 6:162344542-162344564 CTGCCCTCACAGCTGGGTCAGGG + Intronic
1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG + Intergenic
1019398188 7:834635-834657 CTCCCCGCACAGCTGGAAGGTGG + Intronic
1019462008 7:1164855-1164877 CTGCCAGCGCGGCTAGAACAAGG - Intergenic
1021310555 7:19090667-19090689 CTGCAAGTGCAGCTGGAATAAGG - Intronic
1022361052 7:29658042-29658064 CTGCGAGCAGATCTGGAAGATGG - Intergenic
1023610187 7:41964898-41964920 CTGCCCCCAAAGCTGGCACATGG + Exonic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024858630 7:53811934-53811956 GTGCCAGCGCGGCTGGAACCCGG - Intergenic
1027686128 7:81280493-81280515 CTGCCAGCATGGCTGGAAAAAGG + Intergenic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030607986 7:111658828-111658850 CTACCAGCCCAGCTTAAACAAGG - Intergenic
1030685566 7:112483725-112483747 CTGGCAGCAGAGCTGGAATCGGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1031922095 7:127609500-127609522 CTGCAAGGACAGCGGGAACCCGG - Intergenic
1032192641 7:129773435-129773457 TTGACTGCACAGCAGGAACATGG - Intergenic
1034432440 7:151047930-151047952 CTGCCACCCCAGGTAGAACATGG - Intergenic
1034936102 7:155201974-155201996 CTGCCAGCCCGGCTTGAAAACGG - Intergenic
1036378255 8:8218993-8219015 CTGCCAGCCCCGCTGGACCCAGG + Intergenic
1037420174 8:18693652-18693674 TTGCCACCACAACTGCAACAGGG - Intronic
1037755031 8:21705047-21705069 CTGCCACGACAGCTGCACCAGGG + Exonic
1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG + Intronic
1038617956 8:29112745-29112767 GTGCCAGCACAGCTGGGAAATGG - Intronic
1040894913 8:52355842-52355864 CTCCCTGCACAAATGGAACAGGG + Intronic
1042039612 8:64578081-64578103 CTGCCAGCTCAGCTAGACCCAGG - Intergenic
1042567544 8:70127795-70127817 CTTCCAGCAGAGGTTGAACAAGG + Intronic
1045932371 8:107642354-107642376 CTGACATCAAGGCTGGAACAGGG + Intergenic
1046155360 8:110282557-110282579 CTGCCAACAAAGCTTGAAAAAGG - Intergenic
1047183229 8:122609000-122609022 CTGCCACAGCATCTGGAACACGG + Intergenic
1047526631 8:125639366-125639388 TTCCCAGCAGAGGTGGAACAAGG + Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1047775644 8:128068092-128068114 ATGCATGCACAGCAGGAACAGGG - Intergenic
1049239906 8:141532102-141532124 CTGCCAGCATGGCTAGAATAAGG + Intergenic
1049558617 8:143296410-143296432 CTTCCTGCACAGCTCGAACGTGG + Exonic
1050941879 9:11471215-11471237 CTGCCAGGGCAACTGGAACTGGG + Intergenic
1051331843 9:16031878-16031900 CTGCCTGTACAGCTGGATCCTGG - Intronic
1051861405 9:21628974-21628996 CTGCCAACATGGCTAGAACAAGG + Intergenic
1052443807 9:28533104-28533126 CTGCCAGCACGGCTAGAATAAGG + Intronic
1056236630 9:84600973-84600995 CTGCCAGCACAGCCTCACCAAGG - Intergenic
1056452937 9:86734246-86734268 CTGCCAGTGCAGCTAGAACAGGG - Intergenic
1056514371 9:87336124-87336146 CTTCTAGCCCAGATGGAACATGG + Intergenic
1056695923 9:88852545-88852567 CTGCCACCCCAGCTGGAGTATGG - Intergenic
1057043714 9:91867202-91867224 CTTCCAGCTCTGCTGGAGCAGGG + Intronic
1057240086 9:93400163-93400185 CTGGCAGCAAAGCAGGATCAAGG - Intergenic
1058778479 9:108309552-108309574 TTGACAGCACAGATGGAAGACGG + Intergenic
1058884393 9:109312517-109312539 CTGACAGCACAGCTGGGCGAGGG - Intronic
1060787319 9:126460772-126460794 CTGCCAGCAGAGGTGGAGCCAGG - Intronic
1060850916 9:126874688-126874710 GTGTGTGCACAGCTGGAACAAGG - Intronic
1061327169 9:129870704-129870726 CTGCCAGCCACGCTGGACCAGGG + Intronic
1061889850 9:133612950-133612972 CTTGCAGCACAGCTGGCACCCGG + Intergenic
1062181720 9:135194523-135194545 CTGCCAGGATCGCTGGAACTGGG + Intergenic
1185742480 X:2544928-2544950 CAGCCAGCACGGGTGGAAGATGG - Intergenic
1186592617 X:10947103-10947125 CTGGCACCACAGTTGGCACATGG + Intergenic
1189252948 X:39615017-39615039 CTGTCAGCGCTGCTGGAACCAGG + Intergenic
1194262366 X:91712411-91712433 CTTCCTGCACAGCTTTAACATGG + Intergenic
1196070349 X:111514312-111514334 CTGCAAGCAAAGCTGTATCAGGG + Intergenic
1199248143 X:145630859-145630881 CAGCCAGCACAGCTGCATCCAGG - Intergenic
1200581657 Y:4957246-4957268 CTTCCTGCACAGCTTTAACATGG + Intergenic