ID: 1094173675

View in Genome Browser
Species Human (GRCh38)
Location 12:27520941-27520963
Sequence ACTGGCCTCTGGGTGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094173675_1094173682 1 Left 1094173675 12:27520941-27520963 CCCCAAGACACCCAGAGGCCAGT 0: 1
1: 0
2: 1
3: 28
4: 244
Right 1094173682 12:27520965-27520987 ATTTCAGTATGTTTATTTAAGGG 0: 1
1: 0
2: 7
3: 72
4: 780
1094173675_1094173681 0 Left 1094173675 12:27520941-27520963 CCCCAAGACACCCAGAGGCCAGT 0: 1
1: 0
2: 1
3: 28
4: 244
Right 1094173681 12:27520964-27520986 GATTTCAGTATGTTTATTTAAGG 0: 1
1: 0
2: 0
3: 41
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094173675 Original CRISPR ACTGGCCTCTGGGTGTCTTG GGG (reversed) Intergenic
900140111 1:1136327-1136349 ACAGCCCTCTGGGTGCCTGGGGG + Intergenic
900189067 1:1345695-1345717 TGTGGCCTCTGGGAGTCTGGAGG - Intronic
900323509 1:2096176-2096198 TCTGGCCTCTGGGTGGGTGGTGG + Intronic
900559074 1:3294743-3294765 ACTTGCCTCTGAGTCTCTCGTGG - Intronic
900566944 1:3338234-3338256 CCTGGCATCTGGGAGGCTTGGGG - Intronic
902270177 1:15298550-15298572 AGTGGCCTCTGGGTTTCCAGAGG + Intronic
904027441 1:27513573-27513595 CCTGGCCTCTGGGTGACCTTAGG + Intergenic
904048128 1:27621699-27621721 CCTGGCCTCAGGGTGCCTTGGGG - Intronic
904432963 1:30477005-30477027 ACTGGCCTCTGGGTGACAGGTGG - Intergenic
904533151 1:31182136-31182158 ATGGGCCTCTGGGGGTCTGGAGG + Intronic
905337883 1:37257910-37257932 TCTGGCCTCTGGCTCTCTTCTGG - Intergenic
905682226 1:39882308-39882330 ACTGGCTTCTGGGTGAGTTGGGG + Intronic
906698837 1:47843033-47843055 ACTGGCCTCTTGCTGTCCTTCGG - Intronic
907923110 1:58931446-58931468 ACTGGCCTCTTGGGGTATTTGGG - Intergenic
911178853 1:94843440-94843462 GGTCTCCTCTGGGTGTCTTGCGG + Intronic
912492751 1:110070856-110070878 ACTGGGCTCTGGGTGAATGGGGG - Intronic
912802280 1:112727663-112727685 AGTGACCTCTGGGTGTCATAAGG - Intergenic
915759643 1:158297622-158297644 ACTTGCCACTCTGTGTCTTGGGG - Intergenic
917002583 1:170375836-170375858 GCTGGCATCTGGTTGACTTGTGG + Intergenic
917967630 1:180188357-180188379 AGTGGCCACTGGGTGGCGTGTGG + Intronic
922753728 1:228082829-228082851 ACTGGCCTCGGGGCGACTTGAGG + Intronic
922831621 1:228557315-228557337 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922832098 1:228609297-228609319 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922832658 1:228611538-228611560 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922833219 1:228613779-228613801 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922833779 1:228616020-228616042 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922834336 1:228618261-228618283 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922834898 1:228620492-228620514 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922835448 1:228622695-228622717 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922836006 1:228624937-228624959 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922836563 1:228627177-228627199 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922837123 1:228629418-228629440 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922837683 1:228631660-228631682 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922838241 1:228633900-228633922 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922838800 1:228636125-228636147 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922839359 1:228638366-228638388 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922839920 1:228640597-228640619 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922840480 1:228642838-228642860 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922841043 1:228645069-228645091 CCTGTGCTCTGGGTGCCTTGCGG + Intergenic
922956937 1:229611000-229611022 AATGGCCCCTGGCTGTCTTACGG + Intronic
923010486 1:230084125-230084147 AGTGGACTGTGAGTGTCTTGAGG + Intronic
1063165806 10:3460983-3461005 AATGGTTTCTGCGTGTCTTGAGG - Intergenic
1064513022 10:16115882-16115904 ACTGGCTTCTGTGGGTCTTCAGG - Intergenic
1066466250 10:35652833-35652855 ACTGGAGTTTGGTTGTCTTGTGG + Intergenic
1067365795 10:45627552-45627574 ACTGGCCTTTGGCTGGCTTTTGG + Intronic
1070330492 10:75413331-75413353 ACTTGCCTCCAGGTGTCTTTTGG - Intergenic
1071308077 10:84316615-84316637 ACTTGCCACTGGGTGTCTAAAGG + Intergenic
1072618319 10:97064037-97064059 GCTGGCCTCTGGGGGTCTGAGGG + Intronic
1072618818 10:97066816-97066838 ACTGGCCTCTGTGGGTCTGGTGG - Intronic
1073444104 10:103570759-103570781 ACTGGGCTCTGGGTGACTTCTGG + Intronic
1073560147 10:104489353-104489375 ACTGGCCTATGAGTGACATGTGG - Intergenic
1073642886 10:105270723-105270745 ACTGACCTCTGAGTATGTTGGGG - Intergenic
1075298705 10:121300889-121300911 ACTTGACTCTGGATGTCATGCGG - Intergenic
1076113713 10:127880844-127880866 ACTGACTTCTGGGAGTCCTGGGG - Intronic
1076860086 10:133136201-133136223 TCTGGTCTCTGGGTCTGTTGGGG + Intergenic
1077421410 11:2451854-2451876 AAGGGCTTCTGGGTGTCCTGAGG - Intronic
1077652600 11:3986992-3987014 TCTAGCCACTTGGTGTCTTGAGG + Intronic
1078721544 11:13889377-13889399 ACTGTCCTGTGGGCATCTTGTGG + Intergenic
1080311639 11:30900369-30900391 ATTGCCATCTGGGTGTCTTGTGG - Intronic
1080563955 11:33491064-33491086 ACTAGACTCTGAGTTTCTTGAGG + Intergenic
1081524611 11:43917723-43917745 ACTGCCCTCTGGTTGTCTGAGGG + Intronic
1084398381 11:68929703-68929725 ACTGGCCTCTGGGTGGATGTGGG + Intronic
1084460403 11:69293836-69293858 ACTGTCTTCTGGGTGGCTTCAGG + Intergenic
1084517272 11:69643702-69643724 ACTGGCCCCTGCGTCTCGTGCGG - Intronic
1086119024 11:83286311-83286333 AATGGCCGCTGGCTATCTTGGGG - Exonic
1087278997 11:96189161-96189183 ATTTGCCTCTTGGTGCCTTGAGG + Intronic
1089462674 11:118662146-118662168 CCTGGCCGCTGGGAGCCTTGGGG + Intronic
1091053978 11:132401448-132401470 ACTGCCCACTGGGCTTCTTGGGG + Intergenic
1091936199 12:4436184-4436206 AAAGGGCTCTGGGAGTCTTGGGG - Intronic
1092132775 12:6124235-6124257 ACTTGCCTCTGAGGGTCCTGGGG - Intronic
1092151669 12:6253126-6253148 ACTTGACTCCGGGTGTCTGGAGG - Intergenic
1092933556 12:13339587-13339609 GCAGGCCTCTGGGACTCTTGTGG + Intergenic
1093300542 12:17448796-17448818 AGATGCCTCTGGGTGTCATGAGG - Intergenic
1094144690 12:27215893-27215915 ACTGACCTCAGGGTATTTTGGGG + Intergenic
1094173675 12:27520941-27520963 ACTGGCCTCTGGGTGTCTTGGGG - Intergenic
1096774774 12:53957176-53957198 TCTGCCCACTGGGTGTCCTGGGG - Exonic
1097333604 12:58358107-58358129 GCTGGTCTCTGGATGTGTTGCGG + Intergenic
1102518851 12:113466850-113466872 ACTGGCCTCAGTGTGACTGGTGG + Intronic
1103477536 12:121229582-121229604 GCTGGCATCTCGGTGTCCTGGGG + Intronic
1103911486 12:124354779-124354801 GCTGGGCTCTGGCTGTCCTGTGG - Intronic
1111290206 13:86156651-86156673 TCTGGCCTCTGGGTGCTTTAAGG - Intergenic
1112760445 13:102688794-102688816 GCTGGCCGCAGGGTGTCATGCGG + Intronic
1113930207 13:113964359-113964381 TCGGGCCTCGGGGAGTCTTGGGG + Intergenic
1114740841 14:25095755-25095777 ACTGGCCTCTGTGAGTCTTGGGG - Intergenic
1115307235 14:31945355-31945377 ACTGACATCTGGGTGCCTTGCGG - Intronic
1116740571 14:48749305-48749327 CCTGGTCTCTGGGTATCTTTGGG - Intergenic
1117611763 14:57490504-57490526 TCTGGCCTCTGTGAGTCTTTGGG + Intronic
1117904724 14:60572709-60572731 ACTGTCCACTTGGTGTCATGTGG - Intergenic
1119226451 14:72947884-72947906 CCTGGCCTCTGGGACCCTTGGGG + Intronic
1121732319 14:96195191-96195213 GCTGGCCTCAGGGTGCCTGGAGG + Intergenic
1122020741 14:98836047-98836069 TGTGGCCTGTGTGTGTCTTGGGG - Intergenic
1122906443 14:104803753-104803775 ACTGGCCTCTGGGGGTCGGCAGG + Exonic
1124068567 15:26369792-26369814 ACTGGCCTGTGGGTTTGGTGTGG - Intergenic
1124490163 15:30150537-30150559 GCTGTCCTCTTGGAGTCTTGTGG - Intergenic
1124753369 15:32387790-32387812 GCTGTCCTCTTGGAGTCTTGTGG + Intergenic
1124975112 15:34523494-34523516 GCTGTCCTCTTGGAGTCTTGTGG + Intergenic
1125540287 15:40466237-40466259 GCTGGCCTGTGGTTTTCTTGGGG + Exonic
1131168645 15:90161043-90161065 ACATGCCTCTGGGTTTGTTGTGG + Intronic
1132685924 16:1162095-1162117 CCTGGCCTCTGGGTGTGTGGCGG + Intronic
1132731235 16:1363022-1363044 ACTTGGCTCTGGGCGTCTCGTGG - Exonic
1133039918 16:3055193-3055215 ACTGCCCTCTGGGAATCTTGTGG + Intronic
1136412294 16:30084554-30084576 ACGGGCCTCTGGTGGACTTGGGG + Intronic
1137600177 16:49751070-49751092 ACTGGACTCTGGGCCGCTTGAGG - Intronic
1137630314 16:49938744-49938766 ACTGGCAACTGGGTGCCTTTTGG - Intergenic
1137872417 16:51963028-51963050 ACTGGACTCTGGGTGTACAGTGG - Intergenic
1138134421 16:54509277-54509299 ACTGGCCCCTGGGAGCCCTGGGG + Intergenic
1138183312 16:54957813-54957835 ACTGGCCTGTGAGATTCTTGAGG + Intergenic
1138536019 16:57660687-57660709 GCTGGCCTCAGGGAGTCTGGAGG - Intronic
1139372341 16:66476943-66476965 ACTGCCCTTTAGGTATCTTGGGG - Intronic
1141148682 16:81549523-81549545 GCTGGGCTCTGTGTGTGTTGGGG + Intronic
1141981396 16:87552370-87552392 CCTGGCCTGTGGGTGCTTTGAGG + Intergenic
1142608659 17:1096192-1096214 CCTGGCCTCTGGGGTGCTTGTGG - Intronic
1142867469 17:2799427-2799449 CCAGGCCTCAGGGTGACTTGTGG + Intronic
1143771891 17:9174196-9174218 GCTGGCCTGTGGGGGTTTTGGGG + Intronic
1147596479 17:41721295-41721317 ACTGGCCTGTGGGTCTCTGAGGG - Intronic
1147615170 17:41823212-41823234 AATGGCCTTAGGGTGTCTTTTGG + Exonic
1148691277 17:49528375-49528397 ATTGGCCTCTGCCTGTCTTGAGG + Intergenic
1149854216 17:60065455-60065477 AATGGCATCTGGGTGTCCTCAGG - Intronic
1151523484 17:74647803-74647825 GCTGGGCTCTGGGTGCCTTGTGG - Intergenic
1152230724 17:79112819-79112841 AGTGGCCTCTGGGTGGCATCTGG + Intronic
1152646430 17:81470932-81470954 ACTGGGCTCTGAGTTTCTTGGGG - Intergenic
1152986099 18:322751-322773 ACTGGCCACAGGGTGTCCTCGGG + Intronic
1155237164 18:23832188-23832210 ACTGACCTGTGAGTGTTTTGTGG + Intronic
1155508716 18:26555940-26555962 ACTGGTATCTGGGTGTATTGGGG + Intronic
1156738143 18:40288925-40288947 ATTGGCCTATGGTTTTCTTGTGG - Intergenic
1157165418 18:45354368-45354390 ACTGGCTTCTGGGTGATTGGTGG + Intronic
1161170343 19:2809513-2809535 GCTGGCCTCTGGGGTTTTTGTGG + Intronic
1164838984 19:31378269-31378291 ACTGGCCTCTGGCTCTCCTTTGG - Intergenic
1166733519 19:45071471-45071493 TCTGGACTCTGGCTTTCTTGGGG - Intergenic
1167482904 19:49744195-49744217 GCTTGCCTCTGGGAGCCTTGTGG - Intronic
1168665339 19:58200875-58200897 ACTGGCATCTGGTTGGCTTCTGG + Intronic
926097356 2:10090815-10090837 ACTGGCCCCTGAGCATCTTGAGG - Intergenic
926309770 2:11667088-11667110 AGAGGCCTCTGGGTGTCTGTGGG - Intronic
926334360 2:11852097-11852119 ACTAGGCTATGGGTTTCTTGGGG - Intergenic
927812237 2:26186512-26186534 ACTGCTGTCTGGGTGTCTTGGGG + Intronic
929767635 2:44860665-44860687 ACTGGCATCTGCTTGTCTTCTGG - Intergenic
932441859 2:71742617-71742639 ACTGGGCTCTGTGGGTCATGGGG + Intergenic
933621375 2:84546180-84546202 ACTTGGCTCTCAGTGTCTTGGGG + Intronic
934048123 2:88188396-88188418 ACTGGCCACAGGGAGTCTTGGGG + Intergenic
935223085 2:101031678-101031700 TCTGGACTCTGGGTAACTTGTGG - Intronic
937090266 2:119201538-119201560 ACTGGGCTCTGGGTGCTTTGTGG - Intergenic
937757486 2:125557742-125557764 CCTGGACTCTGGATGCCTTGAGG + Intergenic
941004384 2:160232765-160232787 ACTGGTCTCTGGCTGGCTAGGGG + Intronic
941405669 2:165084428-165084450 TCTGTCCTGTGAGTGTCTTGTGG + Intergenic
945063159 2:205925878-205925900 ACAGCCCTCTGGGTGTCTCTCGG - Intergenic
946049436 2:216849741-216849763 TCTAGTCTCTGGGAGTCTTGGGG + Intergenic
946253127 2:218425617-218425639 ACAGGCTGCTGGCTGTCTTGTGG - Exonic
947197521 2:227583691-227583713 ACTGGCATCTGTGTGGCTTCTGG + Intergenic
948168570 2:235882213-235882235 ACTGGCCTGTGGGTCTCTGAAGG - Intronic
949056662 2:241931636-241931658 ACTGGCCCCTGGGGTTCTCGGGG + Intergenic
1169440521 20:5630205-5630227 ACTGGGCTCTGCATGTCATGAGG + Intergenic
1170477261 20:16728241-16728263 TCAGGCCTCTGTGTTTCTTGTGG + Intergenic
1172231844 20:33341976-33341998 CCAGACTTCTGGGTGTCTTGGGG + Intergenic
1172270312 20:33651611-33651633 TCTGGCATCTGGGTGTTTTGTGG - Intergenic
1173424282 20:42929085-42929107 ACTTCCTTCTGGGTATCTTGTGG - Intronic
1173808359 20:45940817-45940839 ACTGGCCTGTGGGTGTCACTGGG - Exonic
1175350266 20:58313061-58313083 GGTGGTGTCTGGGTGTCTTGTGG - Intronic
1175414474 20:58792726-58792748 GCTGGCCCCGGGGTGTGTTGGGG - Intergenic
1175547647 20:59788925-59788947 ACCAGACTCTGGGGGTCTTGAGG - Intronic
1175604723 20:60303366-60303388 TCTGGTCTCTGAGGGTCTTGGGG - Intergenic
1175855737 20:62119998-62120020 ACAGGCTTCTGGCTGTGTTGGGG - Intergenic
1175894466 20:62329961-62329983 TCAACCCTCTGGGTGTCTTGGGG - Intronic
1178485581 21:33018257-33018279 AGTTGCCTCTGGGGGTCTGGGGG + Intergenic
1178845278 21:36169437-36169459 ACAGGCCTCGGTGGGTCTTGTGG + Intronic
1179342651 21:40527055-40527077 TCTGGCCTCTGTGTCTCTTTAGG + Intronic
1180726044 22:17947251-17947273 ACTGTCCTCTGGGTGTGTAGAGG - Intronic
1180864202 22:19106522-19106544 GCTGGCCTCTGGGCTCCTTGTGG - Intronic
1182425327 22:30268473-30268495 ACTGGCCCCTGGGGGTGGTGAGG - Intergenic
1183300248 22:37055491-37055513 ACTGGCCTCTGGGCTCCCTGGGG - Intronic
1183511606 22:38238597-38238619 ACTGGCCTCTGGCTCTTGTGTGG + Intronic
1183615909 22:38945212-38945234 ACTAGACTCTCAGTGTCTTGAGG + Intergenic
1184827216 22:46960555-46960577 CCTGGCCTCTTGGCGTCTTTTGG + Intronic
951252423 3:20409583-20409605 ACTGGCCACTGTGTGTTTGGGGG + Intergenic
953180277 3:40588546-40588568 ACTGGCCTGGGGCTGCCTTGCGG + Intergenic
953549653 3:43891661-43891683 AGTGGCCCCTGGATGTCCTGAGG - Intergenic
954697970 3:52437483-52437505 TCTAGCCTCTGTGTGTCCTGAGG - Intronic
956460787 3:69470023-69470045 TTTTGCATCTGGGTGTCTTGGGG - Intronic
957063699 3:75503616-75503638 ATAGGCCACTGGGTGTCTTTAGG + Intergenic
957304630 3:78441597-78441619 ACAGCCCTCTGGGTGGTTTGGGG - Intergenic
958484889 3:94692621-94692643 ACTGGACTCTAAGTTTCTTGAGG - Intergenic
959631575 3:108513006-108513028 ACTGACCTCTGGGTCCCTTTAGG + Intronic
960704827 3:120471991-120472013 ACTGGCATCTAGGTGGGTTGAGG - Intergenic
960895817 3:122503926-122503948 AGTGGCTGCTGGGTGTTTTGGGG + Intronic
961369983 3:126423183-126423205 GCTGCCCTCTGGGTAACTTGTGG + Intronic
962847976 3:139287744-139287766 ACTGCCCAGTGGGTGACTTGGGG - Intronic
963646196 3:147917826-147917848 ACTAGACTATGAGTGTCTTGAGG - Intergenic
963653430 3:148014201-148014223 ACTAGCCTCTGGGTTTCAAGTGG - Intergenic
965091221 3:164164750-164164772 CCTGGGCTTTGGGTGTGTTGAGG - Intergenic
968120299 3:196121278-196121300 GCTGGCCTTTGGGTGGCTTTTGG + Intergenic
968468678 4:766150-766172 CATTGCCTCTGGGTGTCATGTGG + Exonic
968720307 4:2197744-2197766 ACTGGGCTCTGGGTGATTTTAGG - Intronic
968955853 4:3718830-3718852 ACTGGACTCTGGAGGTCCTGGGG + Intergenic
969042176 4:4307643-4307665 ACCGGCATCTGGGGGTCATGAGG - Intronic
969341899 4:6547463-6547485 ACTGGACACTGGGTGCCTTCTGG + Intronic
970456372 4:16227105-16227127 CCTGGCCTCTGAGTGTCCTTTGG + Intronic
971527427 4:27638725-27638747 ACTGGCCTCTGTTTGATTTGGGG + Intergenic
973897532 4:55429701-55429723 ACTGGCCTTTGACTGTGTTGGGG + Exonic
978219934 4:106257912-106257934 ACTGACTTCTGGATGTATTGTGG - Intronic
978945075 4:114485646-114485668 ACAGGCCTGTGGATGTCTAGAGG + Intergenic
984193782 4:176634538-176634560 AAAGGCCTCTGGGTGTCTGTAGG + Intergenic
987198611 5:15552292-15552314 TCTTGCCTCTGCCTGTCTTGTGG + Intronic
989087858 5:37695065-37695087 GCTGGCATCTGGTTGGCTTGTGG + Intronic
990860710 5:60323712-60323734 TCTGGCCTCTGGATGTCTCTTGG + Intronic
991083766 5:62629222-62629244 TCTGGCCTCTGGGTGAACTGTGG + Intergenic
995384447 5:111573474-111573496 TCTGGCCTCAGGATGTCCTGAGG - Intergenic
996077017 5:119208101-119208123 AGTGGCCTTTGGGGGTTTTGAGG + Intronic
996840258 5:127840368-127840390 ACAGGGCTCTGTGTGTCCTGTGG - Intergenic
997205809 5:132049205-132049227 ACTTGCCTCTGGGTGCCTGCAGG + Intergenic
998005105 5:138651535-138651557 ACTGGGCTCTGTGTGTGTGGGGG - Intronic
998415227 5:141941206-141941228 TCTGGCCACTGGGCGTCCTGTGG + Exonic
999190820 5:149745945-149745967 ACTGGCCTCTGGGAGTCTGCAGG - Intronic
999691590 5:154150739-154150761 ACTGGCCTCTGTTTGATTTGGGG + Intronic
1001650970 5:173316057-173316079 TCTGGCCTCAGGTTGCCTTGAGG + Exonic
1002236803 5:177808716-177808738 AGTAGTCTCTGGGTGTGTTGTGG + Intergenic
1002317324 5:178351507-178351529 ACTGGCCCCTGGGGGTCCTGTGG - Intronic
1002858817 6:1061740-1061762 ACTTGCCTGTGTGTGTGTTGGGG - Intergenic
1005802604 6:29442190-29442212 ACCTTCCTCTGGGTCTCTTGTGG - Intronic
1006634074 6:35449892-35449914 ACTGGCCTCTGGGAGTGAGGTGG + Intergenic
1009685648 6:66953116-66953138 ACTGGCATCTGGGTTTCTCACGG - Intergenic
1011476888 6:87757061-87757083 ATTGGCTTCTGGGTGGCTTTAGG + Intergenic
1013288608 6:108700681-108700703 TCTGGCCTCAGGGTTTCTGGAGG + Intergenic
1014930303 6:127327696-127327718 ACTGTCCTCTGAGGGGCTTGAGG + Intronic
1017564483 6:155669303-155669325 TAGGACCTCTGGGTGTCTTGTGG + Intergenic
1018199026 6:161378458-161378480 ACTGGCCAGTGGGTGTCAGGTGG + Intronic
1019255312 7:46026-46048 CCTGGCCTCAGGGAGGCTTGTGG - Intergenic
1019724760 7:2595399-2595421 ACTGCCCTCTGGGTGGGGTGGGG + Intronic
1019854092 7:3586777-3586799 ACTGTCATCTGGGTATCATGTGG + Intronic
1020139945 7:5606657-5606679 GCCGGCCTGTGTGTGTCTTGGGG + Intergenic
1022836656 7:34123278-34123300 ACTGGCCTCTGATTCTCTTCGGG - Intronic
1024532785 7:50407176-50407198 ACTGGACTCTGGGTGCTCTGTGG - Intergenic
1025988208 7:66474334-66474356 CCTGGCCTCTGAGTGTCCTTTGG - Intergenic
1026491626 7:70868715-70868737 ACTGGCCTCTGGCTGCCCTGGGG - Intergenic
1027211194 7:76150233-76150255 CCTGGCCTCTGAGTGTCCTTTGG - Intergenic
1029134766 7:98361498-98361520 ACTGGGGTCTGAGTGTTTTGGGG + Intronic
1029442375 7:100594222-100594244 ACTGGAGTCTGGGGGACTTGGGG + Intronic
1029465762 7:100723627-100723649 GCTGGCCTCTGGCTCTCATGGGG + Exonic
1032391888 7:131560591-131560613 ACTGACCTCTGAGTTCCTTGTGG + Intergenic
1033288404 7:140061791-140061813 ACTGGCAGCTGGGTGCCATGAGG + Intronic
1035925335 8:3721977-3721999 ACTGGCTTGTGGGGGGCTTGGGG - Intronic
1038047304 8:23776408-23776430 AGTAGCCTGTGGGTTTCTTGAGG + Intergenic
1038479547 8:27892435-27892457 ACTTGCCTCTGTGGGTCCTGGGG + Intronic
1039391398 8:37183874-37183896 TCTGACCTCAGGGTGTCTGGGGG - Intergenic
1039571432 8:38589678-38589700 CATGGCCTGTGGGAGTCTTGGGG + Intergenic
1041139426 8:54800301-54800323 ATTTGCCTCTGTGTGTGTTGGGG + Intergenic
1041495504 8:58481520-58481542 ACTAGACTCTGAGTGCCTTGAGG + Intergenic
1041719508 8:60963541-60963563 ACAGGCCTCTGGGTCTCTGCAGG - Intergenic
1042528559 8:69791672-69791694 ACTGGACTCTGGGCTTCTTGAGG - Intronic
1043908073 8:85830720-85830742 ACTGGCCTGTGGGGTTCTTTTGG + Intergenic
1045676260 8:104611203-104611225 ACTGGCCTCAGAGTGAGTTGGGG + Intronic
1046949205 8:120003694-120003716 AATTGACCCTGGGTGTCTTGTGG + Intronic
1047226528 8:122959874-122959896 ACTGTGCTTTGGGTGACTTGTGG + Intronic
1048168913 8:132086609-132086631 ACTGGCGTGTGTGTGTGTTGAGG + Intronic
1049671655 8:143872770-143872792 ACTGGCCACTGGGGGCCTGGTGG - Exonic
1053458928 9:38253360-38253382 ACTGGACTCTGGGCTTCTAGGGG + Intergenic
1056186052 9:84135918-84135940 ACTGGTGTCTGGGTGTTGTGCGG + Intergenic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1058324338 9:103677014-103677036 ATTGGGTTCTGGGTGCCTTGAGG + Intergenic
1059457759 9:114410552-114410574 ACTGGCCTCTCTCTGTCTTAGGG - Intronic
1060937549 9:127524441-127524463 ACTGCCCTCGGGGTGTTGTGTGG - Intronic
1061549564 9:131325508-131325530 ACTGGCGTCTGTGTGACTTTGGG + Intergenic
1186170220 X:6869045-6869067 ACTGGCCAATGGGTATCCTGGGG - Intergenic
1186642932 X:11474980-11475002 ACTGGCATCTGCTTGGCTTGTGG - Intronic
1187409594 X:19038739-19038761 CCTGGCTTCTGGGTGCCCTGGGG - Intronic
1192150960 X:68712145-68712167 ACTGGCCTGTCGGGGTCTTGGGG - Intronic
1192330953 X:70174834-70174856 ACTGGACTGTGAGTTTCTTGAGG + Intergenic
1195239755 X:102939357-102939379 TCTGGCCTCAGGGAGCCTTGGGG + Intergenic
1195348935 X:103978989-103979011 ACTGGCCTCTACGTGTCATGGGG + Intergenic
1195358508 X:104059850-104059872 ACTGGCCTCTACGTGTCATGGGG - Intergenic
1195687841 X:107601967-107601989 ACTGGTGTCTGGGTGGCTTGTGG - Exonic
1196144131 X:112297917-112297939 ACTAGACTCTGGGTTTCTTGAGG + Intergenic
1196833441 X:119793988-119794010 CCTGCCCTCTTGGAGTCTTGTGG + Intergenic
1197939981 X:131779140-131779162 ACAGGTCTTTGGGTCTCTTGCGG + Intergenic
1198735561 X:139781166-139781188 ACTTTCCTCTGGGTTTCTTTTGG + Intronic
1199867233 X:151863208-151863230 GCTGGACTCTGGGAGACTTGTGG + Intergenic