ID: 1094173676

View in Genome Browser
Species Human (GRCh38)
Location 12:27520942-27520964
Sequence CACTGGCCTCTGGGTGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094173676_1094173682 0 Left 1094173676 12:27520942-27520964 CCCAAGACACCCAGAGGCCAGTG 0: 1
1: 0
2: 1
3: 28
4: 263
Right 1094173682 12:27520965-27520987 ATTTCAGTATGTTTATTTAAGGG 0: 1
1: 0
2: 7
3: 72
4: 780
1094173676_1094173681 -1 Left 1094173676 12:27520942-27520964 CCCAAGACACCCAGAGGCCAGTG 0: 1
1: 0
2: 1
3: 28
4: 263
Right 1094173681 12:27520964-27520986 GATTTCAGTATGTTTATTTAAGG 0: 1
1: 0
2: 0
3: 41
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094173676 Original CRISPR CACTGGCCTCTGGGTGTCTT GGG (reversed) Intergenic
900140110 1:1136326-1136348 CACAGCCCTCTGGGTGCCTGGGG + Intergenic
900566946 1:3338235-3338257 CCCTGGCATCTGGGAGGCTTGGG - Intronic
900607214 1:3529228-3529250 CACTGGCCTCTGAGTCTCGGGGG - Intronic
901218222 1:7566662-7566684 CTCAGGCCTCTGGGTGCCTGTGG - Intronic
901645207 1:10713262-10713284 CACTGGCCTCTTGAAGGCTTGGG - Intronic
902246143 1:15122074-15122096 CACTGGTCACTGGCTGTATTAGG - Intergenic
904048130 1:27621700-27621722 ACCTGGCCTCAGGGTGCCTTGGG - Intronic
905212035 1:36381044-36381066 AACTGGACTCTGGGAGTGTTTGG - Intronic
905682225 1:39882307-39882329 CACTGGCTTCTGGGTGAGTTGGG + Intronic
906479616 1:46191489-46191511 CACTAGACTGTGGGTGTCTGGGG - Intronic
907013817 1:50991564-50991586 TAATGGCTTCTGGCTGTCTTTGG + Intergenic
907623075 1:56001667-56001689 CACTGGCCTCTGGTTCAATTTGG + Intergenic
907923111 1:58931447-58931469 TACTGGCCTCTTGGGGTATTTGG - Intergenic
912196584 1:107404185-107404207 CACTTGCCCCTGGGTGTGTTAGG + Intronic
913225133 1:116692397-116692419 CACTGGACTCTGAGCTTCTTCGG + Intergenic
916091306 1:161309805-161309827 CACTCTACTCTGGGAGTCTTGGG - Intronic
916722974 1:167498862-167498884 CACTTGACTCTGGGTGTCCCTGG - Intronic
917940640 1:179917524-179917546 CTCTTGCCTCTGGGAGTTTTTGG + Exonic
918075716 1:181169907-181169929 CACTGGGAGCTGGGTGTCTCAGG - Intergenic
919869381 1:201808971-201808993 CACTGGCATCTGCTTGGCTTCGG - Intronic
920413826 1:205784208-205784230 CACAGGCCTCTGGGGGTGTGTGG + Intergenic
920504331 1:206506065-206506087 CACTGGACTCTGGAAATCTTAGG + Intergenic
923851629 1:237802550-237802572 CCCAGAACTCTGGGTGTCTTAGG + Intronic
924619579 1:245649056-245649078 CACTGGCCAATGGATGTTTTGGG - Intronic
1063118533 10:3087818-3087840 CACCTACCTCTGGGCGTCTTGGG + Intronic
1064459020 10:15515215-15515237 CACCAGCCTCTGGGGGTCTTTGG - Exonic
1069536456 10:69257218-69257240 CTCTGGCCTCTGTCTGCCTTGGG + Intronic
1070969494 10:80551887-80551909 CCCTGGACTCTGGATGTCTGAGG + Intronic
1071571599 10:86700289-86700311 CACTGTCCTGTGGGTGACTAAGG - Intronic
1072618318 10:97064036-97064058 GGCTGGCCTCTGGGGGTCTGAGG + Intronic
1073456255 10:103638371-103638393 CACTGGCTTCTGGGCCTGTTCGG - Intronic
1073642887 10:105270724-105270746 CACTGACCTCTGAGTATGTTGGG - Intergenic
1074715388 10:116213807-116213829 CACTGGCCTCAGTGTGCCCTTGG - Intronic
1075426728 10:122347532-122347554 CTCTGGCCTCTTGGAGTCTTGGG + Intergenic
1076299604 10:129415038-129415060 CCCTAGGCTCTGGGTGTTTTAGG - Intergenic
1076825964 10:132968380-132968402 CACTGGCCTCGGTGATTCTTGGG + Intergenic
1077322739 11:1949589-1949611 CGCTGGCCTCTGCCTGTCTAGGG - Intronic
1080671171 11:34379489-34379511 CACTGGGCTCTGCTTGTCTGGGG + Intergenic
1081524610 11:43917722-43917744 CACTGCCCTCTGGTTGTCTGAGG + Intronic
1081999723 11:47387578-47387600 CACTCGCCTCTGGGAGTGCTGGG - Intergenic
1082940732 11:58703035-58703057 CACTGGGCTCTGAGTTCCTTTGG - Intronic
1083490915 11:63014683-63014705 CATGGCCCTCTGGGTGTCATTGG + Exonic
1084029450 11:66472747-66472769 CACTTACCACTGGGTGACTTTGG + Intronic
1084398380 11:68929702-68929724 AACTGGCCTCTGGGTGGATGTGG + Intronic
1084970407 11:72768381-72768403 CTCTTGCCTCTGGGTTTCTGGGG + Intronic
1087186357 11:95201765-95201787 CACTTGCCTCTGGGTGACACTGG - Intronic
1089914461 11:122139425-122139447 CACCGGCTTCTGAGTGTGTTTGG - Intergenic
1091005976 11:131954165-131954187 CACTGGCCTCTGGTTTTCAGAGG - Intronic
1202805757 11_KI270721v1_random:4902-4924 CGCTGGCCTCTGCCTGTCTAGGG - Intergenic
1092132776 12:6124236-6124258 CACTTGCCTCTGAGGGTCCTGGG - Intronic
1094173676 12:27520942-27520964 CACTGGCCTCTGGGTGTCTTGGG - Intergenic
1096074774 12:48796149-48796171 CACTGGTCTCTGGGTGTTGGAGG + Intergenic
1096481460 12:51944028-51944050 CTCTGGCCTTTGGGCTTCTTGGG + Intergenic
1097763467 12:63495405-63495427 CTCTGCCCTCTGGGAGTTTTTGG - Intergenic
1098663646 12:73131875-73131897 CACTGGCCTCTTCTTGTCCTTGG + Intergenic
1099565006 12:84231265-84231287 CAATGCACTCTGGGTGTCTAAGG - Intergenic
1101666354 12:106819231-106819253 CAGTGGCCTCTGGGAGTAATTGG + Intronic
1103539866 12:121658741-121658763 CACGCGCCTCTGGCTGGCTTCGG + Intronic
1103908744 12:124340443-124340465 CTCTGGCCTTTGGGTTTCCTAGG - Exonic
1104540957 12:129664249-129664271 CACTGGCCTCTGGACCTTTTGGG + Intronic
1104597299 12:130128521-130128543 CCCTGGCCTCTGAGTCTCATCGG - Intergenic
1104744554 12:131202803-131202825 CATCAGCCTCTGGGAGTCTTAGG - Intergenic
1104764112 12:131315392-131315414 CACCTGCCCCTGGGTGTCCTTGG - Intergenic
1105529243 13:21203228-21203250 AAGTTGGCTCTGGGTGTCTTTGG - Intergenic
1105889846 13:24674718-24674740 CACTGGCCTTGGGCTGGCTTCGG + Intergenic
1105934051 13:25082026-25082048 CTCTTGCCTCTGGTTGCCTTTGG + Intergenic
1107411145 13:40159833-40159855 GACTGTGCTCTGGGTGTCTTTGG - Intergenic
1113930206 13:113964358-113964380 CTCGGGCCTCGGGGAGTCTTGGG + Intergenic
1114696265 14:24630410-24630432 CATGGGTCTCTGGGTATCTTAGG + Intergenic
1114740842 14:25095756-25095778 CACTGGCCTCTGTGAGTCTTGGG - Intergenic
1115758038 14:36549225-36549247 CACTTGCCTCTTGGTGTCTCAGG + Intergenic
1116423933 14:44766635-44766657 CACTGGACTGTGGATGTCTCAGG + Intergenic
1116740573 14:48749306-48749328 TCCTGGTCTCTGGGTATCTTTGG - Intergenic
1117611762 14:57490503-57490525 ATCTGGCCTCTGTGAGTCTTTGG + Intronic
1117644582 14:57838097-57838119 CACTGGCCTCTGTGTTGCTAAGG - Intronic
1118311598 14:64697613-64697635 CCCAGGCCTGTGGCTGTCTTAGG - Intergenic
1119226449 14:72947883-72947905 CCCTGGCCTCTGGGACCCTTGGG + Intronic
1119614024 14:76086508-76086530 GAAAGGCCTCTGGGTGTCTGGGG + Intergenic
1120768042 14:88349327-88349349 CAGTTGCCTTTGGGTGACTTAGG - Intergenic
1121834138 14:97076986-97077008 CACAGGGCTCTGGGTTTCTCTGG - Intergenic
1122692411 14:103537622-103537644 CCCAGGCCTCTGGGGCTCTTGGG - Intergenic
1122742502 14:103880380-103880402 CACTGGCCTCTCGGCCTCTGGGG + Intergenic
1122774005 14:104109224-104109246 CACAGGCATCCGGGTGTCATTGG + Exonic
1123786337 15:23678596-23678618 CACTGACCTCTCTGTGTCCTTGG + Intergenic
1123992450 15:25693746-25693768 TACTGGCCTCAGGGTGTGTAGGG + Intronic
1124253749 15:28124270-28124292 CACTGGCCCCCGTGTGCCTTTGG - Intronic
1124595243 15:31086548-31086570 CCCTGGCTTCTGGGTGCCTGTGG + Intronic
1125743878 15:41986138-41986160 CAGTGCCCTCTGGGTGGCTGAGG + Intronic
1127371561 15:58346377-58346399 CAATGGCCTGTGGGTATCTGCGG - Intronic
1129506555 15:76086350-76086372 CAGTTGCCTCTGGGTGTCAGAGG + Intronic
1129519665 15:76177830-76177852 CACGGGGCTCTGGGTGACTCAGG + Intronic
1129684430 15:77677118-77677140 GACTGGCCTCTGGGGGCCTGGGG + Intronic
1130204980 15:81867505-81867527 CATTAGCCTCTGGGTCACTTTGG - Intergenic
1132396909 15:101481146-101481168 CACTGGGCTCTGGGCTTCCTGGG - Intronic
1133031231 16:3012229-3012251 CTCTGGCCTCTGGAGATCTTAGG + Intergenic
1134006616 16:10822378-10822400 CACTGGCCTCTGGCTGACCTTGG + Intergenic
1136412293 16:30084553-30084575 CACGGGCCTCTGGTGGACTTGGG + Intronic
1137290678 16:47050071-47050093 CACATGCCTCTGCGAGTCTTTGG - Intergenic
1137379020 16:47980794-47980816 CCCAGCCCACTGGGTGTCTTTGG + Intergenic
1137532414 16:49287732-49287754 AACTGGCCTCTGGGTGGATTTGG + Intergenic
1137736893 16:50731482-50731504 CACTGGCCTTGGGGAGTCTGTGG + Intronic
1138522466 16:57578676-57578698 CTCTGGCTTCTGGGTGAATTTGG - Intronic
1139372342 16:66476944-66476966 CACTGCCCTTTAGGTATCTTGGG - Intronic
1139549998 16:67667724-67667746 CACTGGCCTCTAAGCCTCTTGGG + Intronic
1140215354 16:73002787-73002809 CACTGGCCTGTGGCTGTGTTTGG - Intronic
1140781036 16:78297111-78297133 CTCTGGCCTCTGGGTTCGTTTGG + Intronic
1141178196 16:81734456-81734478 TGCGGGCCTCTGGGTGTCATTGG + Intergenic
1141980593 16:87547683-87547705 CCCTGGCCTCTGGCTGGCTGTGG - Intergenic
1142014595 16:87738153-87738175 GACTGGCCTCTGAGAGTCTCAGG - Intronic
1142065660 16:88060918-88060940 CACAGGCCTCGGGGTGACTTTGG + Intronic
1142158799 16:88546764-88546786 CACTGGCCACTGTATGTCTATGG + Intergenic
1142323339 16:89399282-89399304 CACTCACCTATGAGTGTCTTGGG - Intronic
1143101354 17:4506420-4506442 CCCTGGCCCCTGGTGGTCTTGGG + Intronic
1144624853 17:16839442-16839464 CACTGGGGTATGGGTGACTTTGG - Intergenic
1144833162 17:18142916-18142938 TACTGGCCTCAGGCAGTCTTGGG + Intronic
1144881577 17:18433279-18433301 CACTGGGGTATGGGTGACTTTGG + Intergenic
1145150656 17:20511107-20511129 CACTGGGGTATGGGTGACTTTGG - Intergenic
1146208842 17:30926281-30926303 CATCAGCCTCTGGGTCTCTTGGG + Intronic
1146946473 17:36877145-36877167 CTCTGGCTTCTGAGGGTCTTAGG - Intergenic
1147578998 17:41618137-41618159 CACTGGGGTATGGGTGACTTTGG - Intergenic
1147596480 17:41721296-41721318 CACTGGCCTGTGGGTCTCTGAGG - Intronic
1149848520 17:60021485-60021507 CACTGGCCTTTGGGCTTCTCTGG + Intergenic
1149861649 17:60125039-60125061 CACTGGCCTTTGGGCTTCTCTGG - Intergenic
1151377066 17:73697159-73697181 CACTGGGCTTGGGGGGTCTTTGG + Intergenic
1152646431 17:81470933-81470955 TACTGGGCTCTGAGTTTCTTGGG - Intergenic
1152986098 18:322750-322772 CACTGGCCACAGGGTGTCCTCGG + Intronic
1154371341 18:13765659-13765681 CACACTCCTCTGGGTGACTTTGG + Intergenic
1155396460 18:25391433-25391455 CACTGGCCCCTGGGGATATTTGG - Intergenic
1155508715 18:26555939-26555961 AACTGGTATCTGGGTGTATTGGG + Intronic
1160507530 18:79435633-79435655 TTCTGCCATCTGGGTGTCTTGGG + Intronic
1160524527 18:79527077-79527099 CACTGGCCTGTGGGGGACTCAGG + Intronic
1160828617 19:1092137-1092159 CCCTGGTCTCTGGGTGACTGAGG - Intronic
1161596782 19:5154650-5154672 GACTGGGCCCTGGGTGTCTGTGG + Intergenic
1162326337 19:10002000-10002022 CATTGGCCTCTGGTGCTCTTTGG - Intronic
1162515035 19:11142664-11142686 CACCGGCCTCAGGCTGTCCTGGG + Intronic
1162925417 19:13928447-13928469 CACTGGCCTCTGGACTTCTGTGG + Intronic
1163612208 19:18307546-18307568 CTCTGTCCTCTAGGTGTGTTTGG - Exonic
1163648478 19:18503583-18503605 CCCTGAGCTCTGGGTGTCTGGGG - Intronic
1164236463 19:23340658-23340680 TACTGACCTCTGAGTGACTTAGG - Intronic
1164639482 19:29813197-29813219 CACTGGCCTCTGCCAGTCCTGGG + Intronic
1166684640 19:44788992-44789014 CACTAGCCTCAGGGAGTCTGAGG + Intronic
1167645021 19:50700958-50700980 CACTGGTCTCTGGGTCTCTAGGG - Intronic
925869325 2:8255350-8255372 CACTGCCCTCAGGATTTCTTGGG - Intergenic
926309771 2:11667089-11667111 AAGAGGCCTCTGGGTGTCTGTGG - Intronic
926334361 2:11852098-11852120 CACTAGGCTATGGGTTTCTTGGG - Intergenic
927703679 2:25284006-25284028 CACTTGCCTCTGGATGGCTGAGG - Intronic
927812236 2:26186511-26186533 CACTGCTGTCTGGGTGTCTTGGG + Intronic
928230586 2:29495263-29495285 CTCTGGCTTCTGGTTGTGTTTGG + Intronic
932410918 2:71547260-71547282 CACAGCCCTGTTGGTGTCTTAGG - Intronic
932569451 2:72930768-72930790 AACTGGGCTCTGAGTGTATTAGG - Intronic
933621374 2:84546179-84546201 CACTTGGCTCTCAGTGTCTTGGG + Intronic
934048122 2:88188395-88188417 CACTGGCCACAGGGAGTCTTGGG + Intergenic
936379582 2:111972558-111972580 CACTGGACTTTGGCTGTCTCAGG - Intronic
937334579 2:121054186-121054208 CCCTGGCCCCTGGGTGTCGTAGG - Intergenic
937951232 2:127389170-127389192 CACTGACCTCTGTGTTTCTGAGG - Intergenic
938149858 2:128873011-128873033 CACTTTCCTCTTGGGGTCTTGGG - Intergenic
939436632 2:142185427-142185449 CTCAGGCCTCTGGGTATCTTAGG + Intergenic
941004383 2:160232764-160232786 CACTGGTCTCTGGCTGGCTAGGG + Intronic
941926672 2:170902454-170902476 CTCTGGCTTCTGGTTGGCTTTGG + Intergenic
942548564 2:177090984-177091006 CCCTGTCCTCTGGGTGAGTTTGG - Intergenic
944400926 2:199325344-199325366 CACTGGCTGCTGGGTGTCCTAGG - Intronic
946487725 2:220117093-220117115 TCCTGTCCCCTGGGTGTCTTTGG - Intergenic
948188173 2:236037656-236037678 CCCAGGACTCTGGGTGTCTGAGG - Intronic
948825903 2:240573363-240573385 CACTGGCCTCTGGGTGCTCTGGG + Intronic
949056661 2:241931635-241931657 CACTGGCCCCTGGGGTTCTCGGG + Intergenic
949071535 2:242027988-242028010 CAAGGGCCTCTGGGTGTCCAAGG - Intergenic
1168794676 20:603536-603558 CACGTGCCTCTGGGTGTCATCGG + Intergenic
1169754025 20:9024286-9024308 CACTGGCCTCTTGCTGTTTCTGG + Intergenic
1171010655 20:21507729-21507751 CACTGGCCTCTTGGTGCGATGGG - Intergenic
1171056147 20:21908836-21908858 CACTGTCCCCTTGGTGTCATTGG - Intergenic
1171431191 20:25084035-25084057 GCCTGGCCTTTTGGTGTCTTTGG - Intergenic
1172205486 20:33160141-33160163 GACTGAGCTCTGGGTGGCTTTGG - Intergenic
1173690597 20:44958005-44958027 TACTGGCCTCTGTGAGTCTGGGG - Intronic
1173768143 20:45632331-45632353 CACCGGGCTCTGGGTATCTCAGG + Intergenic
1173808360 20:45940818-45940840 GACTGGCCTGTGGGTGTCACTGG - Exonic
1174212766 20:48892839-48892861 CACTGGTTTCTGGGTGGGTTTGG + Intergenic
1175145868 20:56895790-56895812 CACTGGCCTCCTGGTGTTTCTGG + Intergenic
1175855738 20:62119999-62120021 CACAGGCTTCTGGCTGTGTTGGG - Intergenic
1176038764 20:63053254-63053276 CTCTGGCCTCTGGGTGGGTGTGG + Intergenic
1176688139 21:9873171-9873193 CACACGCCTCTGAGTGACTTTGG + Intergenic
1179043681 21:37827042-37827064 CAGTGGCCTCTGGGTTTAATTGG + Intronic
1179310967 21:40196106-40196128 CACTGGCCTCCTGGTGTCCCAGG + Intronic
1179643144 21:42760249-42760271 CACAGCCTTCTGGGTGGCTTTGG + Intronic
1180077282 21:45469159-45469181 CACAGGCCTGGGGGTGTCTCTGG - Intronic
1180093928 21:45546011-45546033 CCCTGGCCGCTGGGAGTGTTAGG - Intergenic
1183242908 22:36671693-36671715 CAGATGCCTCTGGGTGTCCTGGG - Intronic
1183545247 22:38451962-38451984 CACGGGCCCCTGAGTGTCTATGG + Intronic
1183628305 22:39018128-39018150 CAGTGTCCCCTGGGTGTCTGTGG + Intronic
1184215099 22:43061411-43061433 CACTTACCTCTGTGTGACTTGGG - Intronic
1184586761 22:45453137-45453159 CTCTGCCCTTTGGGTGTCTCAGG - Intergenic
949267174 3:2171811-2171833 TACTGGGCTCTTGGTGTGTTTGG + Intronic
950101103 3:10357565-10357587 CACTGTTCTCTGGGGGTCTCTGG - Intronic
951252422 3:20409582-20409604 CACTGGCCACTGTGTGTTTGGGG + Intergenic
952676172 3:36032698-36032720 CCCTGGCTCCTGGGTGTCTGCGG - Intergenic
953407872 3:42668552-42668574 CAGAGGCCTCTGGGTGGCTGTGG + Intergenic
959318751 3:104843728-104843750 CCCTGGCATCTTGGTGACTTTGG + Intergenic
960895816 3:122503925-122503947 CAGTGGCTGCTGGGTGTTTTGGG + Intronic
961208885 3:125110012-125110034 CCCTGTCCTCTGGCTGGCTTAGG - Intronic
961657547 3:128451695-128451717 CTCTGGCCTCTGAATGTCCTTGG + Intergenic
962604978 3:137025557-137025579 CACTGGGCTCTGACTGTCTGTGG + Intergenic
963302529 3:143615136-143615158 CACAGGCCTCTGGGTCTGCTAGG - Intronic
963705143 3:148677761-148677783 AATTGGCTTCTGGGTGACTTTGG + Intergenic
965519489 3:169658753-169658775 AACAGGGCTCTGGGTGCCTTGGG + Intronic
968087405 3:195880120-195880142 CACAGACCTCTGGGTGCCTCTGG + Intronic
968644021 4:1729716-1729738 CACAGGCCTCTGGATGGCTGCGG + Intronic
971527426 4:27638724-27638746 CACTGGCCTCTGTTTGATTTGGG + Intergenic
972453644 4:39230455-39230477 CACTTACCTCTGTGTGCCTTGGG + Intronic
973790910 4:54377320-54377342 CACTGGCCACTATGTGTCTGCGG - Intergenic
974017291 4:56659204-56659226 CACAGGACTCTGGGTTTATTTGG - Intronic
976599900 4:86928443-86928465 AACTGGCTTCTGGGTGGGTTTGG - Intronic
977119086 4:93073980-93074002 CTCTGTCCTCTGTGAGTCTTGGG - Intronic
981577892 4:146223796-146223818 CTCGAGCCTCTGGGTGACTTCGG + Intergenic
983054426 4:163085109-163085131 CCCAGTACTCTGGGTGTCTTCGG + Intergenic
985740355 5:1612244-1612266 CAAGGGCCTCTGGGTGTCCAAGG + Intergenic
986654647 5:9999371-9999393 CCCTGCCCTCTGGGTGTTTGAGG - Intergenic
988299004 5:29397576-29397598 CACTGGAGTTTGGGTGTTTTTGG - Intergenic
988354901 5:30161249-30161271 CACTGGCCTCTAGTTGGCTGGGG + Intergenic
989686297 5:44091492-44091514 CACTGGCTTCTGGTTGTTCTAGG + Intergenic
990726304 5:58758740-58758762 CACTGGCCTCTATGTTACTTTGG - Intronic
991520884 5:67495544-67495566 CAGTGGCCTCTGGTTGTGTGAGG + Intergenic
992697483 5:79304378-79304400 CACTGGCTTCTTGGTTTCTCTGG + Intronic
993674926 5:90805509-90805531 CACTGGCCACTAATTGTCTTGGG + Intronic
995447218 5:112258694-112258716 CAATGTCCTCTGGGAGTATTTGG - Intronic
995747083 5:115415427-115415449 CTCAGGCCTCTGAGTGTCTTAGG + Intergenic
996791865 5:127301644-127301666 CACTGACATCTTGGTGACTTTGG + Intronic
998005106 5:138651536-138651558 CACTGGGCTCTGTGTGTGTGGGG - Intronic
999076964 5:148805773-148805795 ATCTGGCCTATGGATGTCTTTGG - Intergenic
1000205484 5:159053986-159054008 CACTGGCCTCATGGTGCTTTGGG - Intronic
1001532490 5:172473498-172473520 CACTGGCGTCTGGCTGCCCTAGG + Intergenic
1001724448 5:173885304-173885326 CCCTGGGCTCTGGGTATCCTGGG + Intergenic
1002800132 6:514712-514734 CCCTGGCCTCTGCGTCCCTTGGG - Intronic
1002895898 6:1379932-1379954 CCCTGGTCTCCGGGTGTTTTCGG - Intergenic
1002940688 6:1713161-1713183 CGCTGGCCTGTGGGTTTATTTGG - Intronic
1004586312 6:17004609-17004631 AGCTGGCCTCAGGGTGTCATGGG + Intergenic
1006448235 6:34091691-34091713 CACTGGGCTCTGGGTGACTCCGG - Intronic
1007421618 6:41723273-41723295 CACTGGCATTGGGATGTCTTTGG - Intronic
1007697105 6:43740829-43740851 CACTGGTCGGTGGGTGTCTAGGG + Intergenic
1007714982 6:43850650-43850672 CTCTGGGCACTGGGTGTCTAGGG + Intergenic
1013033601 6:106360270-106360292 CTCTGATCTCTGGGTGGCTTGGG - Intergenic
1017584728 6:155908368-155908390 CTCTAGCCTCTGGCTTTCTTAGG - Intergenic
1018623016 6:165750210-165750232 CACTGGTCTCTGGGTGAACTAGG - Intronic
1019087916 6:169499579-169499601 GACTGTCTTCTGGCTGTCTTAGG - Intronic
1019570857 7:1711394-1711416 CTCTGGCCTCTGGATGTTTGGGG - Intronic
1019724759 7:2595398-2595420 CACTGCCCTCTGGGTGGGGTGGG + Intronic
1022836657 7:34123279-34123301 CACTGGCCTCTGATTCTCTTCGG - Intronic
1024200822 7:47104052-47104074 CCGTGGCCTGTGGGTGTCATGGG - Intergenic
1024968618 7:55048400-55048422 CCATGGCCTCTGGGTGACTTTGG + Intronic
1026491627 7:70868716-70868738 CACTGGCCTCTGGCTGCCCTGGG - Intergenic
1027052914 7:75031000-75031022 CACTGGCCTTGGCCTGTCTTGGG - Intronic
1027554662 7:79648349-79648371 CACACTCCTCTAGGTGTCTTTGG - Intergenic
1027567964 7:79822293-79822315 CACTGGCATCTGAGTGTTTCAGG - Intergenic
1029860094 7:103561854-103561876 TACTGGCCTCAGGGTGCCCTTGG - Exonic
1030656386 7:112173099-112173121 CACTGGATTCTGGGTATCATTGG - Intronic
1030673927 7:112365356-112365378 CACTGGCCAGTTGGTCTCTTTGG + Intergenic
1031989733 7:128189742-128189764 GCCTGGCCTCTGGGTGGCTGGGG + Intergenic
1032857381 7:135846554-135846576 CTCTGGCGTCTGGGTGGATTTGG + Intergenic
1034550712 7:151818872-151818894 CACTGGCCTCAAGCTGTCATAGG - Intronic
1035252693 7:157607579-157607601 CACTGGTCTCAGGGTGCCGTGGG - Intronic
1039571431 8:38589677-38589699 CCATGGCCTGTGGGAGTCTTGGG + Intergenic
1045599160 8:103693730-103693752 CCCTGGCCCCTGGGTTTGTTGGG + Intronic
1046004700 8:108464658-108464680 CACAGGCCTCTGTGTGACTGTGG + Intronic
1048029787 8:130620726-130620748 CACTGGTCACTGCGAGTCTTGGG - Intergenic
1048846878 8:138610633-138610655 CAGCGGCCTCTGGGGGCCTTGGG + Intronic
1049700195 8:144007406-144007428 AACTGGCTTCTGAGTGTCTGAGG - Intronic
1051184223 9:14441794-14441816 TAATGGTCTCTGGGTGTCTATGG - Intergenic
1051275789 9:15396759-15396781 CAGTGTTCTCAGGGTGTCTTTGG + Intergenic
1053458927 9:38253359-38253381 CACTGGACTCTGGGCTTCTAGGG + Intergenic
1053781202 9:41608702-41608724 CACACGCCTCTGAGTGACTTAGG - Intergenic
1054169148 9:61818855-61818877 CACACGCCTCTGAGTGACTTAGG - Intergenic
1054668384 9:67761961-67761983 CACACGCCTCTGAGTGACTTAGG + Intergenic
1055066459 9:72123951-72123973 CACTGGCTTCTCACTGTCTTTGG - Intronic
1055122169 9:72673907-72673929 CACTGGCCTCAGGGAGAGTTGGG - Intronic
1056747475 9:89317000-89317022 CACTGGCCACTGGTGGTCTTGGG + Intergenic
1057551500 9:96054037-96054059 CTCTGGCTTCTGGGTGGGTTTGG - Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1059457760 9:114410553-114410575 GACTGGCCTCTCTCTGTCTTAGG - Intronic
1060807631 9:126587720-126587742 CACTGGCTCCTGCCTGTCTTTGG + Intergenic
1061517664 9:131098810-131098832 CACTGGCTTCTGCGTGGCCTTGG - Intronic
1061549563 9:131325507-131325529 CACTGGCGTCTGTGTGACTTTGG + Intergenic
1061936707 9:133861891-133861913 CCCTGGCTGCTGGGTGACTTTGG - Intronic
1062402128 9:136377412-136377434 GGCTGGCTGCTGGGTGTCTTAGG - Intronic
1185983055 X:4800875-4800897 CACTTGCCTCTGGCTCTCTGCGG + Intergenic
1186727042 X:12368206-12368228 CACTTGCCTCTGAGTGTTGTGGG - Intronic
1189273912 X:39771082-39771104 CACTGACCTCTGGGACTCTCAGG + Intergenic
1189729197 X:44001013-44001035 CACTGGTCTCTGCATGTCATTGG - Intergenic
1190679163 X:52810398-52810420 CACTGAAGTCTGGGTCTCTTGGG - Intergenic
1190844597 X:54180699-54180721 CACTTATCTCTGGGTGACTTTGG + Intronic
1192150961 X:68712146-68712168 TACTGGCCTGTCGGGGTCTTGGG - Intronic
1195239754 X:102939356-102939378 CTCTGGCCTCAGGGAGCCTTGGG + Intergenic
1195244093 X:102980361-102980383 CCCTGGACTCTGGGTGCCTGAGG - Intergenic
1195348934 X:103978988-103979010 GACTGGCCTCTACGTGTCATGGG + Intergenic
1195358509 X:104059851-104059873 GACTGGCCTCTACGTGTCATGGG - Intergenic
1197177424 X:123500624-123500646 CACGGTCCTCTAGGTGGCTTTGG - Intergenic