ID: 1094180081

View in Genome Browser
Species Human (GRCh38)
Location 12:27583277-27583299
Sequence GGAACACTGTTAGATGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094180078_1094180081 7 Left 1094180078 12:27583247-27583269 CCTTGGGGAAGAGTTAAGAAGAC 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1094180081 12:27583277-27583299 GGAACACTGTTAGATGCTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094180081 Original CRISPR GGAACACTGTTAGATGCTTC TGG Intronic
906156833 1:43618899-43618921 GGAACAGTGCTAGGAGCTTCAGG + Intronic
906507013 1:46387837-46387859 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
909172019 1:72308679-72308701 TTAGCACTGTAAGATGCTTCAGG + Intergenic
909390967 1:75121544-75121566 GGAAAACTTTTAGATGATTAGGG - Intergenic
912463694 1:109854709-109854731 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
921058498 1:211563040-211563062 GGAACACTGCTAGCTGCTCTGGG - Intergenic
922684456 1:227628519-227628541 GGAACCCTCTTAATTGCTTCAGG + Intronic
1065199335 10:23298611-23298633 GGAACGCTCTTAGTTGCTTCAGG + Intronic
1065631987 10:27689929-27689951 GGAACATAATCAGATGCTTCCGG - Intronic
1073252036 10:102126411-102126433 GGTACTCTGTTAGATGCTGGAGG - Intergenic
1074583113 10:114740097-114740119 GACACACTCTTAGATACTTCTGG - Intergenic
1074948712 10:118306567-118306589 GGAACACAGCTATAGGCTTCTGG - Exonic
1075575997 10:123577955-123577977 GGAACACTGTGAGTTTCTTTGGG - Intergenic
1081552428 11:44126310-44126332 AGCACACTGTTAGATGCTATGGG + Intronic
1082760113 11:57119174-57119196 GGCATCCTGGTAGATGCTTCAGG - Intergenic
1083509700 11:63197120-63197142 GGAACACCATTCCATGCTTCTGG + Intronic
1084702860 11:70798863-70798885 GCAACACTGAGAGATGCTACAGG - Intronic
1085249448 11:75132719-75132741 GGGCCACTGTTAGCAGCTTCAGG + Intronic
1085553823 11:77401368-77401390 GGAAAACTGTTGGCTGTTTCTGG + Intronic
1086441759 11:86835631-86835653 GGAACCCTCTTAGTTGCTTTAGG + Intronic
1088694513 11:112355363-112355385 TGCACACTATTGGATGCTTCAGG - Intergenic
1092469222 12:8763503-8763525 GGAACCCTCTTAGTTGCTTTAGG + Intronic
1092992177 12:13913382-13913404 GGGGCACTGTTAGAGCCTTCTGG - Intronic
1093148054 12:15590156-15590178 GTAACACTGTTGGATATTTCAGG - Intronic
1094180081 12:27583277-27583299 GGAACACTGTTAGATGCTTCTGG + Intronic
1094806686 12:34100896-34100918 GGAATGCTGTTAGTTGCTTTAGG - Intergenic
1095083200 12:38031060-38031082 GGAACACTTTTAGTTGCTTTAGG + Intergenic
1095125535 12:38472361-38472383 GGAACACTCTTAGTTGCTTTAGG - Intergenic
1096351845 12:50907286-50907308 GGAACCCTGTTAGTTGCTTTAGG + Intergenic
1096878529 12:54648644-54648666 GGAAGACTGTGAGAGGTTTCTGG + Intergenic
1097377028 12:58854360-58854382 GGAACGCTCTTAGTTGCTTTAGG + Intergenic
1097430130 12:59495120-59495142 GGCACTCTTTTAGATGCTTGAGG - Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099426401 12:82529059-82529081 GGAACACTGCTATATGCATAGGG - Intergenic
1100714604 12:97292638-97292660 AGAAGACTGTTACATTCTTCTGG + Intergenic
1104449411 12:128857017-128857039 GGCACAGAGTTAGAAGCTTCAGG + Intronic
1111531874 13:89547371-89547393 GGCATACTGTGAAATGCTTCTGG - Intergenic
1114384542 14:22241638-22241660 GGAACCCTCTTAGTTGCTTTAGG - Intergenic
1117672666 14:58124058-58124080 GGAACCCTCTTAGTTGCTTTAGG - Intronic
1117896579 14:60493913-60493935 GGAACACTGTTAGTAGCTCCTGG + Intronic
1118080611 14:62354975-62354997 GGAACACTTTTACATGCTGATGG - Intergenic
1120054576 14:79908345-79908367 GGAACATTGTTTTATGCTTAGGG + Intergenic
1121949121 14:98154538-98154560 GGATAACTGGTAGATGCTTCAGG + Intergenic
1127529778 15:59832551-59832573 GGAACAGTGTTAGGTGATGCAGG - Intergenic
1127594959 15:60471658-60471680 GAAACCCTGTCAGATGCTTTTGG - Intronic
1128362385 15:66971569-66971591 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
1128787532 15:70409228-70409250 GAAACATTGTGAGACGCTTCTGG + Intergenic
1130997236 15:88910755-88910777 GGAGCACAGTTAGATGCAGCTGG + Intronic
1138320864 16:56110718-56110740 GGAACTCTGTTAAATGCTTTGGG + Intergenic
1141643864 16:85357111-85357133 GGCTCCCTCTTAGATGCTTCTGG + Intergenic
1142026842 16:87818972-87818994 GGAACTCTGGAAGATGCTCCAGG - Intergenic
1147837209 17:43342435-43342457 GAAACAATGTTAACTGCTTCAGG + Intergenic
1149273862 17:55013471-55013493 GGAACTCTCTTAGTTGCTTTAGG + Intronic
1151154496 17:72115406-72115428 GGAACACTGTTATATTTTCCGGG + Intergenic
1152677153 17:81647506-81647528 GGAACTCTGGCAGAGGCTTCTGG - Intronic
1153401779 18:4689967-4689989 GGAACGCTGTTAGTTGCTTTAGG - Intergenic
1153656765 18:7289748-7289770 TGAACACTGATACATGCTTTTGG + Intergenic
1155929112 18:31686645-31686667 GTAACATTTTTAGATGCTTAAGG + Intergenic
1156295123 18:35782439-35782461 GGATCTCTGCTAGAGGCTTCAGG + Intergenic
1156444909 18:37229239-37229261 GGCACACAGTTAAGTGCTTCAGG - Intronic
1156934969 18:42692749-42692771 GGAATACTCTTATATGCTGCTGG - Intergenic
1157910195 18:51610224-51610246 AGAACTCTGTTGGAGGCTTCTGG + Intergenic
1159327391 18:66940778-66940800 GGAACCCTGTAAACTGCTTCAGG + Intergenic
1160251471 18:77207118-77207140 GGGACACTTTTGGATGCTCCTGG + Intergenic
1161585720 19:5104291-5104313 GTTACACTGTGAGCTGCTTCAGG + Intronic
1163305956 19:16479008-16479030 TGAACAGTGTTTCATGCTTCTGG - Intergenic
1164747106 19:30624412-30624434 CCAACACTGTTAGATCATTCTGG - Intronic
1165783631 19:38448092-38448114 GGAACACTGGAAGAGGGTTCGGG + Intronic
1166352201 19:42204685-42204707 ACAACACTGGGAGATGCTTCCGG + Intronic
929307126 2:40376219-40376241 TGTACATTGTTAGATGCTTAAGG - Intronic
929785898 2:44990966-44990988 GGAAAACTGTTAGTTGATTATGG + Intergenic
931156209 2:59633706-59633728 GGAACATTTTTTAATGCTTCAGG - Intergenic
932287778 2:70551504-70551526 GGAACACTGGTTGATTCTCCTGG + Intronic
933175023 2:79165221-79165243 GGAACCCTCTTAGTTGCTTAGGG + Intergenic
934671910 2:96219543-96219565 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
934958655 2:98647677-98647699 GGAAAACTGATAGATGATGCAGG - Intronic
935063803 2:99631027-99631049 GAAACACTGTGAGCTGCTGCAGG + Intronic
935193885 2:100799600-100799622 GTAACACAGGTAGATGCTCCCGG + Intergenic
935818304 2:106868570-106868592 GAAGCACTGCTAGAGGCTTCCGG - Intronic
937530705 2:122823918-122823940 GAAAAAATGTTAGATTCTTCAGG - Intergenic
944656836 2:201883923-201883945 GGAACACTGTTTAATGATTTGGG + Intronic
946032027 2:216712994-216713016 GGAACATTGTTGGATGCTACAGG - Intergenic
1170074632 20:12406106-12406128 GAAACACTGTTGGATCTTTCTGG + Intergenic
1170481176 20:16766403-16766425 GGAACACTCTTGGGGGCTTCAGG - Intronic
1175630166 20:60528913-60528935 GGAAGACTGTTAGCCTCTTCAGG + Intergenic
1177263282 21:18755249-18755271 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
1177896489 21:26859981-26860003 GGAACACTCTTAGTTGCTTTAGG - Intergenic
1177897180 21:26867559-26867581 AGAACACTGTTAGAAGAATCTGG + Intergenic
1179258901 21:39741334-39741356 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
1184628921 22:45760256-45760278 GGCACACTCTCAGATGCATCTGG - Intronic
950669990 3:14520203-14520225 GGAACACTGCTCGCTGCTTGAGG - Exonic
951838148 3:27004510-27004532 GGAACCCTCTTAGTTGCTTTAGG - Intergenic
956043293 3:65169319-65169341 AGAACAGTGTTTGATGCTGCTGG - Intergenic
956302385 3:67786482-67786504 GGAACCCTGTTAGGTGCTCAGGG + Intergenic
956409798 3:68967782-68967804 GGAAAACTGGCAGATGCTCCAGG - Intergenic
957000048 3:74874892-74874914 GGAACACTCTTAGTTGCTTTAGG + Intergenic
958016010 3:87941296-87941318 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
958159525 3:89799498-89799520 ATAACACTGTAAGATGCTCCAGG - Intergenic
958629563 3:96669326-96669348 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
958803123 3:98779256-98779278 GGAAGTCTATTAGATGCTTTTGG - Intronic
962495686 3:135936824-135936846 GGAACCCTCTTAGTTGCTTTAGG - Intergenic
963188195 3:142441204-142441226 GGAACCCTCTTAGTTGCTTTAGG - Intronic
963809249 3:149758528-149758550 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
966353742 3:179057764-179057786 GGAACCCTATTAGTTGCTTTAGG - Intronic
969711333 4:8845975-8845997 GGCACACTGTTAAATGTTTGTGG - Intergenic
972781126 4:42287871-42287893 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
973122475 4:46539454-46539476 AGAACACTGTTAGGGGCTTAGGG + Intergenic
974452043 4:62077119-62077141 GGAATACTTTTAGATGCATTTGG - Intronic
975279650 4:72546287-72546309 AGATCTCTGTTAGATGCCTCAGG + Intronic
975313574 4:72928603-72928625 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
978485527 4:109249416-109249438 CCAACACAGTTAGATGCTTGGGG + Intronic
978586565 4:110281262-110281284 GGAACTCTCTTAGTTGCTTTAGG + Intergenic
978909797 4:114049740-114049762 GGAACCCTCTTAGTTGCTTTAGG - Intergenic
979553153 4:122013971-122013993 GGAACATTGTTGTATGCTGCCGG - Intergenic
980872564 4:138626556-138626578 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
982273782 4:153619030-153619052 GGAGAACTCTTTGATGCTTCTGG + Intronic
983666792 4:170192273-170192295 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
984723973 4:183002321-183002343 GGAACCCTCTTAGTTGCTTTAGG - Intergenic
986731073 5:10635534-10635556 TGAACACTGTTAGACTCATCAGG + Intronic
989023515 5:37039204-37039226 GGACCTCTGTTAGAGGCTACTGG - Intronic
990617505 5:57522518-57522540 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
993485740 5:88482090-88482112 AGAAAACTGTTATATGCTCCAGG - Intergenic
995750767 5:115451345-115451367 GAAACACTATTAGATGTGTCAGG + Intergenic
995820802 5:116229557-116229579 GCAACACTGTTAGCTGCTAAAGG + Intronic
996747435 5:126857416-126857438 GAAACTTTGTTAGATGCCTCTGG - Intergenic
999015157 5:148094856-148094878 GCAACACTCTCAGATACTTCAGG + Intronic
999035362 5:148343091-148343113 GGAGTTCTGTGAGATGCTTCTGG + Intergenic
999363384 5:151005160-151005182 GGAACACTGGGAGAAGTTTCTGG + Intergenic
1000067702 5:157709542-157709564 AGCAGTCTGTTAGATGCTTCTGG + Intergenic
1001037632 5:168309104-168309126 GGAGCACTGCTAGGTGCTACAGG - Intronic
1004150206 6:13111789-13111811 GAAAAACTATTAAATGCTTCTGG - Intronic
1005323430 6:24677805-24677827 GGAACCCTCTTAGTTGCTTTAGG + Intronic
1006381690 6:33701973-33701995 GGAATCCTGTGGGATGCTTCAGG + Intronic
1006998503 6:38285496-38285518 AGAACACTGTTAGATGGTGGCGG + Intronic
1008328931 6:50221981-50222003 GGAAACCTGTTTGATGCCTCAGG + Intergenic
1009434063 6:63598201-63598223 GGAATTCTGTTAGAGGCTTCTGG + Intergenic
1010893693 6:81342113-81342135 GGAACGCTCTTAGTTGCTTTAGG - Intergenic
1011539622 6:88416245-88416267 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
1013703498 6:112803114-112803136 GGTACACTATTATATGCCTCTGG + Intergenic
1015511782 6:134044766-134044788 GGCACAGTGCTGGATGCTTCAGG - Intronic
1015947546 6:138518284-138518306 GTGACACTGTTAAATGCTACTGG - Intronic
1016343014 6:143083028-143083050 GGAACATTCTTAATTGCTTCAGG + Intronic
1018602897 6:165564198-165564220 GGAACAGTGTTGGACTCTTCAGG - Intronic
1018761282 6:166896195-166896217 GGAACCCTCTTAGTTGCTTTAGG - Intronic
1021824893 7:24539926-24539948 GGAAAAATGTTAGATGCTGTGGG - Intergenic
1031264791 7:119568757-119568779 GGAACACTGTTGGTTGCTGTAGG - Intergenic
1031594782 7:123637485-123637507 GCAACAATGTTAGATGCTGTAGG - Exonic
1033517078 7:142117461-142117483 GGCATTCTGTTTGATGCTTCTGG - Intronic
1035325247 7:158061729-158061751 GGATCATTGTTAGGTCCTTCAGG - Intronic
1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG + Intergenic
1039331643 8:36543689-36543711 GGAACTTTGTTAGTTTCTTCTGG - Intergenic
1040973351 8:53162023-53162045 GGAACACTTATACATGCTTGGGG - Intergenic
1046373655 8:113347041-113347063 GGAGGACTGTTAGACACTTCTGG - Intronic
1049454053 8:142678084-142678106 GGAAGGCTGGTAGATGTTTCTGG - Intronic
1051227358 9:14915021-14915043 GGAAAACTCTTAGTTGCTACTGG + Intergenic
1053134630 9:35642802-35642824 GGAACCCTCTTAGTTGCTTTTGG + Intronic
1054730297 9:68695537-68695559 AGACCACTGTTAGAAGATTCTGG - Intergenic
1059633638 9:116152311-116152333 GGAACATTGCTACACGCTTCAGG - Intergenic
1186119670 X:6346422-6346444 TGAGCACTGTTAGATTTTTCTGG + Intergenic
1187925195 X:24243375-24243397 GGAAAACTTTTGGACGCTTCTGG + Intergenic
1189132220 X:38511607-38511629 GGAACACTGTTAGGTGAATGGGG - Intronic
1189360616 X:40347941-40347963 GGAACAGTGGTAGATGGTTGAGG + Intergenic
1189736370 X:44073634-44073656 GGAAGACTGTGAGATGCCCCCGG + Intergenic
1191166809 X:57400646-57400668 GGAACCCTCTTAGTTGCTTTAGG + Intronic
1191924970 X:66299148-66299170 GGAACCCTCTTAGTTGCTTTAGG + Intergenic
1195535190 X:106002042-106002064 GGAACCCTCTTAGTTGCTTTAGG - Intergenic
1196536033 X:116845534-116845556 GGTACACTGTTATATGCTATGGG + Intergenic
1200403893 Y:2789439-2789461 GACACAATGTCAGATGCTTCTGG - Intergenic