ID: 1094185879

View in Genome Browser
Species Human (GRCh38)
Location 12:27642158-27642180
Sequence TGGCCTCTGCCAGGTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 2, 1: 0, 2: 2, 3: 41, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094185879 Original CRISPR TGGCCTCTGCCAGGTTTTCC TGG (reversed) Intronic
901316457 1:8313070-8313092 CGGCCTCTGCCAGGTGTTGCAGG + Intergenic
902642410 1:17775277-17775299 TGGCCTCTGCAGGCTATTCCTGG - Intronic
902868862 1:19300295-19300317 TGGCTTCTGCCTAGTTTGCCTGG + Intergenic
903154459 1:21434647-21434669 TGACCTCAGCCAGTTTTCCCAGG + Intergenic
903975949 1:27150371-27150393 GGGCCTCTGCCAGGCATTCTGGG + Intronic
905765239 1:40595236-40595258 TGGGCCCTGCCAGGTCCTCCTGG + Intergenic
907946097 1:59137934-59137956 TGGCCTCTGCCACCTCCTCCAGG - Intergenic
909634991 1:77807700-77807722 TGGCCTCTTCCAGCTTTTGGTGG + Intronic
911776434 1:101819297-101819319 TGGGCTCTGCCTGATTCTCCAGG - Intronic
916427338 1:164693268-164693290 TGGCCTTTGCCTGGTTTTCAGGG + Intronic
916688509 1:167169610-167169632 TGGCCTCTCCCTGGTTTTCTTGG - Intergenic
916745770 1:167683896-167683918 TGGTCTCTGCCGGTCTTTCCTGG - Exonic
916787019 1:168093764-168093786 TGGCCTCTGCCTTGTGTCCCTGG - Intronic
919494146 1:198242859-198242881 TGCCATGTGCCATGTTTTCCAGG + Intronic
919857009 1:201712863-201712885 TGGTCTCTTCCAGGTTCTGCCGG - Exonic
920106594 1:203557628-203557650 CGGCCTCTGCCTGAATTTCCAGG - Intergenic
920262970 1:204702348-204702370 TGGCCTCTCCCAGGGCCTCCAGG - Intergenic
920963440 1:210683559-210683581 TGGCCTCACCCACGTTGTCCAGG + Exonic
921214970 1:212928905-212928927 TGGCCTCTGCGGGGGTTTCCTGG - Intergenic
1063998397 10:11642372-11642394 TGGCCTTTGGGAGGTTTACCTGG - Intergenic
1064035168 10:11908655-11908677 TGGCCCCTGCCAGGTGGACCTGG - Intergenic
1065821939 10:29533680-29533702 TGACCCCTGCCAGCTTTTACAGG - Intronic
1067700633 10:48568857-48568879 TGGTCCCTGCCATGTTTTCCAGG + Intronic
1067970144 10:50960461-50960483 TTGCCTCTTCCAGGTTTTGATGG - Intergenic
1068823604 10:61408161-61408183 CAGCTTCTGCAAGGTTTTCCAGG - Exonic
1069749287 10:70735315-70735337 TGGCCTCTGCCAGGTGGTTGGGG + Intronic
1069773911 10:70915939-70915961 CGGCCTCTGTCAGGTGCTCCAGG - Intergenic
1070552102 10:77498018-77498040 TGAGCTGTGGCAGGTTTTCCAGG - Intronic
1071983852 10:91031332-91031354 TGGCCTCTGGCAGGTAGTGCTGG + Intergenic
1072781278 10:98253453-98253475 TGGCCACAGGCAAGTTTTCCTGG - Intronic
1074060111 10:109957571-109957593 TGGCCTTTGCCAACCTTTCCAGG - Intergenic
1074118254 10:110473940-110473962 TGGTCTCTACCAGGTTATCCCGG - Intergenic
1075741727 10:124700152-124700174 TGACCGCTGGCAGGTTTCCCTGG + Intronic
1076527946 10:131124181-131124203 TGGCCTCTGACAGGTCTCCAAGG + Intronic
1076572082 10:131439542-131439564 TGGCGGCTGCCAGGATTCCCAGG - Intergenic
1078324796 11:10370707-10370729 GGGCCTCTCCCAGGGTTGCCAGG - Intronic
1078529508 11:12126068-12126090 TGGCCTATGCCAGGCTCTGCAGG - Intronic
1078580338 11:12534770-12534792 AGGCCTTTGACAGGGTTTCCAGG - Intergenic
1078952503 11:16150349-16150371 TGGGCTCTGCTAGCTTGTCCAGG - Intronic
1079273129 11:19007219-19007241 TGGGCTTTGCCATGTTGTCCAGG + Intergenic
1079373036 11:19868347-19868369 TGAGATCTGCCAGGTTTGCCAGG - Intronic
1080254620 11:30276076-30276098 TAACCTTTCCCAGGTTTTCCAGG + Intergenic
1082759165 11:57109793-57109815 CTGGCTGTGCCAGGTTTTCCTGG + Intergenic
1084891166 11:72237775-72237797 CCTCCTCTGCCAGGTCTTCCTGG - Exonic
1085449507 11:76623433-76623455 AGGCCCCGGCCAGGTTTTACTGG + Intergenic
1085802104 11:79600256-79600278 TGGCCGCTGCCTGCTATTCCAGG + Intergenic
1087014652 11:93543313-93543335 CGGCCACTGCCACGTATTCCCGG - Exonic
1087207707 11:95414798-95414820 TGGCCTCTAGCATGTTTACCAGG - Intergenic
1088503910 11:110510783-110510805 TGGCTTCTGCCTTGTTTTCTTGG + Intergenic
1088810404 11:113387977-113387999 CGGCTTCAGCCAGGTGTTCCAGG + Exonic
1088932128 11:114363023-114363045 TGGCCTCTGCCCTGGTTTCCTGG + Intergenic
1089002968 11:115067627-115067649 TGCCTTCTGCCTGGTTTTGCAGG + Intergenic
1089588242 11:119523504-119523526 CTCCCTCTGCCAGGCTTTCCTGG + Intergenic
1090240187 11:125176250-125176272 TGGCCTCTGCCAGGTCCTGTTGG + Intronic
1090419438 11:126564096-126564118 TGGCCCTTGCCAGGGTTTCTGGG + Intronic
1090763055 11:129854002-129854024 GGGCCTCTGCCTTGTTTACCCGG + Intronic
1092148378 12:6230422-6230444 TGGCCTCTGCCAGGACCGCCAGG + Intronic
1092947659 12:13471921-13471943 TGCTCTCTGCCAGGTATTCAAGG - Intergenic
1092963446 12:13618212-13618234 TGTCCTCTGCCAGTTTGGCCAGG + Intronic
1094136260 12:27130089-27130111 TGGCCTCTGCCAGGTTTTCCTGG - Intergenic
1094185879 12:27642158-27642180 TGGCCTCTGCCAGGTTTTCCTGG - Intronic
1095683692 12:45007966-45007988 TTGCCTCTTCCAGATTTTGCTGG - Intergenic
1095807170 12:46332243-46332265 TAGCCTCAGCCAGGTCTTTCCGG - Intergenic
1095960534 12:47832039-47832061 TGGCCTCTGGAAGGTTGTCAGGG - Intronic
1096005378 12:48166170-48166192 TGGCCTCTTCCTTGTCTTCCAGG - Intronic
1096850187 12:54430478-54430500 TGGCTTCTTCCATATTTTCCTGG - Intergenic
1101587211 12:106095366-106095388 AGCCCTCTGCCAGGGTTTCCAGG - Intronic
1103485435 12:121279702-121279724 TGGCCTCTGCCTGGATTTCATGG - Intronic
1104014851 12:124955071-124955093 TGGCCTCTGCCCAGATCTCCTGG - Intronic
1104555663 12:129797730-129797752 TGCCCTCTTCCAGGTTATCCAGG - Intronic
1104912881 12:132248097-132248119 TGGGGTCTTCCAGGCTTTCCTGG - Intronic
1104938908 12:132385615-132385637 AGGCCAGTGCCAGCTTTTCCTGG + Intergenic
1105783982 13:23729349-23729371 CGGCCTGTGCCAGGTGCTCCTGG - Intergenic
1106164978 13:27236635-27236657 TTGCTTCTGCTAAGTTTTCCAGG - Intergenic
1108028857 13:46207157-46207179 TTTCCTTTGCCAGGTTTTCCAGG - Intronic
1109374591 13:61474684-61474706 TGTCATCTTCCAGGTTTTCAGGG - Intergenic
1109432935 13:62259092-62259114 CGACCTCTTCCAGGTTTTGCAGG - Intergenic
1110666689 13:78125427-78125449 TGGCCTGTGCCAGATTTTATAGG + Intergenic
1112497380 13:99915828-99915850 TGGGCTTTGCCATGTTTGCCAGG - Intergenic
1113839368 13:113350069-113350091 TGGCCTCCACGAGGGTTTCCAGG - Intronic
1115137715 14:30131033-30131055 TGGGCACTGCCAAGTTTGCCAGG - Intronic
1118307173 14:64664641-64664663 TAGCCTCAGGCAGGTTTTTCAGG - Intergenic
1118588039 14:67375009-67375031 AGGCCTCTGCCTTGCTTTCCTGG - Intronic
1120521668 14:85532993-85533015 TGGCATCTGCCGGGTTAGCCAGG + Intronic
1121449800 14:93999877-93999899 TGGCCTCTGGCAAGTTCTCAAGG + Intergenic
1121569871 14:94939595-94939617 TGGCCTCTGCCAGTCCTTCAAGG + Intergenic
1121757060 14:96412078-96412100 TTTCCTCTGCCAGATTTACCAGG + Intronic
1121774748 14:96583228-96583250 CTGCCCCTGCCAGGTCTTCCAGG + Intergenic
1121840609 14:97130747-97130769 TGGCCGCTGCTAGATTTTCAGGG + Intergenic
1122229286 14:100297547-100297569 TGGACACTGCCAGGCTGTCCTGG + Intronic
1122541078 14:102497889-102497911 TGGGCTCTGCCAGAGTCTCCTGG + Intronic
1122955169 14:105067063-105067085 TGGCCTTTGCCAGGCAGTCCGGG + Intergenic
1123014677 14:105368008-105368030 TGGTCACTGCCTGGTTTCCCGGG + Intronic
1123043490 14:105500033-105500055 TGGCCACGGCCAGGTCTTGCCGG - Intergenic
1123695812 15:22878391-22878413 TGCCATCTGCCAGCTTTTCATGG - Intronic
1124059892 15:26281327-26281349 TGGGGTTTGCCATGTTTTCCAGG + Intergenic
1124399114 15:29333188-29333210 TGGCCTCTCCCTGGTTTCCCAGG - Intronic
1125504069 15:40256919-40256941 TCACCTCTGCCAGCTTCTCCAGG - Intronic
1126178178 15:45758153-45758175 TGACCTCTGCCCAGTTTTGCAGG + Intergenic
1128243941 15:66120145-66120167 TGCCCTCTACCAGGTTTCACAGG + Intronic
1128249057 15:66152136-66152158 TGGGCACTGCCAGCTTCTCCAGG + Intronic
1128810955 15:70572305-70572327 TGGCCTCTTCCAGCTTCTCAGGG - Intergenic
1129601671 15:77002693-77002715 TGGTCACTGCCAGGATTTGCTGG + Intronic
1129603058 15:77011434-77011456 TGGCCTCTGCCGGGCCTTACAGG - Intronic
1130256689 15:82329138-82329160 TGGGCTCTGCCTGGCTTTCACGG + Intergenic
1130467249 15:84198691-84198713 TAGCCTCTTCCCGGCTTTCCTGG - Intergenic
1130497013 15:84474845-84474867 TAGCCTCTTCCCGGCTTTCCTGG + Intergenic
1130598261 15:85260850-85260872 TGGGCTCTGCCTGGCTTTCACGG - Intergenic
1131030498 15:89182380-89182402 TGTCCTCAGCCAGTTTATCCTGG + Intronic
1131962892 15:97807960-97807982 TGGCCTGGGCCAGGTGTTCTAGG - Intergenic
1132568669 16:634742-634764 TGGCCTTTCCCAGGTCCTCCAGG + Exonic
1133142575 16:3758491-3758513 TGGCCTTTGCAAGGCTATCCAGG + Intronic
1133312699 16:4860548-4860570 TGGACTGTGACAGGTTCTCCTGG + Intronic
1135412451 16:22245468-22245490 AGGCCTCTGCTTGTTTTTCCCGG + Intronic
1135922424 16:26663211-26663233 TGGCCTCTGCCAAGAATTTCAGG - Intergenic
1138404545 16:56779130-56779152 TGTCTTCTGCCAGGTTCTCCAGG - Intronic
1139530476 16:67540157-67540179 TGGCCTCTGCCAGGCTGTCCCGG - Exonic
1139678895 16:68544610-68544632 TGACCTAAGCCAGGTTTTGCTGG - Intronic
1140477321 16:75245421-75245443 GGGCCTCTGCCAGCCTTTCCTGG - Intronic
1140544458 16:75792848-75792870 TGGACTCTTCCATGTTTTCCTGG + Intergenic
1141027680 16:80563459-80563481 TCTCCTCTGCCAGTTTTCCCTGG + Intergenic
1141160278 16:81625165-81625187 TGGCCTCTGCCATGTTGGTCTGG + Intronic
1141782606 16:86173839-86173861 AGGGCTCTGCCTGGTGTTCCTGG + Intergenic
1144864138 17:18324018-18324040 TGGCCTCTGCCATGTTCACACGG - Intergenic
1145266593 17:21382729-21382751 GGGCCTCAGCCAGGTGTGCCCGG + Intronic
1146804671 17:35855741-35855763 CTGCCTCTGCCAGGGTGTCCTGG - Exonic
1147866996 17:43559741-43559763 TGGCCTTGGACACGTTTTCCTGG + Intronic
1148740164 17:49888160-49888182 TCTCCTCTGCGAGGCTTTCCTGG + Intergenic
1151104824 17:71600634-71600656 TGGCCTCTTGTGGGTTTTCCAGG + Intergenic
1151251535 17:72839506-72839528 TGGCCTCTTCCAGCTTCTGCAGG - Intronic
1152521647 17:80860012-80860034 TGGCCTCTCCAAGGTGTTCTTGG - Intronic
1152924766 17:83081706-83081728 TGCCCTCTGCCAGGCTCTGCAGG - Intronic
1153613424 18:6910554-6910576 TGGTCTCTGCCAGGTCTTTGCGG + Intronic
1153811452 18:8755554-8755576 TGGCCTCAGGAAGGTTTTCTGGG - Intronic
1156936973 18:42721138-42721160 TGGCCTCTTCCAGTTTCTCCTGG - Intergenic
1159626665 18:70703189-70703211 TTGCCTCTTCCAGCTTTTCATGG + Intergenic
1160376781 18:78419887-78419909 TTGGCTCTGCTAGGTTTTCTGGG - Intergenic
1160940460 19:1618320-1618342 TGGCCTCTGCCTTGGTCTCCCGG + Intronic
1161801428 19:6418610-6418632 TGGGCTCTCCCAGGACTTCCTGG + Intronic
1163737571 19:18990685-18990707 TGGCATCTTCCAAGCTTTCCTGG + Intergenic
1163791114 19:19306572-19306594 CGACCTCTGTCAGGTTTCCCAGG - Intronic
1166391296 19:42410306-42410328 TGGCCGCTGCCTGGGCTTCCAGG - Exonic
1166392825 19:42419484-42419506 TGCCCTCTGCCAGGGATTCCTGG - Intronic
1166977262 19:46611996-46612018 AGGCCTCGGCTGGGTTTTCCTGG + Intergenic
925828224 2:7871425-7871447 TGGCCTCTTCCAGCTTTTGGTGG - Intergenic
926631926 2:15144318-15144340 TGGTCTGTGTCAGGCTTTCCTGG - Intergenic
926977334 2:18528132-18528154 TGTCCTCTGCCAGGCTTCCCAGG + Intergenic
929049802 2:37826418-37826440 TTGCCTCTTCCAGCTTTTGCTGG + Intergenic
929572862 2:43033639-43033661 CGGCCCCTGCCAGGGTCTCCCGG + Intergenic
931109875 2:59098827-59098849 AGACCTCTGCCTGGTTATCCAGG + Intergenic
931680447 2:64742988-64743010 TGTCCACTGTAAGGTTTTCCAGG + Intronic
933418484 2:82018843-82018865 TGTCCTCTGCCTGGTTCTACTGG + Intergenic
933853009 2:86385894-86385916 TGTCCTCTCCCAGTTTTCCCAGG + Intergenic
934046447 2:88176477-88176499 TGGCCTTGGGCAGGCTTTCCAGG + Intronic
936021528 2:108998684-108998706 TGGCCCCTGCCAAGTGTTCCTGG + Intergenic
937862130 2:126719412-126719434 TGGCCTCTGCCTGCTTTTTCCGG - Intergenic
942682232 2:178489358-178489380 GGGCTTCTGCCAGATTTTGCTGG + Intronic
944982328 2:205135504-205135526 TTTCATCTGCCTGGTTTTCCAGG + Intronic
947541347 2:230981969-230981991 AGGCCTCTTCCAGGATGTCCTGG - Intergenic
947801858 2:232933690-232933712 TGGCCTCTGCACAGTTCTCCAGG + Intronic
1168969858 20:1923604-1923626 CGGCCAATGCCAGGTTTTCATGG + Intronic
1168969874 20:1923678-1923700 TGGGCAATGCCAGGTTTTCATGG + Intronic
1169353813 20:4891507-4891529 TGGCCTCTGCCATAGATTCCAGG + Intronic
1170570766 20:17631179-17631201 TCTCCTCTGCCAGGTGTCCCGGG + Intronic
1172277575 20:33688205-33688227 TGGCCCCTTCCAGGGTTGCCAGG + Intergenic
1173583859 20:44166922-44166944 CGGCCCCTGCCAGGTTTTGTGGG - Intronic
1173923710 20:46765002-46765024 TGGCCCCTCGCTGGTTTTCCTGG - Intergenic
1175954688 20:62603265-62603287 TGGCCTCTGCCAGGAAATCCTGG - Intergenic
1178690105 21:34743410-34743432 GGTCCTCTGCCAGGCTTTCCTGG - Intergenic
1179132278 21:38648740-38648762 TGTCCTCTGTCTGGTTTTCATGG - Intronic
1180245023 21:46541264-46541286 AGGCCTCTGCCAGGTGGTTCTGG + Intronic
1180953514 22:19731249-19731271 TGGCCTCTGCCAGGGATGCCGGG + Intergenic
1180972817 22:19824455-19824477 TGGCTTCTGCCTGCTCTTCCAGG + Intronic
1180997099 22:19971045-19971067 TGACCTCTGCCTGGTCTTTCCGG + Intronic
1181329347 22:22077127-22077149 TGGCCTCTGACAGCTTTCCTGGG - Intergenic
1181346996 22:22226686-22226708 TGGCCTATGGCAGGTATTCTGGG - Intergenic
1181541270 22:23574455-23574477 TGGCCTCTGCTGGGTCTTCAGGG - Intronic
1182156100 22:28074537-28074559 GTGCCTCTGCCAGGTGTTCAGGG + Intronic
1182749651 22:32631326-32631348 TGGCCTCTGCAGGTTTTTCTGGG - Intronic
1182768019 22:32772767-32772789 TTGCCTCTTCCAGTTTCTCCTGG - Intronic
1183507758 22:38218966-38218988 AGGCATCTCCCAGGATTTCCTGG - Intergenic
1183710414 22:39500180-39500202 AGGGCTCTGCCAGGTTTCACAGG - Intronic
1184028898 22:41879343-41879365 GGGCCTCTTCCAGCTTTTCCAGG - Intronic
1184430144 22:44437767-44437789 GGGCCTCTGCGAGGTTACCCAGG + Intergenic
1184471220 22:44697492-44697514 AGGCCTCTTCCAGGGTGTCCGGG + Intronic
1184471553 22:44698898-44698920 TGGCCTCTGCCTGGGGTTTCTGG + Intronic
1184712889 22:46263332-46263354 CGGCCTCTCCCAGCTTCTCCTGG - Exonic
1185280658 22:49968554-49968576 TGCCCTGTGCCAGGCTTTGCAGG - Intergenic
949118554 3:358219-358241 TTGCCTTTTCCAGCTTTTCCAGG + Intronic
949217144 3:1583561-1583583 TGGGCTGTTCCAGGTGTTCCAGG - Intergenic
950023501 3:9805584-9805606 TGGCATCTTCCATGTTTTCAAGG + Intronic
950886784 3:16369287-16369309 TGCCCCCTGCCAGGTTTTGCTGG + Intronic
952120362 3:30235555-30235577 TGTCCTCTGCCTGCTTTTCTTGG - Intergenic
954524526 3:51257996-51258018 TGTCCTCATCCAGGTTTTCATGG + Intronic
956729213 3:72181410-72181432 CGGCCCCTGCCAGGTCTTCCTGG + Intergenic
957208995 3:77236469-77236491 TGGCCTGAGCCAGTTTTTCAGGG + Intronic
959945162 3:112118381-112118403 TGGCCTCTGCCTGCTCTTGCTGG - Intronic
962808211 3:138941508-138941530 CAGCCTTTGCCAGGGTTTCCTGG - Intergenic
962902917 3:139776489-139776511 TGGCCTAAGCCAGGTACTCCAGG - Intergenic
963042894 3:141082250-141082272 TGGGCTTTGCCAGGTCTCCCAGG + Intronic
964095250 3:152924057-152924079 TGTCCTCTGACAGATCTTCCAGG - Intergenic
964118487 3:153160327-153160349 TTGCCTCTGAGAGGTTTTTCTGG + Intergenic
964198841 3:154094577-154094599 TGGAATCTGCCATTTTTTCCAGG - Intergenic
964430552 3:156601613-156601635 TGGCCTCAGGCAGGTCCTCCAGG - Intergenic
968286454 3:197511860-197511882 TGGCCTCTGTCAGGGATCCCTGG - Exonic
968702856 4:2064930-2064952 TGGCCTCTCCCAGATGTCCCCGG + Exonic
968933677 4:3597881-3597903 TGGTCTGTGGCATGTTTTCCTGG - Intergenic
969317162 4:6389231-6389253 AGGCCTCGGCCAGAGTTTCCAGG - Intronic
969916412 4:10495919-10495941 TGGCCTCTTCCAGCTTTCCGTGG - Intronic
971910623 4:32792307-32792329 TGGCCTCTTCTAGCTGTTCCTGG + Intergenic
972352684 4:38251598-38251620 TGGCCTCTTCAAGCATTTCCCGG + Intergenic
972458087 4:39273517-39273539 TGGCATGTGCCCAGTTTTCCAGG + Intronic
972783705 4:42308048-42308070 TGGCCTCTGCCATCTCTTCCAGG + Intergenic
973040723 4:45466767-45466789 TTGCCTCTTCCAGGTTTTAGAGG - Intergenic
978833347 4:113116363-113116385 TGGGCTCAGCGAGGTTTTCCTGG - Intronic
979633393 4:122929052-122929074 TGGCCTATGGCAGGATTTCCTGG + Exonic
979879568 4:125938517-125938539 TGGCCTCTGTTTGGTTTTCTGGG - Intergenic
983627463 4:169816155-169816177 TTTCCTCTGCCACGTCTTCCAGG + Intergenic
983752031 4:171286001-171286023 TGGCCTTTTTCAGCTTTTCCAGG + Intergenic
985651297 5:1109009-1109031 GGGGCTCTCCCAGGTTTGCCGGG - Intronic
985801711 5:2008801-2008823 GTGGCTCTGCCAGGTATTCCAGG + Intergenic
986017593 5:3771243-3771265 TGGGCTTGGGCAGGTTTTCCTGG - Intergenic
986688154 5:10291782-10291804 TTGCCTCTGCCTGGTGTTCCAGG - Intronic
988278606 5:29114773-29114795 TGGCCCCTCCCCAGTTTTCCTGG + Intergenic
990237089 5:53779968-53779990 GGGCCTCTGGAAGGTTCTCCAGG + Intergenic
990694141 5:58396222-58396244 TGGTTTCTTCCTGGTTTTCCTGG - Intergenic
993007910 5:82448091-82448113 TGGCCTCTGCCTTCCTTTCCAGG + Intergenic
993133105 5:83923918-83923940 TGGACTCTGCAATTTTTTCCTGG + Intergenic
994808112 5:104478287-104478309 TGGGTTCTGCCATGTTTTCCAGG - Intergenic
996339339 5:122418905-122418927 CAGTCTCTGCAAGGTTTTCCTGG - Intronic
997423262 5:133785887-133785909 TGGCATCTGCCAGCTTCACCTGG - Intergenic
997437640 5:133886419-133886441 TGCCCTGTGCCAGGTATTCTAGG - Intergenic
997969888 5:138392385-138392407 GGGCCTCTGCCAGGTCCTCTTGG - Intronic
998830399 5:146151897-146151919 TTGCTTCTGCAAGTTTTTCCCGG + Exonic
998879610 5:146632897-146632919 TGGTCTCTGCCAACATTTCCAGG - Intronic
999400810 5:151262900-151262922 TGCCCTCAGCCTGCTTTTCCTGG + Intronic
1000189338 5:158894161-158894183 TGGACTCTGCCATGTTTGCTGGG - Intronic
1000639510 5:163685026-163685048 TTGGCTCTTCCTGGTTTTCCAGG - Intergenic
1001020472 5:168178355-168178377 TGCCCTCTGCCTGCTGTTCCTGG - Intronic
1002103471 5:176868707-176868729 TGGCCCCTGCCAGGGTGACCAGG - Intronic
1003221589 6:4165282-4165304 TGGGCCCTGCCAGGCTTGCCTGG + Intergenic
1003275586 6:4647801-4647823 TTCCCTCTGCCCGGTTCTCCCGG - Intergenic
1005409013 6:25522591-25522613 GGGCCTCTGAGAGGTCTTCCTGG - Intronic
1005453738 6:25999197-25999219 TGCCCTCTGCCATGTTCTTCCGG + Intergenic
1005488608 6:26324974-26324996 TGACCTCTGCCATGTTTGCTTGG - Intergenic
1006586660 6:35119424-35119446 GGGCCTATGCCAGGGTTACCTGG - Intronic
1006743018 6:36322713-36322735 TTCCCTCTGCCAGGTTTTCTGGG + Intronic
1009988985 6:70817763-70817785 TGGCTTCTACCTGGTTTTCAGGG - Intronic
1012434145 6:99197079-99197101 TGGTCTCTCCTAGGTTTTCTTGG - Intergenic
1013528246 6:110995288-110995310 TGGCCTTTGCAAGTTTTTGCAGG + Intronic
1014204135 6:118637504-118637526 GGGCTTTTGCCATGTTTTCCAGG - Intronic
1015789519 6:136952404-136952426 TGGCTTCTGCCACCTTCTCCCGG + Intergenic
1016392796 6:143591877-143591899 TGTCCACTTCCAGGTTTTCCTGG + Intronic
1016866754 6:148775206-148775228 TGTTCTCTGCCAAGTTTTGCAGG + Intronic
1018172440 6:161153123-161153145 GGGCCTGTGCCTGCTTTTCCTGG - Intronic
1018796698 6:167191451-167191473 TTGCTTCTGCCAGGTGTCCCAGG + Intronic
1018819624 6:167363679-167363701 TTGCTTCTGCCAGGTGTCCCGGG - Intronic
1018940197 6:168304530-168304552 TGGCATCTGCCCGCTCTTCCTGG + Intronic
1019267845 7:128801-128823 AGGCCACCGGCAGGTTTTCCGGG - Intergenic
1019411166 7:907381-907403 TGGCCTCTCCCTGGTGCTCCTGG - Intronic
1019440799 7:1045445-1045467 TGGCCTCTGCTAGGTGCTGCAGG - Intronic
1019463422 7:1173385-1173407 TGCCCTCTGCCAGGTTGCCGGGG + Intergenic
1019910352 7:4096746-4096768 TGGCCTCTGCTTGGTTTCCCAGG - Intronic
1021633041 7:22665276-22665298 TGGCCACTTCCAGGTTTCCCGGG - Intergenic
1021881394 7:25098373-25098395 TGGTCTCTGGCAAATTTTCCAGG + Intergenic
1022519237 7:30995213-30995235 TGGCCTCTCTCAGGTCCTCCAGG + Intergenic
1023372343 7:39524222-39524244 TGGCCTTAGCCATGATTTCCTGG + Intergenic
1024264779 7:47598224-47598246 TGGCACCTGCCAAGTTTGCCGGG + Intergenic
1024377639 7:48657274-48657296 TGTCATGTGACAGGTTTTCCAGG + Intergenic
1028678369 7:93494907-93494929 TGGCCTCTGTCAGTTCATCCCGG - Intronic
1029215699 7:98947750-98947772 TGGCCACTGCTAGGTTTTGAGGG + Intronic
1029409233 7:100398181-100398203 TGCCCTCTGCCTGCCTTTCCTGG + Intronic
1029543588 7:101198701-101198723 TGGCTTCTCCCAGCTCTTCCCGG - Exonic
1030575090 7:111275941-111275963 TGGAGTCTGCCGGGTTTTCTAGG + Intronic
1030770752 7:113472019-113472041 TGTCCTCTGCCAGTTTTCACAGG + Intergenic
1030937702 7:115606131-115606153 TGACCTCTGCCAGGTGCTCATGG - Intergenic
1031177221 7:118368672-118368694 TGGTGTCTGCCAGGCTTTGCCGG - Intergenic
1031816194 7:126439665-126439687 TGGCCTCAGGCAGGTCCTCCAGG + Intronic
1032382967 7:131503412-131503434 TGGCCTCTGCAAGGAGTGCCAGG + Intronic
1035042060 7:155936166-155936188 TTGCCTCTCCCAGGCTTTTCAGG + Intergenic
1035789533 8:2291109-2291131 TGGACTCTCCCAGGTCTGCCTGG + Intergenic
1035803272 8:2430596-2430618 TGGACTCTCCCAGGTCTGCCTGG - Intergenic
1036517570 8:9458823-9458845 TGGCCTATGGCTGGTTTCCCAGG + Intergenic
1036704588 8:11037414-11037436 TGGGCTGTGCCATGTTGTCCAGG + Intronic
1037926746 8:22849572-22849594 TGCCCACTGCCAAGTTATCCTGG + Intronic
1039423639 8:37467044-37467066 TGGCCTCTACCAGTCTCTCCAGG - Intergenic
1041728711 8:61043339-61043361 TAGCCTCTGCCATTCTTTCCAGG - Intergenic
1042411383 8:68470537-68470559 AGGCCACAGCCAGGTTTTCTTGG - Intronic
1047975699 8:130127987-130128009 TGGCTTTTGTCAGGTCTTCCAGG + Exonic
1048326871 8:133446735-133446757 TGGCCTCTGCCTGGCATACCAGG + Intergenic
1048329856 8:133464056-133464078 TGTCTTCTGCCAGGTTTTCTAGG - Intronic
1048665428 8:136656044-136656066 AGGCATCAGCCAGGTCTTCCAGG + Intergenic
1048910663 8:139131780-139131802 TAGCCTCAGCCAGGTTTGCGTGG + Intergenic
1049031277 8:140039821-140039843 TGGCCACTGACAAGTTGTCCAGG - Intronic
1049429030 8:142550723-142550745 CGGCCTCTCCCAGGGGTTCCGGG + Intergenic
1049556873 8:143286933-143286955 AGGTCTCTGCCAGGGTCTCCTGG + Intergenic
1050531565 9:6594502-6594524 AGGGCTTTGCCATGTTTTCCAGG - Intronic
1051358159 9:16258671-16258693 TTGCCTCTGCCAGCTTTTAGAGG + Intronic
1052318678 9:27143852-27143874 TGGCATCTGGCAGGTTTCCCAGG + Intronic
1052428273 9:28332881-28332903 TGGTCTCTGCCTTGTTTTCTAGG + Intronic
1054456466 9:65433935-65433957 TGGTCTGTGGCATGTTTTCCTGG + Intergenic
1055173855 9:73293415-73293437 TGGCCTGTACAAGTTTTTCCTGG + Intergenic
1055315311 9:75028397-75028419 TGGGCTCCGCCAGGTCTTCAGGG + Intronic
1056823365 9:89860063-89860085 TGGTCCCTGGCAGGGTTTCCGGG + Intergenic
1057518251 9:95739306-95739328 GAGCTTCTGCCATGTTTTCCTGG + Intergenic
1057733652 9:97633412-97633434 TGGCCTCTCAATGGTTTTCCCGG - Exonic
1060253840 9:122007895-122007917 TGGTGTCTGCCAGATTTTCATGG - Intronic
1060259405 9:122060853-122060875 TGCCCTCTTCCAGGTATTCCTGG + Intronic
1060769927 9:126325908-126325930 TGGCCTCTGCCTGGGGTGCCTGG + Intergenic
1060802017 9:126550944-126550966 TCCCCCCTCCCAGGTTTTCCTGG + Intergenic
1061039591 9:128132220-128132242 TGGTCCCTGGCAGGGTTTCCGGG - Intergenic
1061116916 9:128619464-128619486 TTGCCTCTTCCAGTTTTTGCTGG + Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061627615 9:131850542-131850564 TGGGCACTGCCCCGTTTTCCTGG - Intergenic
1061884978 9:133586845-133586867 TGGCCTCAGCCAGGCTTTGCGGG + Intergenic
1062022500 9:134326161-134326183 TCGCCTCCGCCAGGGGTTCCCGG - Intronic
1062355143 9:136158351-136158373 TGGCAGCTGCCAGGTTTTCCAGG + Intergenic
1062405796 9:136395635-136395657 TGGCCTCAGCCAGCTTCTCCTGG + Exonic
1062721921 9:138049150-138049172 TGGCCTCTGCCTGTCTTTTCTGG + Intronic
1187063408 X:15809724-15809746 TGGCATGTGCCAGGAGTTCCAGG + Intronic
1192700091 X:73459577-73459599 TGGCCTCTTCCAGCTTCTCTTGG - Intergenic
1195083213 X:101390247-101390269 TGCCTTCTGCCAGGTTTGCAAGG + Intronic
1195703045 X:107719165-107719187 TGTCCTGTGCCCTGTTTTCCTGG - Intronic
1195776369 X:108410447-108410469 TGGCCTTTACCATGTTTTCCAGG + Intronic
1196324895 X:114391096-114391118 TGGCATCTTCCTGGTTGTCCTGG - Intergenic
1196588271 X:117456002-117456024 TGGCCTCTGCCTGCCTCTCCAGG - Intergenic
1196763226 X:119219019-119219041 AGGCCTCAGCCTTGTTTTCCAGG + Intergenic
1200069548 X:153521205-153521227 TGGCTTCTGCCAGCTTAGCCAGG - Intronic
1200834601 Y:7721072-7721094 TGCTCCCTGCCAGGTTTTGCTGG + Intergenic
1202368886 Y:24184330-24184352 TAGCCTCTTCCCGGCTTTCCTGG + Intergenic
1202501899 Y:25485787-25485809 TAGCCTCTTCCCGGCTTTCCTGG - Intergenic