ID: 1094186268

View in Genome Browser
Species Human (GRCh38)
Location 12:27646264-27646286
Sequence ATAAGCCATCTGTACACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094186268 Original CRISPR ATAAGCCATCTGTACACAAT AGG Intronic
907068155 1:51507260-51507282 ATAAAATATCTGTACACATTAGG + Intronic
915060448 1:153178121-153178143 ATAAACCATCACCACACAATTGG - Intergenic
915610269 1:156986318-156986340 ATTAGCCATGTGTACACCACTGG + Intronic
916582587 1:166121973-166121995 ATAGGCCATGAGTACACAATGGG - Intronic
1063560698 10:7123851-7123873 TCAAGACTTCTGTACACAATGGG - Intergenic
1065397995 10:25262164-25262186 TTAAGCCATCTGTTCACTGTGGG - Intronic
1066007430 10:31158432-31158454 ATAAGCCATACGTAAACAAATGG - Intergenic
1069319512 10:67151023-67151045 ATTAGCCATCTGTGCATCATGGG - Intronic
1073210276 10:101795472-101795494 TTCTCCCATCTGTACACAATGGG + Intronic
1073851502 10:107624315-107624337 ATATGGTATATGTACACAATGGG - Intergenic
1077842082 11:5986325-5986347 AACAGCCATATGTTCACAATAGG + Exonic
1077849143 11:6057670-6057692 AACAGCCATATGTTCACAATAGG + Intergenic
1079590226 11:22174620-22174642 ATAAGCCATAAGTAACCAATTGG + Intergenic
1080340839 11:31261768-31261790 ATATGGCATTTGTACACAGTAGG + Intronic
1086943296 11:92820277-92820299 AAAGGCCATGTGAACACAATGGG - Intronic
1088548995 11:110991377-110991399 ATAAGTCATATGTGCACATTGGG + Intergenic
1090691832 11:129191595-129191617 ATAACCAATCTGTACTTAATCGG + Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093721322 12:22445219-22445241 ATATGGTATCTATACACAATGGG + Intergenic
1094136608 12:27133796-27133818 GTAAGCCATCTGTAACCAATAGG + Intergenic
1094186268 12:27646264-27646286 ATAAGCCATCTGTACACAATAGG + Intronic
1094321209 12:29185535-29185557 ATAAGCCATCATTAGACATTAGG + Intronic
1094620823 12:32078804-32078826 ACAGACCATCTGGACACAATGGG + Intergenic
1098135929 12:67401725-67401747 ATAAGCAATGTGTAAACAAATGG - Intergenic
1103289678 12:119834882-119834904 ATATGACATATGTAAACAATGGG + Intronic
1105994741 13:25659507-25659529 ATAAGCTATCTCTACACCACTGG + Intronic
1108371339 13:49772359-49772381 ATAAGACATCTCTACACACTTGG + Intronic
1108960194 13:56217345-56217367 ATGAGCCATCTTGTCACAATGGG + Intergenic
1110279177 13:73672710-73672732 ATAAGCCATATGAACAGAATTGG + Intergenic
1110407973 13:75171759-75171781 ATAATCCATATTCACACAATAGG + Intergenic
1111666824 13:91279737-91279759 ATAAACTATCTGTATACAAGTGG + Intergenic
1114581788 14:23767617-23767639 ATAAACCATCTAAACACTATGGG + Intergenic
1118138929 14:63058424-63058446 TTAAGCCATCTGTTTACAAGAGG - Intronic
1122386599 14:101352573-101352595 ATAAGACATCACTACACAAATGG + Intergenic
1126840010 15:52708764-52708786 ATTAGCTATCTGTAAACAACTGG - Intronic
1127450369 15:59110618-59110640 ATAAGCCATGTGTCCATGATAGG + Intronic
1128668912 15:69559583-69559605 ATAAGCCCTCAGTAAATAATAGG - Intergenic
1132243536 15:100278026-100278048 ATAAGCCATTTGTCCACAAAAGG + Intronic
1133828487 16:9300315-9300337 ATAAGCAATCTTCACGCAATAGG - Intergenic
1133990300 16:10701419-10701441 ATATGCCATGTGTACACCCTGGG - Intergenic
1136377074 16:29872028-29872050 GCAAGCCATGTGTATACAATAGG - Intronic
1137307256 16:47214764-47214786 ATAATCTATCTGTAAGCAATAGG + Intronic
1141347558 16:83261322-83261344 ATAAGCCAGCTGTTCTCAATTGG + Intronic
1143759356 17:9089906-9089928 ACAAGCTATCTGGACACAGTAGG + Intronic
1147379074 17:40041951-40041973 ATAGCCCATCTGTAAACAAATGG - Intronic
1148336600 17:46846190-46846212 ATGAGCCATCTGTACTGAAACGG - Intronic
1155063598 18:22250105-22250127 ATAAGGCATCTGTATACATATGG - Intergenic
1156794036 18:41018803-41018825 ATAAGCCATCAGAATAGAATAGG + Intergenic
1157460072 18:47883296-47883318 ATAAGACATCTGTTAAGAATTGG - Intronic
1159727003 18:71973748-71973770 AGAAGACATTTGTACACAAAAGG + Intergenic
1162686708 19:12392198-12392220 ATACGACATCTGTAAAAAATGGG + Exonic
1162691058 19:12431972-12431994 ATACGACATCTGTAAAAAATGGG + Exonic
1164187220 19:22880888-22880910 AAAAGCCATGTGTAAATAATAGG - Intergenic
932811211 2:74827749-74827771 ATAAGACATCTGTACTGGATTGG - Intergenic
933207712 2:79527945-79527967 ATAAGGCATATTTATACAATGGG + Intronic
940844463 2:158624873-158624895 ATCAGCCATCAGTAGCCAATCGG + Exonic
941209694 2:162622335-162622357 ATTAGCCACCTGATCACAATGGG + Intronic
942521806 2:176812021-176812043 AGAAGCCATGTGTGCACACTAGG - Intergenic
1178115209 21:29409906-29409928 TTAAGCCATCTTTACAACATGGG + Intronic
1180114406 21:45689242-45689264 ATAAGCCATCAGGACCAAATGGG + Intronic
1181146167 22:20849222-20849244 ACAAGCCCTCTGTACACCGTTGG + Intronic
1183142828 22:35960087-35960109 ATACGCCAACTGTACAGAACAGG + Intronic
951931759 3:27975284-27975306 ATATGCCAGCTGGCCACAATAGG + Intergenic
954413893 3:50383578-50383600 ACAAGGCAGCTTTACACAATGGG - Intronic
966120177 3:176511951-176511973 AAAAGCCATTTGTAAATAATAGG + Intergenic
971669616 4:29540228-29540250 ATGAGACTTCTGTACACAGTAGG - Intergenic
972075867 4:35086356-35086378 ATAAACCATATTTAAACAATAGG - Intergenic
972901537 4:43691088-43691110 ATATGCCACGTATACACAATGGG - Intergenic
975362183 4:73483772-73483794 ATAAGTCATGTGAACAAAATAGG - Intronic
983595508 4:169461958-169461980 ATAATCCATTTGCACAGAATTGG - Intronic
984017003 4:174438751-174438773 ATAACCCATCGGTACATATTAGG - Intergenic
986943370 5:12984592-12984614 AGAAGCCATCTCTTTACAATTGG + Intergenic
987122050 5:14776936-14776958 ATCAGTCTTCTCTACACAATGGG + Intronic
987615562 5:20269504-20269526 ATACGCTATATATACACAATGGG + Intronic
987799223 5:22671753-22671775 ATAAGCCAACTGTGAACAAAGGG + Intronic
987810228 5:22825684-22825706 GTAAGTCCTCTGTACACAATTGG + Intronic
988653228 5:33176935-33176957 ATAAGCCCTCTGTTCTCAAAAGG + Intergenic
990800545 5:59597821-59597843 AGAGGGCATCTGTCCACAATGGG - Intronic
997921213 5:137981108-137981130 AGAACCCATCTGTACAAAAATGG - Intronic
999457185 5:151726681-151726703 ATGAGCCATCTTTACACACATGG - Intergenic
1005016063 6:21376446-21376468 ATAAGTTATGTGTACACAAATGG - Intergenic
1005213187 6:23493287-23493309 ATCAGCCATCCGGAAACAATAGG + Intergenic
1008214836 6:48776489-48776511 TTAAGCCATTTGTACAAAACAGG + Intergenic
1010170514 6:72969974-72969996 ATGAGCCACCTGCACCCAATGGG - Intronic
1011709763 6:90040910-90040932 ATAATCCATTAGTACATAATGGG + Intronic
1015166663 6:130206852-130206874 ATGAGCCATGTGAAAACAATTGG + Intronic
1017333419 6:153226201-153226223 ATAAGAAATCTTTACACATTAGG - Intergenic
1022041380 7:26584904-26584926 ATAAGCAATCTGTTTACCATGGG - Intergenic
1022362564 7:29676290-29676312 AGAAGCCATATATACATAATGGG - Intergenic
1022698834 7:32737502-32737524 AGAAGCCATATATACATAATGGG + Intergenic
1024375170 7:48629268-48629290 AGAATCCAACTGTACACTATGGG + Intronic
1027818396 7:83009788-83009810 ATAGGCAATCTGTAGATAATGGG - Intronic
1028251559 7:88544509-88544531 AAAAGCCATGTGTAAACATTAGG + Intergenic
1028410750 7:90528086-90528108 ATAAGCCCTCTGTAAACAAGTGG - Intronic
1028679150 7:93505676-93505698 ATAAGCCATGTCTACAAAATAGG + Intronic
1028926459 7:96361816-96361838 AAAAGCCATTTGTTTACAATGGG - Intergenic
1030439234 7:109565482-109565504 AGAAGACAACTGTAAACAATAGG - Intergenic
1031764109 7:125754406-125754428 ATGAGGCATATATACACAATGGG - Intergenic
1034328477 7:150260088-150260110 ATAGGCAATATATACACAATGGG - Intronic
1034764732 7:153709304-153709326 ATAGGCAATATATACACAATGGG + Intergenic
1036936040 8:13003650-13003672 CTAAGCCAGCTGAACCCAATGGG + Intronic
1039295838 8:36152999-36153021 ACAAGCCAAATGTCCACAATAGG - Intergenic
1044154616 8:88828189-88828211 AGAAGGCATTTGTAAACAATAGG + Intergenic
1045872408 8:106941388-106941410 TTAAGACATCTGTAAATAATTGG - Intergenic
1047859054 8:128944691-128944713 AAAACCATTCTGTACACAATAGG - Intergenic
1048024795 8:130576443-130576465 ATAAGGGATTTGAACACAATCGG - Intergenic
1050015797 9:1232565-1232587 AGAAGCCATGTGTAAACAGTTGG + Intergenic
1051213025 9:14765485-14765507 ATAAAGCACCTGTACACAGTGGG + Intronic
1187330056 X:18329530-18329552 ATAAGTCATATGTACACAAAAGG - Intronic
1188706681 X:33342154-33342176 ATAAACCTTCTGTACAGCATAGG - Intergenic
1193587648 X:83345468-83345490 AAAACCCATCTGTCCTCAATGGG - Intergenic
1194562153 X:95435769-95435791 ATGAACCCTCTGTACACCATAGG - Intergenic
1196241623 X:113348725-113348747 TTAAGCCACATGTACACAAAAGG - Intergenic