ID: 1094188918

View in Genome Browser
Species Human (GRCh38)
Location 12:27676939-27676961
Sequence CACCGTGGAGGAGAGGCATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094188918_1094188922 -9 Left 1094188918 12:27676939-27676961 CCGCATGCCTCTCCTCCACGGTG 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1094188922 12:27676953-27676975 TCCACGGTGTGTATTTGGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 37
1094188918_1094188924 -6 Left 1094188918 12:27676939-27676961 CCGCATGCCTCTCCTCCACGGTG 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1094188924 12:27676956-27676978 ACGGTGTGTATTTGGCGAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094188918 Original CRISPR CACCGTGGAGGAGAGGCATG CGG (reversed) Intronic
900395465 1:2451576-2451598 CACCGTGGAGGGCAGCCCTGTGG + Intronic
900406559 1:2495517-2495539 CAGCGTGGAGGAGGGAGATGAGG + Exonic
902402840 1:16167504-16167526 CCACGTGGAGGAGAGGCAGGTGG + Intergenic
903641309 1:24862195-24862217 CACCGTCTAGGACAGGGATGCGG - Intergenic
904336302 1:29800501-29800523 CAGCCTGGAGGAGAGGAACGGGG - Intergenic
905495446 1:38381481-38381503 CACCGTGGAAGAGATGGGTGAGG - Intergenic
906078842 1:43070387-43070409 CATGATGGAGGAGAGGCCTGTGG - Intergenic
906704137 1:47882362-47882384 CAGGGTGGAGGAGAGGGATGAGG - Intronic
907399842 1:54218278-54218300 TTCCGTGGAAGAGAGGCAAGAGG - Exonic
907404627 1:54246349-54246371 CACAGTGGAGAATAGGCCTGGGG - Intronic
912159719 1:106966925-106966947 CACCATGGTGGGGAGGCATAGGG - Intergenic
913127364 1:115805231-115805253 CTGAGTGGAGGTGAGGCATGTGG - Intergenic
916602099 1:166303273-166303295 CAGCGTGGAGAAGGGCCATGTGG - Intergenic
917440777 1:175067088-175067110 CACAGAGCAGGAGAGGGATGGGG + Intergenic
922345324 1:224691514-224691536 CAAGGAGGATGAGAGGCATGGGG + Intronic
922422136 1:225467314-225467336 CCCCGGGGAGGACAGGCAAGAGG + Intergenic
922932184 1:229398657-229398679 CCCAGGGGAGGAGAGGAATGGGG - Intergenic
1063381388 10:5588384-5588406 AAGCGAGGAGGAGAGTCATGAGG + Intergenic
1064839385 10:19573444-19573466 CCCAGTGGAGCAGAGACATGAGG + Intronic
1065954721 10:30683696-30683718 CAGTGAGGAGGAGAGGCATCAGG + Intergenic
1067344780 10:45429215-45429237 GACCCTGGAGGAAAGGCAGGCGG + Intronic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1072826200 10:98609165-98609187 CTGGGTGGAGGACAGGCATGGGG - Intronic
1073285104 10:102382778-102382800 CACCATGGAGGGTAGGCAGGTGG + Exonic
1074955403 10:118383877-118383899 AACCTTGGAGGAGATGCAAGAGG + Intergenic
1075261586 10:120967807-120967829 TGCCATGGAGGAGAGGCGTGTGG - Intergenic
1076143326 10:128096870-128096892 CAGCCTGGAGGACAGGCATGGGG + Exonic
1076307510 10:129475385-129475407 CACAGTGCATGAGAGGCGTGAGG + Intronic
1076772878 10:132676685-132676707 CACCTTGGAGCAGAGTCAGGAGG - Intronic
1077276781 11:1715237-1715259 CTAGGTGGAGGAGAGGCCTGTGG - Intergenic
1082957353 11:58884666-58884688 CACCAGGGAGGAAGGGCATGGGG + Intronic
1083201130 11:61121666-61121688 CACCGTGGAGGTGCGCCAGGGGG + Exonic
1083445498 11:62705781-62705803 CACAGTGGAGGAAAGGGAAGGGG - Intronic
1084673722 11:70622358-70622380 CACCGGGGTGGAGAGGACTGAGG - Intronic
1086983443 11:93223642-93223664 CACCCTGGAGGAGTGGCACGGGG + Intergenic
1087272462 11:96125381-96125403 GAAGGTGCAGGAGAGGCATGAGG + Intronic
1092957775 12:13565518-13565540 CACCGTGCAGGAGAGGCAACGGG + Intronic
1094188918 12:27676939-27676961 CACCGTGGAGGAGAGGCATGCGG - Intronic
1101571857 12:105960957-105960979 CACCCTGGTGCAGAGGCATGTGG + Intergenic
1101789267 12:107912722-107912744 CACCGGGGAGGAAAGGGAGGGGG + Intergenic
1103377661 12:120469385-120469407 CACCGAGGAGGAGAGGGCAGGGG + Intronic
1104756275 12:131271208-131271230 CACTGGGGAGGGGAAGCATGAGG - Intergenic
1104939255 12:132387193-132387215 CACCGTGGACAGAAGGCATGTGG + Intergenic
1105994128 13:25654030-25654052 CACTGTGAAGGTAAGGCATGAGG + Intronic
1107317209 13:39146005-39146027 CACCGAAGAGGAGACGCTTGAGG + Intergenic
1112915180 13:104539483-104539505 CTTAGTGGAGGAGAGGTATGTGG + Intergenic
1114495379 14:23128195-23128217 ATCTGTGGAGCAGAGGCATGAGG + Exonic
1114645644 14:24254661-24254683 CACCGTGAGGGAGAGGTCTGGGG + Exonic
1114712768 14:24795065-24795087 CAGCGTGAAGGAGAGGGGTGGGG - Intergenic
1117271299 14:54146482-54146504 CGCTGTGGAGGATAGGGATGTGG - Intergenic
1118443127 14:65829666-65829688 CACCCAGGAGGACAGGAATGGGG + Intergenic
1120517675 14:85489867-85489889 CACAGTGGAGGAGAGAGATTGGG - Intergenic
1121701377 14:95956867-95956889 CAGAGTGGAGGAGGTGCATGTGG - Intergenic
1121847020 14:97180804-97180826 CTCCATGGATGATAGGCATGGGG + Intergenic
1122092340 14:99348860-99348882 CTCCGTGGAGGGGATGCAGGCGG + Intergenic
1123068045 14:105628036-105628058 CACAGGGGAGGAGGGGCAGGTGG - Intergenic
1123874947 15:24614678-24614700 TCCAGTGAAGGAGAGGCATGTGG - Intergenic
1124218840 15:27832181-27832203 CAACGTGGATGTGAGCCATGAGG - Intronic
1125921317 15:43527463-43527485 CTCCTTGGTTGAGAGGCATGGGG - Exonic
1127363108 15:58262359-58262381 CACCCTGGAGGTGAGGTAGGTGG - Intronic
1127937303 15:63654272-63654294 CAGCCTGGAGGAGAGGCAGCAGG + Exonic
1128510737 15:68312697-68312719 CATCCTGGAGGGGAGGAATGTGG - Intronic
1128944816 15:71812991-71813013 AAACCAGGAGGAGAGGCATGAGG + Intronic
1129104540 15:73297065-73297087 CACCTGTGAGGAGAGGGATGGGG - Intronic
1131798346 15:96043773-96043795 CACCGAGGGAGGGAGGCATGGGG + Intergenic
1133108909 16:3533899-3533921 AACCCTGGAGAAGAGGCAGGCGG - Intronic
1134089404 16:11383644-11383666 CACTGTGGAGGAGGGGCCAGGGG + Exonic
1134687594 16:16169605-16169627 CAGCTGGGAGGAGAGGGATGAGG + Intronic
1137444875 16:48525615-48525637 CTCCTTGGAGGAGAAACATGTGG - Intergenic
1137964405 16:52916408-52916430 CATCGTGGGGGAAAGGCAAGTGG - Intergenic
1138531642 16:57637713-57637735 CTCCGTGGAGCAGAGCCAGGAGG - Intronic
1139635346 16:68255295-68255317 CACCATGGTGGAGAGCCTTGTGG + Exonic
1139748849 16:69096285-69096307 CACTTTGGAGGTGAGGCAGGTGG + Intergenic
1141462218 16:84184297-84184319 GACAGTGGAGCAGAGGCTTGGGG - Intronic
1142122621 16:88394556-88394578 CACCTTGAAGGACAGGCCTGTGG + Intergenic
1142234506 16:88915429-88915451 CAGCGTGGAGGAGTGGAACGTGG + Intronic
1142407066 16:89896163-89896185 CACCCTGGAGGGCAGCCATGAGG - Intronic
1142415584 16:89939333-89939355 CCCCGTGGAGGAGACACTTGGGG - Intergenic
1142568953 17:859791-859813 CCCCGTGGAGGACAGGGAAGGGG - Intronic
1142913393 17:3113863-3113885 CACTGAGGAGATGAGGCATGTGG - Intergenic
1143023128 17:3926883-3926905 AACCATGGAGGACAGGCAAGAGG - Intronic
1146449245 17:32959367-32959389 CAAGGAGGATGAGAGGCATGTGG - Intergenic
1147838170 17:43349990-43350012 CTCCTTGGAGGAGAGGAAAGAGG + Intergenic
1148204997 17:45774623-45774645 CCCCGTGGAGGAAATGCAGGTGG - Intergenic
1148587354 17:48790498-48790520 CAGGGTGGAGGGGAGACATGTGG + Intronic
1150145484 17:62765585-62765607 CCCTCTGAAGGAGAGGCATGTGG + Intronic
1150484110 17:65532291-65532313 GACCTTGGAGAAGAGCCATGTGG - Intronic
1150538797 17:66075684-66075706 TATGGTGGATGAGAGGCATGAGG + Intronic
1150976350 17:70091419-70091441 CACAGTGCAGGAGAGGCCTATGG + Intronic
1152053064 17:77997579-77997601 CAGGGTGGAGCGGAGGCATGAGG + Intergenic
1152470405 17:80487896-80487918 CACGGTGGAGGGGAGGGATGTGG + Intergenic
1152470661 17:80488871-80488893 CACAGTGGAGGGGAGGGAAGTGG + Intergenic
1152470744 17:80489160-80489182 CACAGTGGAGGGGAGGGAAGTGG + Intergenic
1152470832 17:80489445-80489467 CACGGTGGAGGGGAGGGAAGTGG + Intergenic
1152470899 17:80489658-80489680 CACAGTGGAGGGGAGGGACGCGG + Intergenic
1152470909 17:80489694-80489716 CACAGTGGAGGGGAGGGAAGTGG + Intergenic
1152470986 17:80489943-80489965 CACGGTGGAGGGGAGGGACGCGG + Intergenic
1152666163 17:81570822-81570844 CCCTGTGGAAGTGAGGCATGGGG - Intronic
1152705508 17:81841546-81841568 CAGCCTGGAGCAGAGGCAGGAGG + Intergenic
1152928707 17:83099480-83099502 CACTGGGGAGGGGAGGCATGGGG - Intergenic
1153804950 18:8703838-8703860 CAACCTGGAGGAGAGGGAGGTGG - Intergenic
1155397939 18:25406123-25406145 CTCCGTGGAGGTGAGGAGTGTGG + Intergenic
1156992261 18:43423382-43423404 CAACGTGTAGGAGAAGCAAGGGG - Intergenic
1158017990 18:52807273-52807295 CACCGTGCTAGAGAGGCAGGAGG - Intronic
1158695306 18:59697792-59697814 CACCGGGGAGAAGAGGGAGGGGG + Intergenic
1161038778 19:2099168-2099190 CAGCTGGGAGGAGAGGCCTGGGG + Intronic
1161281679 19:3449008-3449030 CACCGGGGACGAGATGCCTGTGG - Exonic
1161308179 19:3578581-3578603 CCCCGTGGACGAGAGGCTGGGGG + Exonic
1161391174 19:4021388-4021410 CACTGTGGAGGCGAGGCAGGTGG - Intronic
1162046185 19:8001988-8002010 CACCCTGGTGGAGAGGCTGGGGG - Intronic
1164726438 19:30468814-30468836 CAACAGGGAGAAGAGGCATGGGG + Intronic
1165104014 19:33458032-33458054 TACCGTGTATGTGAGGCATGTGG + Intronic
1165154241 19:33777654-33777676 CAGGGTGAAGGAGAGGCAGGAGG - Intergenic
1166864838 19:45829504-45829526 CACCTTTGAAGAGAGGGATGGGG + Intronic
1166962594 19:46507831-46507853 CACCAAGGAGGAGACACATGAGG + Intronic
1167557767 19:50206317-50206339 CTCCAGGGAGGAGAGGCATAGGG + Intronic
1167903235 19:52637807-52637829 GACTGTGGAGGAGAGACCTGTGG + Intronic
925982806 2:9190966-9190988 CACAGTGGTGGGGATGCATGTGG + Intergenic
926302811 2:11616694-11616716 AGCCTTGGAGGAGAGGGATGAGG - Exonic
929763982 2:44829111-44829133 AACAGTGGTGGAGAGGCATACGG - Intergenic
931586412 2:63834685-63834707 CACCTTGGATAAGAGGCCTGTGG - Intergenic
934683964 2:96306753-96306775 CACTGAGGAGCAGAGCCATGAGG - Intergenic
935585756 2:104798614-104798636 CTCCTGGGAGGAGAGGGATGAGG + Intergenic
937918721 2:127114934-127114956 GACCGTGTAGGAGAGACCTGTGG + Intergenic
939745074 2:145958025-145958047 CACTGTGGAGGATAGGGGTGTGG + Intergenic
940268808 2:151869425-151869447 CACCCTGGAGGAGAACCAAGGGG - Intronic
944055861 2:195521188-195521210 GACAGTGGAGGTGAGGTATGAGG - Intergenic
945991389 2:216398244-216398266 CAACATGGAGGAGATGCATCTGG - Intergenic
946021569 2:216643965-216643987 CAAGGAGGAGGAGAGGCATAGGG - Intronic
946469771 2:219947734-219947756 CAATGTGCAGCAGAGGCATGAGG - Intergenic
947635530 2:231679099-231679121 CTGAGTGGAGGAGAAGCATGGGG + Intergenic
948388838 2:237598075-237598097 AACAGTGGAGGTGGGGCATGGGG - Intronic
1168949584 20:1787446-1787468 CACCGTGGAGGCCAGGAATGGGG + Intergenic
1173924135 20:46768242-46768264 CAGGGTGGAGGAAAGCCATGGGG - Intergenic
1174135896 20:48378996-48379018 CACAGTGAAAGAGAGGCATGGGG - Intergenic
1174731571 20:52923170-52923192 CAAGGTGGGGGAAAGGCATGTGG + Intergenic
1176901701 21:14450088-14450110 CACAGTGGATGAGAGTCATATGG - Intergenic
1177369786 21:20187313-20187335 CTCTGTGGTGCAGAGGCATGAGG - Intergenic
1177663431 21:24119312-24119334 CACCGAGGTGGAGAGGAAGGAGG + Intergenic
1178190360 21:30273080-30273102 TACCGTGGTGGGGAGGCCTGGGG + Intergenic
1179081178 21:38172033-38172055 CTCCTTGGGGAAGAGGCATGAGG + Intronic
1180183109 21:46126702-46126724 CACAGGGGAGGAGGGGCTTGGGG + Intronic
1180229700 21:46419725-46419747 GACCGTTGAGGAGGGGCAAGGGG - Intronic
1180783299 22:18533889-18533911 TGCAGTGGAGGAGAGGCCTGTGG - Intergenic
1181126863 22:20707934-20707956 TGCAGTGGAGGAGAGGCCTGTGG - Exonic
1181240198 22:21473241-21473263 TGCAGTGGAGGAGAGGCCTGTGG - Intergenic
1182551004 22:31100679-31100701 CACAGTGGGGAGGAGGCATGCGG + Intronic
1183478455 22:38050096-38050118 CAGCCTAGAGGAGAGGGATGAGG - Intergenic
1184455005 22:44605077-44605099 CCCTGGGGAGGAGGGGCATGAGG + Intergenic
1184650347 22:45916744-45916766 CAGCGGGGAGGAGACGCAGGCGG - Intergenic
1185210207 22:49566464-49566486 CACCGTGCAGCAGTGGGATGTGG - Intronic
950180591 3:10910395-10910417 CCACATGGAGGAGAGGGATGTGG + Intronic
950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG + Intergenic
952151870 3:30602064-30602086 CAGGGAGGAGGAGAGACATGTGG - Intergenic
952240838 3:31530359-31530381 CACTGTGGAGGACAGGCACATGG - Intergenic
953026091 3:39146117-39146139 CCCCGTGGCAGAGAAGCATGGGG + Intronic
953886118 3:46715248-46715270 TCCCGTGGAGAGGAGGCATGAGG + Intronic
955391292 3:58524294-58524316 GACCGGGGAGGCTAGGCATGGGG + Intronic
960052910 3:113254677-113254699 CAGCGTGGAGAAGAGGCCAGAGG - Intronic
960899506 3:122540754-122540776 CAACGTGGAAGAGATGTATGAGG - Exonic
962272831 3:133990720-133990742 CACCTGGGAGGTGAGGCTTGGGG + Intronic
964402246 3:156311532-156311554 CTGCCTGGAGCAGAGGCATGGGG + Intronic
968615183 4:1574597-1574619 CACAGAGGAAGAGAGGCGTGGGG - Intergenic
968748688 4:2374867-2374889 CACCGAGGAGGAGCCGAATGTGG - Intronic
972835496 4:42865528-42865550 CGTCTTGGAGGAGAGGCAGGAGG + Intergenic
975794174 4:77988603-77988625 CACTGTGGAGGAGGTGGATGTGG - Intergenic
980677645 4:136109781-136109803 CACTTTGGAGGCGAGGCAAGAGG - Intergenic
985874026 5:2581720-2581742 CAGCTTAGAGGAGAGGCAAGAGG - Intergenic
985998304 5:3610186-3610208 CTCCCAGAAGGAGAGGCATGAGG + Intergenic
988465197 5:31483764-31483786 CACTGAGGAGGAGTGGCAGGAGG - Intronic
992050409 5:72935569-72935591 CACCGTGGAGCAGGGGCAGGGGG - Intergenic
992557233 5:77915851-77915873 CACCAGGGAGGAGAGGCCAGAGG + Intergenic
994128655 5:96198503-96198525 CAAGGAGGAGGAGAGCCATGTGG - Intergenic
995244698 5:109922518-109922540 CACGGTGGAGGAAAGGTGTGGGG + Intergenic
996715747 5:126586717-126586739 CAAAGTGGAGGAAAAGCATGGGG + Intronic
999449484 5:151667502-151667524 CACCCTGTATGAGAGGGATGAGG - Exonic
999625232 5:153513435-153513457 AACAGTGGAGGAGATGCACGGGG + Intronic
999890891 5:155977665-155977687 CACCCAGGAGGGGAGGCATCAGG + Intronic
1001416955 5:171552049-171552071 CTCCGTGCAGAAGAGGCATCTGG + Intergenic
1001426993 5:171629261-171629283 GACCATGGAGGACAGGGATGGGG + Intergenic
1001582293 5:172807049-172807071 CACAGTGAAGGGGAGGCCTGAGG + Intergenic
1001734804 5:173989178-173989200 CACTGTGCAGGCGAGGGATGCGG - Exonic
1001934482 5:175694621-175694643 CCCTGTGGAGGAGAGGGAAGAGG + Intergenic
1001999893 5:176191696-176191718 CACGGTGGAGGAGTGGGAGGGGG + Intergenic
1003816856 6:9851295-9851317 CCCAGAGGAGGAGAGGTATGCGG + Intronic
1004075504 6:12340705-12340727 CAACGTGGAGTAGGGGCAGGAGG - Intergenic
1005893346 6:30157982-30158004 CACACTGGAGGAGAGGTATTGGG - Intronic
1006839639 6:37020459-37020481 CACTGTGGAGGGGAGGGAGGTGG - Intronic
1008918331 6:56814956-56814978 CACAGTGTAGGTGAGACATGAGG + Intronic
1012945830 6:105464501-105464523 CATGGTGGAGGAGTGGCAAGTGG + Intergenic
1016530972 6:145057830-145057852 GAACTGGGAGGAGAGGCATGTGG + Intergenic
1017545825 6:155450094-155450116 CGCCATGGAGGAGTGGGATGAGG + Intronic
1018871518 6:167787424-167787446 CACAGAGGAGGAGATTCATGGGG - Exonic
1018919506 6:168161519-168161541 CACTGGGGAGGAGCAGCATGGGG - Intergenic
1019632953 7:2059335-2059357 CAGAGGAGAGGAGAGGCATGGGG + Intronic
1023038668 7:36153864-36153886 AGGCCTGGAGGAGAGGCATGAGG + Intronic
1023162458 7:37310332-37310354 CACAGTAGAGGAAAGCCATGAGG - Intronic
1023838770 7:44083878-44083900 CAGTGATGAGGAGAGGCATGTGG - Intergenic
1024219584 7:47277421-47277443 CACCATGGTGGGGTGGCATGGGG + Exonic
1024238640 7:47416679-47416701 TACCCTGCAGGAGAGGCGTGTGG - Intronic
1026383168 7:69819584-69819606 CACAGTGGATCAGAGGCATATGG + Intronic
1027312488 7:76963328-76963350 CAGGGTGGAGCAGAGTCATGGGG + Intergenic
1028328749 7:89561497-89561519 CACCTTGGAGCAGAGGACTGAGG - Intergenic
1029109185 7:98203598-98203620 CCCTGTGGAGGAGAGGCGTGCGG + Exonic
1029115156 7:98232956-98232978 TACCGAGGAGGACAGGCCTGTGG + Exonic
1030121879 7:106118117-106118139 CACCGTGGGTGATTGGCATGAGG + Intergenic
1031026630 7:116686403-116686425 CTGCCTGGAGGAGAGGTATGGGG - Intronic
1031496178 7:122451019-122451041 CACTGTGGAGGTGAGACTTGAGG + Intronic
1031945864 7:127839885-127839907 AACCGTGGAGGATAGGGAGGAGG - Intronic
1033220663 7:139524554-139524576 CCCCGTGGTGGTGGGGCATGTGG + Intronic
1034456859 7:151175370-151175392 CACCCGGAAGGAGGGGCATGTGG - Intergenic
1034853188 7:154515374-154515396 CACCGTGCATGAGAGGCCAGAGG + Intronic
1034978448 7:155461123-155461145 CACTGAGGAGAAGAGGAATGTGG - Intronic
1035254523 7:157617770-157617792 CAGCAAGGAGGAGAGTCATGTGG - Exonic
1035553579 8:546490-546512 CACCGGGGGAGGGAGGCATGTGG - Intergenic
1039119277 8:34127903-34127925 AACAGAGAAGGAGAGGCATGAGG + Intergenic
1040060286 8:43097826-43097848 AACCCTGGAGGAGGGGCCTGTGG + Intronic
1043176455 8:77028215-77028237 AGACCTGGAGGAGAGGCATGTGG + Intergenic
1044294375 8:90510587-90510609 CACTTTGGGGGTGAGGCATGGGG + Intergenic
1044639011 8:94359010-94359032 CATGGTGGAGCATAGGCATGAGG + Intergenic
1047254599 8:123206224-123206246 CACCCTCAAGGAGAGGCCTGGGG - Intronic
1047852834 8:128877556-128877578 GAAGGTGGAGGAGAGGCAGGAGG + Intergenic
1048857311 8:138695880-138695902 CACTGTGCAGGAGAGGAGTGGGG + Intronic
1049012754 8:139898238-139898260 TACCGTGGAAGTGAGGCACGGGG - Intronic
1049150485 8:141032153-141032175 CACCGCGGTGGAGGGCCATGAGG + Intergenic
1049307176 8:141910282-141910304 CACGGGGGAGGAGAGGGAAGAGG + Intergenic
1049364141 8:142228496-142228518 GACCGGAGAGGAGAGGAATGAGG - Intronic
1049677741 8:143900009-143900031 AACCGTGGCGGGGAGTCATGAGG - Intergenic
1050565553 9:6878466-6878488 TACCTAGGAGGAGAGGAATGAGG + Intronic
1050627998 9:7526367-7526389 CAATGTGGAGGAGAGGCCTTTGG - Intergenic
1051493657 9:17695346-17695368 CACAGTGGAGTAGATGCCTGAGG + Intronic
1055360396 9:75483569-75483591 TACAGTGGAGGAGAGGAAGGGGG - Intergenic
1055509129 9:76977625-76977647 CTCAGTGGGGGAGAAGCATGTGG + Intergenic
1056173620 9:84012793-84012815 GACTGGGGAGCAGAGGCATGGGG + Intergenic
1057311703 9:93947356-93947378 CACAGGGGAGGAGAAGCTTGGGG - Intergenic
1059354401 9:113687815-113687837 CACCGTGGAGGGAAGGAAGGGGG - Intergenic
1059413759 9:114150555-114150577 CATCATGGAGGAGAGGGAGGAGG + Intergenic
1061034065 9:128103722-128103744 CACAGTGGAGGAGAGGCAGACGG + Exonic
1061921236 9:133783637-133783659 GACCTTGGCAGAGAGGCATGAGG - Intronic
1061994527 9:134176977-134176999 CATGGGGGAGGAGAGACATGGGG - Intergenic
1061994542 9:134177023-134177045 CATGGGGGAGGAGAGACATGGGG - Intergenic
1062185540 9:135216296-135216318 CACATTGTAGGAGAGGCCTGAGG - Intergenic
1062249277 9:135586200-135586222 CACCGTGGAGGTTGGCCATGGGG + Intergenic
1062466774 9:136685099-136685121 CAGTCTGGAGGAGAGGCCTGGGG - Intronic
1185996220 X:4952890-4952912 TACTCTGGAGGAGAGGCAAGAGG + Intergenic
1186487815 X:9946948-9946970 CCCGGTGGAGGAGGGGCACGGGG + Exonic
1189974730 X:46449300-46449322 CACAGTGGAGGAGAGGTGTGGGG - Intronic
1190916667 X:54816305-54816327 CACTTTGAAGGAGAGGCTTGAGG + Intergenic
1195822820 X:108965564-108965586 TAACGTGGAGAAGAGGGATGAGG - Intergenic
1196442120 X:115727582-115727604 CCCACTGGAGGAGAGGCACGGGG + Intergenic
1196442780 X:115730536-115730558 CCCACTGGAGGAGAGGCACGGGG + Intergenic
1196443442 X:115733332-115733354 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196445766 X:115845252-115845274 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196446437 X:115848233-115848255 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196447777 X:115854197-115854219 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196449116 X:115860167-115860189 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196449787 X:115863158-115863180 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196450456 X:115866141-115866163 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196451126 X:115869126-115869148 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196451797 X:115872105-115872127 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196452468 X:115875092-115875114 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196453138 X:115878061-115878083 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196453808 X:115881054-115881076 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196454888 X:115886165-115886187 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1196455552 X:115889125-115889147 CCCACTGGAGGAGAGGCACGGGG - Intergenic
1198435822 X:136615899-136615921 CACCGTTCAGGAGATCCATGTGG + Intergenic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic
1200247101 X:154532101-154532123 ACGGGTGGAGGAGAGGCATGAGG + Intronic