ID: 1094190655

View in Genome Browser
Species Human (GRCh38)
Location 12:27694985-27695007
Sequence TACAGTTACCACATAATGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094190655_1094190656 -4 Left 1094190655 12:27694985-27695007 CCATTCATTATGTGGTAACTGTA 0: 1
1: 0
2: 0
3: 26
4: 166
Right 1094190656 12:27695004-27695026 TGTATTGAACTTACTTTATTTGG 0: 1
1: 0
2: 1
3: 15
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094190655 Original CRISPR TACAGTTACCACATAATGAA TGG (reversed) Exonic
902300798 1:15501312-15501334 TGCTGTTACCTCCTAATGAATGG + Intronic
907825860 1:58016259-58016281 TACAGACATTACATAATGAATGG + Intronic
910050466 1:82967868-82967890 TATAATTAGCACATAATAAATGG - Intergenic
911733402 1:101312385-101312407 TAGAGTTACTACAAAGTGAAAGG - Intergenic
913492358 1:119392771-119392793 GACAGCTACCACATCAGGAAAGG - Intronic
918712895 1:187753526-187753548 TAAAGTTATTACATCATGAATGG - Intergenic
920029088 1:203025993-203026015 CACTGTTACTACAAAATGAAGGG - Intergenic
1070397697 10:76025841-76025863 AGCAGTTACCAGATAATGCAGGG - Intronic
1070671762 10:78382343-78382365 TTCAGTTATCAGATACTGAATGG + Intergenic
1070672204 10:78385939-78385961 TTCAGTTATCAGATACTGAATGG + Intergenic
1073173432 10:101533402-101533424 TACAGTTACCACTACCTGAAAGG - Intronic
1073478367 10:103769296-103769318 TTTAGATCCCACATAATGAAGGG + Intronic
1074334634 10:112558847-112558869 TACAGTCACCACATCATCACAGG - Intronic
1076870941 10:133194514-133194536 TACAATTATCACAAAATAAAAGG + Intronic
1077909957 11:6564877-6564899 TACAGTGTCCTCATTATGAAGGG - Intronic
1079054354 11:17192824-17192846 CATAGTTACCACATAATAATTGG - Intronic
1079591844 11:22192302-22192324 TTCAGTTTCCACATATTTAAAGG - Intergenic
1085824056 11:79824340-79824362 TACAGTAAGCACAGAATAAATGG - Intergenic
1085975668 11:81650826-81650848 GACAGATACCAGATAATGGAGGG - Intergenic
1086169011 11:83814614-83814636 TTCAGTTTCCACATAATTAAGGG - Intronic
1087700039 11:101426177-101426199 TACAGTAACTACAAAATTAAAGG - Intergenic
1087844125 11:102952212-102952234 TCCAGTGACCAGGTAATGAAAGG + Intronic
1090119911 11:124015473-124015495 TGCAGTTTCCACATAGAGAATGG + Intergenic
1090752805 11:129762350-129762372 TGCAGTAACCACATGGTGAATGG - Intergenic
1093603082 12:21054304-21054326 TACAGTTGCTTAATAATGAAAGG - Intronic
1093675641 12:21936647-21936669 TGTTGTTACCACAAAATGAAAGG + Exonic
1094190655 12:27694985-27695007 TACAGTTACCACATAATGAATGG - Exonic
1095525046 12:43115949-43115971 TTCAGTTACCTCATACTTAATGG + Intergenic
1097241706 12:57580216-57580238 TACAGGTTCCACACAATGACTGG - Intronic
1099711844 12:86236718-86236740 TATAGTTACTAAATAATTAAAGG + Intronic
1099783399 12:87229524-87229546 AACAGTAAACACATTATGAAGGG + Intergenic
1100020687 12:90066054-90066076 TAGAGTTTCCACAAAATAAAGGG + Intergenic
1104687719 12:130799544-130799566 TCCACTTACCATATAATGAATGG + Intronic
1105032671 12:132895060-132895082 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032681 12:132895140-132895162 CGCAGTTACCTCATGATGAAAGG + Intronic
1105032689 12:132895221-132895243 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032700 12:132895302-132895324 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032711 12:132895383-132895405 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032721 12:132895464-132895486 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032731 12:132895544-132895566 CGCAGTTACCTCATGATGAAAGG + Intronic
1105032739 12:132895625-132895647 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032748 12:132895706-132895728 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032760 12:132895787-132895809 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032770 12:132895867-132895889 CGCAGTTACCTCATCATGAAAGG + Intronic
1105032786 12:132896029-132896051 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032795 12:132896110-132896132 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032807 12:132896191-132896213 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032817 12:132896271-132896293 CGCAGTTACCTCATCATGAAAGG + Intronic
1105032823 12:132896352-132896374 CGCAGTTACCTCATCATGAAAGG + Intronic
1105032830 12:132896433-132896455 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032837 12:132896513-132896535 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032848 12:132896594-132896616 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032857 12:132896675-132896697 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032867 12:132896756-132896778 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032876 12:132896836-132896858 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032885 12:132896916-132896938 TGCAGTTACCCCATCATGAAAGG + Intronic
1105661230 13:22497589-22497611 CACAGTTTCCACACATTGAAAGG + Intergenic
1106746312 13:32711813-32711835 TACAGTTTATACATAATGAGTGG - Intronic
1107691978 13:42962428-42962450 TACAGTTATCATATTAGGAAAGG + Intronic
1109647466 13:65276988-65277010 TAGAGCTTCCATATAATGAATGG - Intergenic
1112358570 13:98695771-98695793 TACTGATACCACATAGTCAAAGG + Intronic
1113053950 13:106246967-106246989 TCCAGTTACCAAGTAATGAACGG - Intergenic
1113059928 13:106311794-106311816 TAGATTTAGCACATAATAAAGGG + Intergenic
1113096757 13:106673592-106673614 TTCAGTTTCCTCATATTGAAAGG + Intergenic
1113129939 13:107024437-107024459 TTCAATTACTACATAATGACTGG + Intergenic
1113177295 13:107579446-107579468 TCCAGTGACCACATAAGGAGGGG - Intronic
1113717104 13:112518505-112518527 AACAGTTACCACATTATAAAAGG - Intronic
1113851400 13:113420773-113420795 TACACTTCCCACAAAACGAACGG + Intergenic
1114299125 14:21358634-21358656 TATAGTTACGAGAGAATGAAGGG - Intronic
1115871431 14:37808225-37808247 TAGAATTAACACATAATGCAAGG - Intronic
1118093070 14:62504219-62504241 TAAAGTTACTACATATTGCAAGG + Intergenic
1118116685 14:62785743-62785765 CAGAGTTACAACATAATTAAAGG + Intronic
1119524623 14:75312568-75312590 TACAGTTACAACACAATGCTGGG + Intergenic
1125123038 15:36186013-36186035 AACAGATAACACAAAATGAATGG + Intergenic
1125305988 15:38314869-38314891 TTCAGCTACCACAAAAGGAAGGG - Intronic
1130362124 15:83199210-83199232 TAGAGTTACCATATGTTGAATGG - Intronic
1130669880 15:85902209-85902231 TACAGTTACCACATTGTGTTTGG + Intergenic
1133814349 16:9184720-9184742 AACACTTACCTCATAGTGAAAGG - Intergenic
1137738815 16:50744722-50744744 TACAATTACCACATTCTGAAAGG - Intronic
1137846074 16:51689547-51689569 TGTAGTTAACACATAAGGAAGGG - Intergenic
1138011760 16:53387707-53387729 TAAAATTACTACAGAATGAATGG - Intergenic
1138683561 16:58705348-58705370 TGCAGACACCACATGATGAATGG + Intergenic
1138698370 16:58837117-58837139 AAAATTTACCACATAATAAAAGG - Intergenic
1141193147 16:81839667-81839689 TACAGTTAAGACATAACAAAGGG + Intronic
1141995075 16:87631580-87631602 CACAGATACCACACAATGAGGGG - Intronic
1146235830 17:31161540-31161562 TACAATTAACACACAATCAATGG - Intronic
1149044122 17:52224777-52224799 TACAAGCAGCACATAATGAAAGG - Intergenic
1149807761 17:59635495-59635517 TACAGACGCCACATAATTAAAGG - Intronic
1151333951 17:73429181-73429203 TATAGCTACTACACAATGAATGG + Intronic
1154079848 18:11245301-11245323 TATAATTATCACATAATGATGGG - Intergenic
1155564444 18:27118418-27118440 TAAACTTACTACATAATGTAGGG - Intronic
1155710901 18:28877994-28878016 TACAATTTACACATAAGGAAAGG + Intergenic
1159183645 18:64943330-64943352 TACATTTACCAAATAATCTAGGG + Intergenic
1159422111 18:68234743-68234765 TACAGCTACCACATAAGCCACGG + Intergenic
1159747994 18:72263473-72263495 AACAGCTAACACATATTGAATGG + Intergenic
1166093836 19:40527679-40527701 TACAGTTACCACAGAGTGAGGGG + Intronic
929637405 2:43538385-43538407 CACTGTAATCACATAATGAAAGG - Intronic
930877445 2:56234857-56234879 AATAATTACCACATTATGAAAGG + Intronic
932145890 2:69316503-69316525 TTAAGATACAACATAATGAATGG - Intergenic
933788717 2:85866232-85866254 TTCAGATACCAAAGAATGAAAGG - Intronic
933867007 2:86529177-86529199 TACAGTCACCTCATAATGCCGGG - Intronic
935208117 2:100914214-100914236 GAGAGTCACCACATAATGCAAGG - Intronic
935505677 2:103899359-103899381 TACAGTTACATCATATTAAAAGG - Intergenic
938783293 2:134604295-134604317 TTCTGTTACCACATAGAGAATGG + Intronic
940527162 2:154831198-154831220 AACAGTTACCCCTTACTGAATGG + Intronic
941038688 2:160596541-160596563 TACATTTAAACCATAATGAATGG - Intergenic
945121298 2:206460128-206460150 TTCAGTGACCACATTATGATTGG - Intronic
1169307656 20:4506706-4506728 TACACCTACTACAAAATGAATGG + Intergenic
1169433234 20:5558845-5558867 TACAGTTACCCCCCATTGAAAGG - Intronic
1169648134 20:7836770-7836792 CACATTTACCACATAAGGACAGG + Intergenic
1171145625 20:22779337-22779359 TACAGATTCCACATAATCAAAGG - Intergenic
1173761369 20:45563604-45563626 GCCAGTTAACAAATAATGAATGG + Intronic
1179208519 21:39305981-39306003 TGCAGTGACCCAATAATGAATGG - Intronic
1183877947 22:40800038-40800060 TACATTCACCACAAATTGAAAGG + Intronic
955914032 3:63888340-63888362 TATAGTTAAGACATAATAAATGG - Intronic
955949941 3:64232982-64233004 CATAGATAGCACATAATGAATGG - Intronic
956696492 3:71923173-71923195 TACAAATACCTCATAATAAATGG + Intergenic
957821869 3:85386929-85386951 TAAAGATACAACATACTGAAGGG - Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960330851 3:116359071-116359093 TATAGTAACCACATATAGAAAGG - Intronic
962126625 3:132626177-132626199 TTCAGTTACCAAATAATTATTGG - Intronic
963386656 3:144604280-144604302 TACAGTTACCATGTTTTGAAAGG + Intergenic
966443754 3:179976913-179976935 TATAGATACCAGAGAATGAATGG + Intronic
968498925 4:935835-935857 TTCAGTTTCCAAATATTGAAAGG - Intronic
969093531 4:4715260-4715282 TACAATTATTACAAAATGAAGGG + Intergenic
970170518 4:13284653-13284675 AGCAGTTACCAAATAATGAAGGG + Intergenic
970509503 4:16767060-16767082 TACAGGGACCTCCTAATGAAAGG - Intronic
970638672 4:18038657-18038679 TACATATCCCACATAATGAATGG - Intergenic
970676653 4:18458041-18458063 TGCATTTACCAAATACTGAATGG - Intergenic
972129341 4:35810467-35810489 TGCAGTGACCACATGATGAAAGG + Intergenic
975409297 4:74030547-74030569 TACAGTTACAAGGAAATGAATGG + Intergenic
978660306 4:111118590-111118612 TACATTTACCAGATAATAACTGG + Intergenic
979204250 4:118016736-118016758 TGCATTTAACAAATAATGAAAGG + Intergenic
979480561 4:121211802-121211824 TAGAGTTACCACACACAGAAAGG + Intronic
983584954 4:169344528-169344550 AACAGTTACCTCAAAATAAAAGG - Intergenic
985157542 4:187006172-187006194 TACAGTCACCATATGATGATAGG - Intergenic
987732259 5:21789589-21789611 TGGAGTTTCCACTTAATGAATGG - Intronic
987811929 5:22848125-22848147 GAGAGTTAGTACATAATGAAGGG - Intronic
987874571 5:23664149-23664171 CACAGTTAACCCATAATAAATGG + Intergenic
988906936 5:35799824-35799846 TAAAGCTAACATATAATGAATGG - Intronic
992357212 5:75998423-75998445 TTCAGGGAGCACATAATGAAAGG - Intergenic
993358462 5:86943497-86943519 CACAGCTAGCTCATAATGAAGGG - Intergenic
993479099 5:88400800-88400822 TACAGTCACCAAAAATTGAAAGG + Intergenic
993687472 5:90957317-90957339 AATAGTTACCATTTAATGAATGG - Intronic
994116794 5:96070415-96070437 TATAGTACCCACATATTGAAGGG + Intergenic
994791756 5:104236124-104236146 AATAATTACCAGATAATGAAGGG - Intergenic
994967424 5:106692649-106692671 TATAATTACCAAAAAATGAAAGG - Intergenic
996688314 5:126309700-126309722 TACAGTCATCACTTAATAAATGG - Intergenic
996803282 5:127427284-127427306 GACAGAAACCACATAATCAATGG + Intronic
1000123118 5:158216976-158216998 TACAGTTAGGACTTAATAAATGG - Intergenic
1000855195 5:166389405-166389427 TTGAGGTACCATATAATGAAGGG + Intergenic
1003525970 6:6897711-6897733 GACAGTCACCACATAATGGAAGG + Intergenic
1008765034 6:54902032-54902054 TTCATTTAACTCATAATGAAGGG + Intronic
1012211513 6:96523603-96523625 CACAATTACCACCTAATAAAAGG - Intronic
1014980790 6:127943934-127943956 TCCAGATATTACATAATGAAGGG + Intergenic
1017337026 6:153272899-153272921 TACTGTTTCCACAGACTGAAAGG - Intergenic
1018537882 6:164841777-164841799 GACAGTTAACACAGAATAAAGGG - Intergenic
1023987228 7:45103852-45103874 TACAGCTACCCCAAAATGGATGG + Intronic
1027900164 7:84102933-84102955 CAGAGTTACCACATATTGTATGG + Intronic
1028288182 7:89030769-89030791 TTCACTTAGCACATAATAAAGGG + Intronic
1029298659 7:99561105-99561127 TGCAGTTACAACAGAATGGATGG - Intronic
1030553200 7:110990646-110990668 CCCAGCTACCAGATAATGAAGGG - Intronic
1030827727 7:114181453-114181475 TTCATTTACCATATAAGGAAGGG - Intronic
1030993376 7:116328661-116328683 TACAGGTAACACAAAAGGAAAGG - Intronic
1031754831 7:125625526-125625548 AACAATTACAAAATAATGAAGGG + Intergenic
1034064882 7:148126727-148126749 AACAGTGACCACAATATGAACGG + Intronic
1034295748 7:149970881-149970903 TACAGTGAGCACATAATGGATGG + Intergenic
1034810305 7:154126024-154126046 TACAGTGAGCACGTAATGAATGG - Intronic
1036279248 8:7385572-7385594 TCCAGTGACCACATAATTAGGGG + Intergenic
1036342266 8:7926301-7926323 TCCAGTGACCACATAATTAGGGG - Intergenic
1036542805 8:9735237-9735259 TACTGTTATCACATAATGGAGGG - Intronic
1036966508 8:13304133-13304155 TATATTTACCATATATTGAATGG - Intronic
1039475211 8:37835927-37835949 TAGAGATACCCCATAAAGAAAGG + Intronic
1043108381 8:76145912-76145934 TACAAATACCACCTTATGAAGGG - Intergenic
1043186456 8:77157790-77157812 TATAGTGACCACATAGTGAAAGG - Intergenic
1045666337 8:104490606-104490628 TAAAGTTACAAAATAATAAATGG + Exonic
1046460353 8:114525946-114525968 TACAGTTAAAAAATAAGGAAGGG - Intergenic
1047566004 8:126044997-126045019 TAAAGCAACCACACAATGAAAGG - Intergenic
1050698748 9:8311860-8311882 TACCATTACCAAATAATAAAAGG - Intergenic
1050891753 9:10833261-10833283 TACACTGAGCACATAATAAATGG + Intergenic
1050978621 9:11977368-11977390 GACAGTTACTGTATAATGAAGGG + Intergenic
1051072689 9:13191642-13191664 CACAGTTACCACTTAGTGAATGG - Intronic
1052894364 9:33733609-33733631 TGCAGTAACCACATGGTGAATGG - Intergenic
1055963070 9:81839076-81839098 TACACATACCACATAATTACAGG - Intergenic
1056127833 9:83554485-83554507 TGCAGTCAGCACAAAATGAACGG + Intergenic
1056308256 9:85312857-85312879 ATCAGTAACCACAAAATGAACGG + Intergenic
1056650510 9:88456475-88456497 TACAGTTACCAAATATTAAAAGG + Intronic
1059713790 9:116894375-116894397 GACAGTTATCACATAAAGATAGG + Intronic
1188404351 X:29788520-29788542 TACAATTATCACAAAATGAAAGG - Intronic
1191150355 X:57214841-57214863 TTCAGGTACCAAATAATGAAGGG - Intergenic
1195399029 X:104442101-104442123 TACCGTTACCAGCTAATGCAGGG - Intergenic
1197187971 X:123609409-123609431 TATAGTCAACACATGATGAATGG - Intronic
1200531245 Y:4342151-4342173 TACAGATACCAGTTAATCAAAGG - Intergenic