ID: 1094199187

View in Genome Browser
Species Human (GRCh38)
Location 12:27779986-27780008
Sequence GCGGAAGTGAGAAGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094199168_1094199187 21 Left 1094199168 12:27779942-27779964 CCGGATCCAGCCGGCAGGTCAGG 0: 1
1: 0
2: 2
3: 12
4: 151
Right 1094199187 12:27779986-27780008 GCGGAAGTGAGAAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1094199171_1094199187 15 Left 1094199171 12:27779948-27779970 CCAGCCGGCAGGTCAGGCCGGCG 0: 1
1: 0
2: 0
3: 5
4: 121
Right 1094199187 12:27779986-27780008 GCGGAAGTGAGAAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1094199165_1094199187 29 Left 1094199165 12:27779934-27779956 CCCGAGAGCCGGATCCAGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1094199187 12:27779986-27780008 GCGGAAGTGAGAAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1094199173_1094199187 11 Left 1094199173 12:27779952-27779974 CCGGCAGGTCAGGCCGGCGGCTG 0: 1
1: 0
2: 2
3: 21
4: 503
Right 1094199187 12:27779986-27780008 GCGGAAGTGAGAAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1094199166_1094199187 28 Left 1094199166 12:27779935-27779957 CCGAGAGCCGGATCCAGCCGGCA 0: 1
1: 0
2: 2
3: 4
4: 73
Right 1094199187 12:27779986-27780008 GCGGAAGTGAGAAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1094199179_1094199187 -2 Left 1094199179 12:27779965-27779987 CCGGCGGCTGGGGTCCCGCGGGC 0: 1
1: 0
2: 2
3: 15
4: 202
Right 1094199187 12:27779986-27780008 GCGGAAGTGAGAAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 26
4: 194
1094199163_1094199187 30 Left 1094199163 12:27779933-27779955 CCCCGAGAGCCGGATCCAGCCGG 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1094199187 12:27779986-27780008 GCGGAAGTGAGAAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 26
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094199187 Original CRISPR GCGGAAGTGAGAAGGGCGGC GGG Intergenic