ID: 1094199229

View in Genome Browser
Species Human (GRCh38)
Location 12:27780135-27780157
Sequence GGCCGCCGCCTCGCGGGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 200}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094199216_1094199229 16 Left 1094199216 12:27780096-27780118 CCGGCCCTTTTTTGGCGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1094199212_1094199229 29 Left 1094199212 12:27780083-27780105 CCGCCGCGCTCCGCCGGCCCTTT 0: 1
1: 0
2: 2
3: 31
4: 476
Right 1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1094199219_1094199229 12 Left 1094199219 12:27780100-27780122 CCCTTTTTTGGCGCTGAGGGAAA 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1094199220_1094199229 11 Left 1094199220 12:27780101-27780123 CCTTTTTTGGCGCTGAGGGAAAG 0: 1
1: 0
2: 0
3: 6
4: 129
Right 1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1094199211_1094199229 30 Left 1094199211 12:27780082-27780104 CCCGCCGCGCTCCGCCGGCCCTT 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1094199213_1094199229 26 Left 1094199213 12:27780086-27780108 CCGCGCTCCGCCGGCCCTTTTTT 0: 1
1: 0
2: 0
3: 13
4: 203
Right 1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG 0: 1
1: 0
2: 1
3: 17
4: 200
1094199215_1094199229 19 Left 1094199215 12:27780093-27780115 CCGCCGGCCCTTTTTTGGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG 0: 1
1: 0
2: 1
3: 17
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094199229 Original CRISPR GGCCGCCGCCTCGCGGGAGC GGG Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
901934555 1:12618531-12618553 GGCAGCCGGCTCGCCGGAGTCGG - Intergenic
902240868 1:15088525-15088547 GGCTGCCGAGTCGCGGGTGCTGG - Intronic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
903750175 1:25616684-25616706 CGCCGCCGCCGCGCCGCAGCCGG - Intergenic
903788145 1:25875051-25875073 GGCCGCTGCCTTCCTGGAGCAGG - Intergenic
903875863 1:26472677-26472699 CGCCGCCGCCTCCCTGGTGCAGG + Intronic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
904215400 1:28914781-28914803 GGCGGCGGCGGCGCGGGAGCCGG + Intronic
905505519 1:38476305-38476327 AGCCCCAGCCTCCCGGGAGCAGG - Intergenic
905580781 1:39081647-39081669 GGCCGCCGGCTGCCGGGAGCTGG - Intronic
906508026 1:46394404-46394426 GGCCGCCGCCACGAAGCAGCAGG - Exonic
906615821 1:47232207-47232229 GGCCGCCGCCGCTCAGGACCGGG - Intronic
910788015 1:91021720-91021742 GGCCGCCGCCTCCCCGAACCCGG + Intronic
912576365 1:110675326-110675348 CGCCGCGGCCCCGCGGGCGCCGG + Intergenic
915213328 1:154325565-154325587 GGCCGAGGCCCCGGGGGAGCGGG + Intronic
917359583 1:174160402-174160424 GGCCACCGGCTAGCGGGAGGTGG + Intronic
917903991 1:179571784-179571806 GGCCGCAGCCTCGCTGGGGGTGG - Intronic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
919759701 1:201089793-201089815 GGCAGCTGCCTGGCTGGAGCAGG + Intronic
920333307 1:205227909-205227931 GGCTGCCTCCGCCCGGGAGCGGG - Intergenic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1071545019 10:86522173-86522195 GGAGGCCGCCGCCCGGGAGCTGG + Intergenic
1071794673 10:88991363-88991385 GCGCGCCGCCCCGCGGGGGCGGG + Exonic
1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG + Intronic
1072937981 10:99731922-99731944 GGACTCCGAGTCGCGGGAGCGGG - Intronic
1073330733 10:102668533-102668555 CGCCGCCTCCTCCCTGGAGCCGG - Intergenic
1076898881 10:133327313-133327335 GGCCGCAGCCTCAGGGGAGTCGG + Intronic
1077253753 11:1571806-1571828 GGGCGCCGCGTCGGGGGCGCTGG - Intronic
1077514241 11:2992150-2992172 GGCCGCCGCCGCGCCCGCGCCGG + Intronic
1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG + Intergenic
1078771741 11:14358547-14358569 GGGCGCGGCGTCGCGGGAGTAGG - Intronic
1081720504 11:45285480-45285502 GGCCGCGGTCCCGCAGGAGCTGG - Intronic
1083658316 11:64240957-64240979 GGCAGCGGCGTCGCGGGGGCGGG + Intergenic
1084515758 11:69637323-69637345 CGGCGGCGGCTCGCGGGAGCCGG - Intergenic
1088579184 11:111299529-111299551 GCCCGCCACCTCCCGCGAGCCGG + Exonic
1089458973 11:118641694-118641716 GGCCTCCGCCTCCCGGGACCTGG + Intronic
1090344995 11:126062654-126062676 AGCCGCCGCCGCGCGCGCGCGGG - Intronic
1091444562 12:536120-536142 AGCCGACGCCTCCTGGGAGCAGG + Intronic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1098426086 12:70366615-70366637 CGCCGCCGCCGCGCGACAGCAGG - Exonic
1099410089 12:82314578-82314600 GGCTGCAGCCTGGCGGGAGGAGG - Intronic
1102035697 12:109769422-109769444 GGCTGCCGCCTCGCTGTGGCCGG + Exonic
1103509948 12:121467329-121467351 GGCTCCCTCCTCGCGGCAGCGGG - Intronic
1103527534 12:121578421-121578443 TGCCGCCGCCTGGCTGGAACTGG - Intronic
1103595385 12:122022025-122022047 GGCCGCCGCGGAGCGCGAGCAGG + Exonic
1103700065 12:122844633-122844655 GGCCCCTGCCTCTTGGGAGCTGG + Intronic
1104921476 12:132292870-132292892 GGACGCCGCCTCGCATGTGCAGG + Intronic
1108688979 13:52846010-52846032 GGCGGCCTCCTCCGGGGAGCCGG + Exonic
1113327981 13:109301430-109301452 GCCCCCCGCCTCTGGGGAGCTGG + Intergenic
1115028333 14:28767235-28767257 GGCGGCGGCGGCGCGGGAGCGGG - Exonic
1115851299 14:37592317-37592339 GGCCGCAGCCGCGCGGGCGGCGG - Exonic
1117545901 14:56794723-56794745 GGCCGCCGCCCCCCGGAAGCGGG - Intergenic
1118220885 14:63853507-63853529 GGCCGCCCCCTCCCGGGCCCAGG + Intronic
1119219371 14:72893602-72893624 GGCCGCGGGCTCGGGGGCGCGGG + Intronic
1121453962 14:94026811-94026833 GGGCGCCGCCTCGACGGCGCTGG + Intronic
1122183528 14:99972067-99972089 GGCCGGCGCCTCGTGGGAGGTGG + Intronic
1122282730 14:100633609-100633631 GGCTGCCTCCTCCTGGGAGCAGG - Intergenic
1122908656 14:104815698-104815720 GGCCGGGGCTGCGCGGGAGCAGG - Intergenic
1123676449 15:22714651-22714673 GGGAGGCGCCTCGAGGGAGCCGG + Intergenic
1124038949 15:26082551-26082573 GCCCCCCGGCTCGCGGGAGGCGG + Intergenic
1124328663 15:28788911-28788933 GGGAGGCGCCTCGAGGGAGCCGG + Intergenic
1125999255 15:44194571-44194593 GGCCGCCCCGTCGGGGGCGCAGG - Intronic
1126827744 15:52568769-52568791 GCCCTCCGCCTGGCGGGAGCAGG + Intronic
1127084085 15:55408451-55408473 GGCCGCCGCCGGGCGGCTGCGGG + Intronic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1129814643 15:78540752-78540774 GCCCGCCCCCTCGCGGGCCCCGG - Intronic
1130531234 15:84748830-84748852 GACCGCCGCCTGGCGGGCCCGGG + Intronic
1130952744 15:88605290-88605312 CCCCACAGCCTCGCGGGAGCCGG + Intergenic
1131055344 15:89371543-89371565 GCCCGCAGCCTCGAGGGCGCGGG - Intergenic
1131272666 15:90956691-90956713 GGCCGCCGCCTGGCTGCGGCGGG - Exonic
1132537532 16:490216-490238 GGCAGCCTCATCGCGGGCGCTGG - Intronic
1132947125 16:2537941-2537963 GCCCGGCGCCGCGCGGGGGCGGG + Intergenic
1133013001 16:2925261-2925283 GGCGGGGGCCTCGCGGGACCTGG + Intronic
1133040924 16:3059396-3059418 GACCGCCCCCTGGCGGCAGCCGG - Exonic
1135557949 16:23452905-23452927 GGACGCCGCCTCCTTGGAGCCGG + Exonic
1136372450 16:29844855-29844877 GGCCGCCGCTTCCTGGGAGTTGG - Exonic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139933863 16:70552990-70553012 GGCCTCCGCCTCCCGGGTTCAGG + Intronic
1141352592 16:83311957-83311979 TGCCGCAGCCTCCCGAGAGCTGG - Intronic
1141591630 16:85073166-85073188 GACCTCCATCTCGCGGGAGCAGG + Intronic
1141633901 16:85303717-85303739 GGCCGCCGCCTCCCGAGTTCTGG + Intergenic
1141649540 16:85385700-85385722 GCCGGCTGCCTCGCGAGAGCGGG - Intergenic
1141709163 16:85688048-85688070 GGCCTCCGCCTCCCGGGTTCAGG - Intronic
1143554426 17:7651671-7651693 GGGCGACGCCTCGGGGGCGCAGG + Intronic
1144829489 17:18123312-18123334 GGCTGCAGCGTTGCGGGAGCGGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146057640 17:29589266-29589288 GGCCGCCGCCGGGCGGGCGCCGG - Intronic
1146057711 17:29589470-29589492 CGCCGGGGCCTCGCCGGAGCCGG - Exonic
1147970962 17:44219052-44219074 GGCCGCAGGCTCGGGGGAGGAGG - Intronic
1151370790 17:73645049-73645071 GGGCGCCGCGTCCCCGGAGCCGG - Intergenic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1152111688 17:78360449-78360471 GGGCGCCGCTTCGGGAGAGCGGG + Intergenic
1152267544 17:79305080-79305102 GGCCGCCGCCTGGCCAGGGCAGG + Intronic
1152354030 17:79798079-79798101 GGCCGAAGCCTGGCGGGGGCGGG - Intronic
1152441281 17:80311721-80311743 GGCCCACGCCTCGAGGCAGCTGG - Intronic
1152751814 17:82065759-82065781 GGCCGCCGCCGGGCCGCAGCCGG + Intronic
1153872593 18:9334656-9334678 AGACGCCTCCTGGCGGGAGCTGG + Intergenic
1155152684 18:23135476-23135498 GGCCGCTGGCTCGCGGGCTCCGG - Intronic
1158236593 18:55322578-55322600 GGCCCCGGCCTCCCCGGAGCTGG + Intronic
1160242255 18:77132465-77132487 GACCGGAGCCCCGCGGGAGCCGG - Intronic
1160540134 18:79616802-79616824 GGGCATCGCCTCTCGGGAGCCGG + Intergenic
1160745414 19:709044-709066 GGACGCGGCCTGGCGGGGGCCGG - Intergenic
1160858935 19:1229506-1229528 GGCCGGGGCCGCGCGGGCGCCGG + Exonic
1160860885 19:1236859-1236881 GGCGGCGGCCTCGGGGGGGCGGG + Intronic
1160992354 19:1864866-1864888 CCCCGCCGCCCCGCCGGAGCTGG - Intergenic
1161169969 19:2807755-2807777 GGACGCGGCCTCGGGGGAGGTGG + Exonic
1161767518 19:6215704-6215726 GGCCTCAGCCTCACGGGAGGAGG + Intronic
1162312393 19:9914677-9914699 GCCCGCTCCCTCGGGGGAGCGGG + Intronic
1162869526 19:13575115-13575137 GCCGGCCGCCTCTCAGGAGCTGG + Intronic
1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG + Exonic
1163154555 19:15432712-15432734 GGCGGCCGCCCCGCGTGCGCCGG - Intronic
1163547411 19:17948328-17948350 GGCGGCGGCCTCGGGGAAGCCGG + Intergenic
1164602036 19:29568647-29568669 GGCCGCTGCCTGGAGGGCGCAGG - Intergenic
1165792618 19:38500969-38500991 GGCAGCCGCCTCGCTGGACACGG + Exonic
1167268190 19:48493642-48493664 GGTCGCGGCCTGGAGGGAGCAGG - Intronic
1167377419 19:49119447-49119469 GGCTGCGGCCTCGCGGGGGGAGG + Exonic
1167514912 19:49917641-49917663 TGCAGTCGCCTGGCGGGAGCTGG + Intronic
1167934783 19:52897261-52897283 GGACGCGGCCTCCCGGGAACCGG + Intronic
926190056 2:10721632-10721654 AGCCGCTGCCTCCCGGGAGCCGG + Exonic
927168583 2:20350324-20350346 GGCCGCCGCCTCGGGGGCGTGGG - Intronic
930046237 2:47175795-47175817 GGCGAGCGCCTCGCGGGACCCGG - Intronic
932823357 2:74920017-74920039 GGCGGCCGTCCCCCGGGAGCGGG + Intergenic
933750438 2:85599582-85599604 GGCCACCGCCCCGCTGGACCTGG - Exonic
935122871 2:100197756-100197778 GGCAGCAGCCTCCCAGGAGCAGG - Intergenic
935590942 2:104845008-104845030 GGCCGCGGCTGCGCGGGAGGAGG - Intergenic
938736675 2:134192001-134192023 GCCCTCCTCCTCGCGTGAGCGGG + Intronic
940293373 2:152098826-152098848 GGCCGCCGACTCCCGGGACTGGG + Intronic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
943669792 2:190648857-190648879 GGCCGCCGCCGGGCGGGGGCGGG - Intronic
948893139 2:240916565-240916587 GGCCGCGGCCCAGCTGGAGCCGG - Intergenic
948958608 2:241315150-241315172 GCCCGCCGCCCCGCGGGGGAGGG - Intronic
1168795870 20:609991-610013 GGCGGCCAACGCGCGGGAGCGGG - Exonic
1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG + Intergenic
1172245609 20:33443443-33443465 GCCCGGCGCTCCGCGGGAGCAGG - Exonic
1173704257 20:45098510-45098532 GGCCGCGGCGTCGGAGGAGCAGG - Exonic
1174045273 20:47728619-47728641 GGCCGCTGCTTCCAGGGAGCTGG + Intronic
1175925930 20:62471319-62471341 GGCTGCAGTCTCACGGGAGCTGG + Intronic
1176380629 21:6110802-6110824 GGGCGCCCCCTCCCGGGCGCTGG - Intergenic
1178922540 21:36747965-36747987 GGTCGCCGCCTCGGGGCCGCCGG - Exonic
1178992690 21:37367854-37367876 GGCCGCGGCCTCCCGGGAGCCGG + Intronic
1179054325 21:37916900-37916922 GGCAGCCCCGGCGCGGGAGCCGG + Intergenic
1179742843 21:43427438-43427460 GGGCGCCCCCTCCCGGGCGCTGG + Intergenic
1179794875 21:43776752-43776774 GGTCCCGGCCCCGCGGGAGCAGG + Intergenic
1180196083 21:46195107-46195129 GTCCACGGCCTCGCTGGAGCGGG - Intronic
1181478243 22:23181365-23181387 GGCAGCCGCGTCGGGGGAACGGG + Exonic
1181592563 22:23894321-23894343 AGCCGCAGCCTCGCGGGGGCGGG + Exonic
1182278710 22:29206080-29206102 CAGCGCCGCCTCCCGGGAGCAGG - Exonic
1184472258 22:44702543-44702565 GGCCGCCGCCGCGGACGAGCGGG + Exonic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
954141624 3:48609715-48609737 GGCCGCCTCCTGGCGGGAACCGG + Exonic
958785421 3:98592919-98592941 GGCCGGCCCCTGGCGGGAGTTGG - Intronic
961377212 3:126475259-126475281 GACCGCCGCCGTGCGTGAGCAGG + Exonic
961389209 3:126542440-126542462 AGCCGCCGCCTCCCGCGACCTGG + Exonic
968561265 4:1283996-1284018 GGCCTCCTCCTCCAGGGAGCCGG + Intergenic
968674636 4:1871097-1871119 CGCCGCCGAGTAGCGGGAGCAGG + Intergenic
971457810 4:26860798-26860820 GGCGGCGGCGGCGCGGGAGCTGG + Intronic
972793972 4:42398260-42398282 GGCCGACGCCAGGCTGGAGCAGG + Exonic
976226586 4:82799019-82799041 GGCCGCCTCCGCCCGGGGGCGGG + Intergenic
981615624 4:146640331-146640353 GGACGCCGACCCGCGGGACCTGG + Exonic
981782499 4:148444157-148444179 CGCCGCCGCCTCGCGTGCCCAGG - Intronic
993905740 5:93621299-93621321 CCCCGCCCCCTCGCGGGCGCGGG + Intronic
995106310 5:108381226-108381248 GGCCGCCGCCTGGGAGCAGCAGG - Exonic
996769733 5:127073504-127073526 GGCCGGCGCCTGGTGGGTGCGGG - Intergenic
999462612 5:151770643-151770665 GGCCTCGGCCTCTGGGGAGCCGG - Exonic
999858406 5:155619831-155619853 GGCAGCCGGCTCCAGGGAGCGGG - Intergenic
1002106322 5:176881024-176881046 CGCCGCAGCCTTGCTGGAGCCGG - Exonic
1002580881 5:180208963-180208985 GGGCGCGGGCTCGCGGGGGCTGG - Intronic
1006617917 6:35342474-35342496 GGCCGCCGCCGGGCGGAAGGGGG + Intergenic
1007327287 6:41072474-41072496 GGCCGCCCCCGCCCGGTAGCGGG + Exonic
1007451139 6:41941075-41941097 GGCCGCCCCCGCCCGGGAGCCGG - Intronic
1007581127 6:42960790-42960812 GGCCGCCACCCCCAGGGAGCGGG - Exonic
1007636393 6:43302339-43302361 GGACGCCGCCTCACGCAAGCCGG + Exonic
1011277096 6:85642482-85642504 GGTCGCCGCGGCGCGGGAGTGGG - Intronic
1013793619 6:113860201-113860223 GGGCGCGGCCTCCGGGGAGCAGG + Exonic
1015625872 6:135181001-135181023 CGCCGCCGCGACCCGGGAGCGGG + Intergenic
1019109995 6:169702130-169702152 GGCCGGAGCCTCGCCGGAGGCGG - Intergenic
1019261081 7:82361-82383 GGCCGCCTCCTCCCTGGCGCGGG + Intergenic
1021958774 7:25852511-25852533 CCCCGCCGCCTCGCCGGAGGCGG + Intergenic
1022230568 7:28409223-28409245 GGCCGGCGCGTCGAGGGGGCAGG - Intronic
1022936692 7:35185948-35185970 GGCCTCCCCCGCCCGGGAGCTGG - Intergenic
1025695682 7:63773139-63773161 GGCCGCCGACAGGCAGGAGCTGG - Intergenic
1025976758 7:66376642-66376664 GGCCGCCGGGAGGCGGGAGCTGG + Intronic
1025976876 7:66377093-66377115 GGCCCCCGGCAGGCGGGAGCCGG + Intronic
1027121801 7:75527593-75527615 CGCCCCGGCCTCTCGGGAGCCGG - Intergenic
1029366416 7:100119351-100119373 CCCCGCCCCCTCGTGGGAGCAGG + Intronic
1029440272 7:100583453-100583475 GGACTCCGCCTCGCGGGCCCTGG - Intronic
1029832927 7:103280059-103280081 GGCCTCCCCCGCCCGGGAGCGGG - Intergenic
1031629889 7:124033144-124033166 GGCCGCGGTCCCGCGGCAGCGGG + Intergenic
1032840649 7:135711012-135711034 AGCGGCCCCCTAGCGGGAGCAGG + Intronic
1035456112 7:159010033-159010055 TGCCCCCGCTTTGCGGGAGCGGG + Intergenic
1035754929 8:2023874-2023896 GGCCTCGGGCCCGCGGGAGCTGG + Intergenic
1037450836 8:19014172-19014194 GGGCGCCGTCTCGCCGGGGCTGG + Intronic
1038147698 8:24913680-24913702 GGCCGCCGCCTCCACGGGGCGGG + Exonic
1039996781 8:42541369-42541391 GGCCGGGGGCTCGCGGGAGGCGG + Intronic
1040504584 8:48035726-48035748 TGCCTCAGCCTCGCAGGAGCTGG + Intronic
1041201590 8:55455077-55455099 GGCCGCACCCGCGCGGGAGTGGG - Intronic
1042278359 8:67028652-67028674 GGCCGCCGCCTCACAGGGGAAGG - Intronic
1049204956 8:141359350-141359372 GGCCGCCGACTGGAGGGACCTGG - Intronic
1051418865 9:16870980-16871002 GTCCCCCGCCTCCCGCGAGCAGG - Intergenic
1053072931 9:35111614-35111636 GGCCGCCGCGGCGCGGGTGGTGG - Intronic
1054835550 9:69672169-69672191 GTCCGCGGGCCCGCGGGAGCAGG + Exonic
1055308205 9:74952245-74952267 CGCCACCGCCCCCCGGGAGCCGG + Exonic
1056386317 9:86099703-86099725 GGCCGCCCCTCGGCGGGAGCAGG + Intronic
1057921734 9:99104236-99104258 CCCCTCCGCCCCGCGGGAGCTGG + Intronic
1058053350 9:100427417-100427439 GGCCGCAGCCGGGCGGGGGCGGG + Intronic
1061000444 9:127899477-127899499 AGCAGGCGCCGCGCGGGAGCAGG - Intronic
1061365845 9:130172238-130172260 GGCCGCGGCCAGGCGGGTGCGGG + Intergenic
1062162503 9:135087927-135087949 GGCCGCCTGGGCGCGGGAGCCGG + Exonic
1062596276 9:137301321-137301343 GCCCGCCGCCTCGCGGGTGGGGG - Exonic
1062653531 9:137590429-137590451 CGCCGCCGCCTCGCGCCCGCCGG + Exonic
1062716456 9:138012827-138012849 GGCCGTCGCCTCCAGGGAGACGG + Intronic
1186463358 X:9765645-9765667 GGCCGCCGGCCCGCGGGCCCCGG - Exonic
1195259074 X:103115321-103115343 GGGCGCCGCCTCGCTGGATCAGG + Intergenic
1200292610 X:154886818-154886840 GGCCGCCGCCCTGCGCGACCTGG + Exonic
1200339454 X:155382558-155382580 GGCCGCCGCCCTGCGCGACCTGG + Exonic
1200347016 X:155458135-155458157 GGCCGCCGCCCTGCGCGACCTGG - Exonic