ID: 1094199303

View in Genome Browser
Species Human (GRCh38)
Location 12:27780360-27780382
Sequence CCGGGTAGCAGCGGTCCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094199303 Original CRISPR CCGGGTAGCAGCGGTCCTCC AGG (reversed) Exonic
900159978 1:1218886-1218908 CCTGGTACCAGCGGTCCTTCAGG + Exonic
900242602 1:1624185-1624207 CCGGGTATGGGCTGTCCTCCTGG - Intronic
900868894 1:5287925-5287947 CTGGGCAGCAGCGATCCTCCTGG - Intergenic
907403678 1:54240931-54240953 CCTGGTGGTGGCGGTCCTCCAGG - Exonic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
915517259 1:156420806-156420828 CTGGGTCGCTGCGGTCTTCCCGG - Intronic
915598439 1:156908191-156908213 CCGGGAAGCAACGGGCGTCCGGG - Exonic
920171770 1:204076372-204076394 CCAGGGAGCAGGGCTCCTCCTGG - Intronic
923617798 1:235552210-235552232 CCAGGCAGCTGCGGACCTCCTGG - Exonic
1064928649 10:20598722-20598744 CCTGGTAGCAGCTGTCGTCTGGG + Intergenic
1067095161 10:43294987-43295009 CAGGGTTGCTGCAGTCCTCCGGG - Intergenic
1070954415 10:80454731-80454753 CCGAGCAGCAGCGGCCGTCCAGG - Intronic
1073185663 10:101613795-101613817 CCTGGCAGCAGCAGTGCTCCTGG - Intronic
1076723829 10:132404366-132404388 CAGGGAAGCAGCTGACCTCCCGG + Intronic
1077065604 11:639807-639829 CCACGTAGTCGCGGTCCTCCAGG - Exonic
1082811610 11:57482288-57482310 CCGGGCACCAGCGGCCTTCCCGG + Intergenic
1084311714 11:68320553-68320575 CCGGGTTCCAGCTGTTCTCCTGG + Intronic
1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG + Intronic
1089858301 11:121566688-121566710 CCAGGCAGCAGGGTTCCTCCTGG - Intronic
1090898569 11:131004259-131004281 CCTGGGAGCAGCGGCCCACCAGG - Intergenic
1094199303 12:27780360-27780382 CCGGGTAGCAGCGGTCCTCCAGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096499081 12:52054646-52054668 CGGGGTAGCAGCCGTACACCTGG - Exonic
1112477973 13:99749430-99749452 CCGGGAAGGAACGGCCCTCCTGG - Intronic
1119263904 14:73253284-73253306 CTTGGTGGCAGCGGGCCTCCTGG + Intronic
1129728634 15:77916839-77916861 CCTGGGAGCAGGGGTCCACCAGG - Intergenic
1132566818 16:627349-627371 CCCGGCAGCAGAGGTCCTGCAGG - Exonic
1132632537 16:926802-926824 CCGGGGAGCAGCTGACATCCTGG - Intronic
1132691885 16:1185415-1185437 CCGGGTGGCAGCTGGACTCCTGG + Intronic
1134761641 16:16719809-16719831 CCGGGTTCCAGCGATTCTCCTGG - Intergenic
1134984416 16:18639361-18639383 CCGGGTTCCAGCGATTCTCCTGG + Intergenic
1140462375 16:75149893-75149915 CCGGGTTCAAGCAGTCCTCCTGG + Intronic
1141560049 16:84862027-84862049 CTGGGTAGGATCAGTCCTCCCGG + Intronic
1141878822 16:86844781-86844803 CCGGGTGGCAGGCGCCCTCCAGG + Intergenic
1144548062 17:16215709-16215731 CCTGGCAGCGGCGGTCCTCTCGG + Intronic
1144708307 17:17384392-17384414 CCGGGTTCCAGCACTCCTCCTGG + Intergenic
1145273192 17:21415338-21415360 CCGGCTGGCCGCGGTCATCCCGG - Exonic
1145311385 17:21702782-21702804 CCGGCTGGCCGCGGTCATCCCGG - Exonic
1146052706 17:29566402-29566424 CCGGGTAGTAGCCGCGCTCCAGG + Exonic
1148549760 17:48543466-48543488 CAGGGTCGCAGATGTCCTCCAGG + Exonic
1152570735 17:81120182-81120204 CCGGGTGGCGGCGGCCCACCTGG + Exonic
1152644778 17:81463730-81463752 CCAGGTAGTAGAGGTCCTGCCGG - Exonic
1160769089 19:822246-822268 CCGGGTGGCTGCGGTCGGCCCGG + Intergenic
1164047601 19:21555846-21555868 CCGGGTAGCACAGTTCCTCACGG + Intronic
1165814368 19:38632557-38632579 CCGGTGAGCAGCTGTCCCCCCGG - Intronic
937088235 2:119186225-119186247 CTGGGTAGGAGAGGTCCCCCAGG - Intergenic
942107285 2:172645362-172645384 CCGGGTTCAAGCGGTTCTCCTGG + Intergenic
943524864 2:189003997-189004019 CCAGGTCCCAGCGGTTCTCCAGG + Exonic
943530016 2:189068031-189068053 CAGGGTAGCACTGGTCCTCAGGG - Exonic
1174658670 20:52192077-52192099 CCGTGCAGCAGCGCTGCTCCCGG + Intronic
1175103486 20:56596844-56596866 CCGGGTACAAGCGATTCTCCTGG - Intergenic
1175888900 20:62307412-62307434 CTGGGGAGCAGTGGGCCTCCAGG + Exonic
1182261200 22:29073676-29073698 CCGGGGAGCAGAGGACGTCCCGG - Intronic
1182261223 22:29073745-29073767 CCGGGGAGCAGGGGGCCTCCTGG - Intronic
1182261253 22:29073814-29073836 CTGGGGAGCAGGGGTCGTCCCGG - Intronic
1184519628 22:44985502-44985524 CTGGGTTCCAGCGATCCTCCTGG - Intronic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
950644815 3:14370884-14370906 GCAGGTAGCAGCAGGCCTCCTGG - Intergenic
954064479 3:48094935-48094957 CCTGGGAGCAGGGGTCCACCAGG - Intergenic
954228691 3:49199661-49199683 CAGGATACCAGCGGTCCTCCCGG + Intronic
958837566 3:99163346-99163368 CAGGGTAGCAGGTTTCCTCCTGG - Intergenic
966201413 3:177362228-177362250 TGGGCTAGGAGCGGTCCTCCGGG + Intergenic
966236175 3:177704246-177704268 CCAGGCAGCAGCAGTCATCCTGG - Intergenic
985972320 5:3388244-3388266 CCCGGGAGCAGGGGTCCTGCAGG - Intergenic
994043727 5:95285106-95285128 CCGGGGACCAGCAGTCCCCCTGG + Intergenic
999098734 5:149004845-149004867 CCTGGCAGCAGCGGTCCTGCTGG - Exonic
1006438647 6:34040059-34040081 CCTGGCAGCAGCGGTCCTGGAGG + Intronic
1006611348 6:35296220-35296242 CCTGGAAGCAGCGGTCACCCTGG - Intergenic
1012922478 6:105234199-105234221 CCGGGTAGCAGAGTCCCTCACGG + Intergenic
1019911484 7:4102855-4102877 CCCGGTAGGGGCGGTCCTTCAGG - Intronic
1020121472 7:5506340-5506362 CCGGGTTGAAGCAGTTCTCCTGG + Intronic
1025927049 7:65968535-65968557 TCGGGTGGCAGCGCTTCTCCAGG - Intronic
1026188810 7:68105738-68105760 CTGGGCAGCAGGTGTCCTCCAGG + Intergenic
1031895992 7:127348055-127348077 ACGGGTGGCAGCGGTCCCCAGGG + Intronic
1032313904 7:130815941-130815963 CTGGGTAACAGCAGTACTCCTGG - Intergenic
1044971728 8:97626504-97626526 CCGGGCACAAGCAGTCCTCCCGG - Intergenic
1047205814 8:122802415-122802437 CCAGGTAGCAGGGTTCCTGCAGG + Intronic
1049347205 8:142145407-142145429 GCGGGGAGCTGCGGTCCTGCAGG + Intergenic
1057674806 9:97130454-97130476 CCGGGCAGAGGCGCTCCTCCAGG + Intergenic
1059396745 9:114039221-114039243 CCTCTTAGCTGCGGTCCTCCTGG - Intronic
1062579426 9:137222808-137222830 CCGGGCAGGTGCGGTCCTCAGGG - Intergenic
1187346694 X:18471831-18471853 CCGGGTTGAAGCAATCCTCCAGG + Intronic
1192033827 X:67543796-67543818 TCAGGAAGCAGGGGTCCTCCAGG + Intergenic
1195730342 X:107960125-107960147 CCGGGTAGCACAGTTCCTCATGG + Intergenic
1197760593 X:130025206-130025228 CCGGGCAGCCTCTGTCCTCCAGG - Exonic
1198850947 X:140964961-140964983 CCGGGTTGGAGCAGTTCTCCTGG - Intergenic