ID: 1094201378

View in Genome Browser
Species Human (GRCh38)
Location 12:27797907-27797929
Sequence CTGGCGGGTGACGGTGTTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094201378_1094201386 11 Left 1094201378 12:27797907-27797929 CCTACAACACCGTCACCCGCCAG 0: 1
1: 0
2: 2
3: 8
4: 73
Right 1094201386 12:27797941-27797963 CAAGGAGAACACGTCCAAATCGG 0: 1
1: 0
2: 1
3: 5
4: 134
1094201378_1094201383 -7 Left 1094201378 12:27797907-27797929 CCTACAACACCGTCACCCGCCAG 0: 1
1: 0
2: 2
3: 8
4: 73
Right 1094201383 12:27797923-27797945 CCGCCAGTGGCTCTACCTCAAGG 0: 1
1: 0
2: 1
3: 7
4: 84
1094201378_1094201387 12 Left 1094201378 12:27797907-27797929 CCTACAACACCGTCACCCGCCAG 0: 1
1: 0
2: 2
3: 8
4: 73
Right 1094201387 12:27797942-27797964 AAGGAGAACACGTCCAAATCGGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094201378 Original CRISPR CTGGCGGGTGACGGTGTTGT AGG (reversed) Exonic
902615437 1:17621047-17621069 CTGGAGGGTTACGGTGATGGTGG + Intronic
902856478 1:19210034-19210056 CTGGCGGGCGACGCTGTTGTGGG - Intronic
911218254 1:95218906-95218928 GTGGGGAGTGACGATGTTGTAGG + Intronic
1064131559 10:12714200-12714222 GTGGGGGGTGACGGTGGGGTCGG - Intronic
1064950873 10:20848722-20848744 CTGGCGAGTGGTGGTGGTGTTGG - Intronic
1074709606 10:116166547-116166569 CGGCCGGGGGAAGGTGTTGTTGG - Intronic
1076781475 10:132727123-132727145 ATGGCGGGTGACAGTGCTGTGGG + Intronic
1082283645 11:50298147-50298169 CTGGCTGGGGGAGGTGTTGTGGG + Intergenic
1083155156 11:60818315-60818337 CTGGTGGGTGATGCTATTGTGGG - Intergenic
1084048269 11:66583510-66583532 CTGGCTGGAGCCAGTGTTGTGGG - Intergenic
1085914441 11:80868324-80868346 CTGGGTGGTGAAGGTGTTGGTGG - Intergenic
1090643574 11:128749373-128749395 CTGGAGGTTGACGCTGTGGTTGG + Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1106138282 13:26990693-26990715 CGGGCGTGTGAGGGTGTGGTGGG - Intergenic
1108123232 13:47212510-47212532 CTGGTGGGTTATGGTGTTCTTGG + Intergenic
1108609641 13:52071533-52071555 CTGGCTGGGGCCAGTGTTGTGGG - Intronic
1112030607 13:95453336-95453358 CTGGTGGGTGAGGTTGTTGGTGG - Intronic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1119086935 14:71747643-71747665 ATGGTAGGTGAGGGTGTTGTCGG + Intergenic
1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG + Intergenic
1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG + Intergenic
1126387921 15:48112878-48112900 CTGGCTGGGGCCGGTGTTATGGG - Intergenic
1128282629 15:66409046-66409068 CAGGAGGGTCACAGTGTTGTTGG + Intronic
1130667945 15:85885523-85885545 CTGGCTGGCGCCGGTGTTCTGGG + Intergenic
1131558673 15:93420665-93420687 CTGGCAGGTGACAGGGTTGGAGG + Intergenic
1132374331 15:101318811-101318833 ATGGCGTGTGACGGGGCTGTCGG + Intronic
1132826699 16:1908798-1908820 CTGGCAGGTGCCAGTGTGGTGGG + Intergenic
1141547950 16:84784865-84784887 CTGAGGGGTGCCTGTGTTGTTGG + Intergenic
1143271811 17:5681274-5681296 AGGGCTGGAGACGGTGTTGTGGG + Intergenic
1143476968 17:7208413-7208435 CTGGCGGGAGAGGGGGCTGTTGG - Intronic
1143982291 17:10880347-10880369 CTGGTTGGTGAGGGTGTTGGTGG + Intergenic
1149894198 17:60416444-60416466 CTGGCAGGTGAGGGGGTTGTGGG - Intronic
1151534141 17:74729262-74729284 CTGGTGGGTGACAGTGGTGTGGG + Intronic
1156742338 18:40347147-40347169 CTGCCTGGTGACTGTGTTGATGG + Intergenic
1160753573 19:746842-746864 CTGGTGGGTGTCTGTGGTGTGGG - Exonic
1164962555 19:32446839-32446861 CTGTCGGTTGAAGGTGTTGTTGG - Intronic
1165829688 19:38724293-38724315 TTGCGGGGTGACGGTGGTGTAGG - Exonic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
933652156 2:84858263-84858285 CTGGTGGGAGACGATGTTGGAGG - Intronic
934525346 2:95048395-95048417 CTGGCGGGTACAGGTGGTGTGGG - Intronic
938538045 2:132261181-132261203 CTCGAGGATGACGGTGTTGCAGG + Intergenic
942527898 2:176875137-176875159 GTGGTGGGTGGTGGTGTTGTGGG + Intergenic
942971004 2:181957807-181957829 CTGGTGGCTGAGGGTCTTGTTGG + Intronic
943564871 2:189505545-189505567 CTGGAAGGTGAATGTGTTGTTGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
948154273 2:235768787-235768809 TTAGCGGTTGACAGTGTTGTCGG + Intronic
1173163050 20:40666399-40666421 CTGGTGGGGGACTGTGTTGTGGG + Intergenic
1176034945 20:63031639-63031661 CTGGGGAGGGACGGTGTCGTTGG + Intergenic
1180013693 21:45069166-45069188 TTGGCGGGTGATGGTGCTCTGGG - Intergenic
1184138076 22:42561242-42561264 CTGGAGGGAGATGGTGTCGTCGG + Intronic
950572677 3:13811743-13811765 CAGGCGGGTGAGGGTGTCTTGGG - Intergenic
952954386 3:38548266-38548288 CTGGCTGCAGACGGTGTGGTTGG - Exonic
962454203 3:135550023-135550045 CTGGGGGGTGGCGGTGGGGTAGG - Intergenic
965435874 3:168650672-168650694 CTGTGGGGTCACAGTGTTGTGGG + Intergenic
967844428 3:194032722-194032744 CTGGAGGCTGAGGGTGTTGGGGG + Intergenic
979099586 4:116598714-116598736 CTGTGGGGTGACGGTGGTGTAGG - Intergenic
992613755 5:78530722-78530744 CTGGCAGGTACAGGTGTTGTTGG - Intronic
1001235308 5:170024289-170024311 CTGGATGGTGACAGTGTTGGGGG + Intronic
1002033567 5:176448359-176448381 CCGGCGGGTGACGGTGCGGACGG + Exonic
1005876465 6:30013714-30013736 CTGGCAGGTGCCGATGTTGATGG - Intergenic
1007969880 6:46040612-46040634 GTGGTGGATGACGATGTTGTTGG + Intronic
1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG + Intergenic
1020279771 7:6644256-6644278 CTTGCAGGTGAAGGTGTTGGGGG + Intronic
1021261410 7:18462192-18462214 CTGGCGGGTGACTGTGAAGATGG - Intronic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1025604626 7:63030424-63030446 CGGGCGGGGGGCGGTGTGGTCGG + Intergenic
1033199940 7:139359956-139359978 CTGGCGGGTGGCGGTGTTGAAGG + Exonic
1034929905 7:155153453-155153475 AGGGCTGGTGACAGTGTTGTAGG - Intergenic
1035713611 8:1737471-1737493 GTGGGAGGTGACTGTGTTGTGGG - Intergenic
1037319243 8:17628566-17628588 TTGTCGGGTGACCGTGCTGTCGG + Exonic
1039984572 8:42436709-42436731 CTGGCCGGTGACGGAGGTGCAGG - Intronic
1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG + Intergenic
1050388649 9:5114097-5114119 CTGGCAGGTGTAGGTGTGGTCGG - Intronic
1052274341 9:26660736-26660758 CTGGCGATTTACAGTGTTGTGGG - Intergenic
1052975306 9:34405832-34405854 CTGGGGGGTGAGGGAGATGTGGG - Intronic
1053168692 9:35862899-35862921 CTGGAGGGTGACAGTGATGAAGG - Intergenic
1053478240 9:38397163-38397185 GTGGCAGGTGACGATGTTGTAGG - Exonic
1055497161 9:76867184-76867206 CGGGGGGTTGATGGTGTTGTGGG - Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057038928 9:91833513-91833535 CTGGCGTGTGGCGGTGCTGGTGG - Intronic
1058001525 9:99870686-99870708 CTGGGGGGTGATGGCTTTGTGGG - Intergenic
1060214457 9:121730357-121730379 CCGGCGGGTGATGCTGTTGCAGG - Intronic
1061306473 9:129735874-129735896 GGGGTGGGTGAGGGTGTTGTGGG - Intergenic
1203364313 Un_KI270442v1:243779-243801 TAGGCGAGTGACGGTGTGGTGGG - Intergenic