ID: 1094201386

View in Genome Browser
Species Human (GRCh38)
Location 12:27797941-27797963
Sequence CAAGGAGAACACGTCCAAAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094201382_1094201386 -5 Left 1094201382 12:27797923-27797945 CCGCCAGTGGCTCTACCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1094201386 12:27797941-27797963 CAAGGAGAACACGTCCAAATCGG 0: 1
1: 0
2: 1
3: 5
4: 134
1094201377_1094201386 20 Left 1094201377 12:27797898-27797920 CCGTGCAGTCCTACAACACCGTC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1094201386 12:27797941-27797963 CAAGGAGAACACGTCCAAATCGG 0: 1
1: 0
2: 1
3: 5
4: 134
1094201384_1094201386 -8 Left 1094201384 12:27797926-27797948 CCAGTGGCTCTACCTCAAGGAGA 0: 1
1: 1
2: 0
3: 17
4: 139
Right 1094201386 12:27797941-27797963 CAAGGAGAACACGTCCAAATCGG 0: 1
1: 0
2: 1
3: 5
4: 134
1094201378_1094201386 11 Left 1094201378 12:27797907-27797929 CCTACAACACCGTCACCCGCCAG 0: 1
1: 0
2: 2
3: 8
4: 73
Right 1094201386 12:27797941-27797963 CAAGGAGAACACGTCCAAATCGG 0: 1
1: 0
2: 1
3: 5
4: 134
1094201381_1094201386 -4 Left 1094201381 12:27797922-27797944 CCCGCCAGTGGCTCTACCTCAAG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1094201386 12:27797941-27797963 CAAGGAGAACACGTCCAAATCGG 0: 1
1: 0
2: 1
3: 5
4: 134
1094201380_1094201386 2 Left 1094201380 12:27797916-27797938 CCGTCACCCGCCAGTGGCTCTAC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1094201386 12:27797941-27797963 CAAGGAGAACACGTCCAAATCGG 0: 1
1: 0
2: 1
3: 5
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094201386 Original CRISPR CAAGGAGAACACGTCCAAAT CGG Exonic
906338494 1:44956311-44956333 CAATGAGAACACGTGGACATAGG + Intronic
906405125 1:45535813-45535835 TAAAGGGAACATGTCCAAATTGG + Intergenic
906675613 1:47691396-47691418 CAATGAGAACACGTGGACATAGG - Intergenic
907627468 1:56044104-56044126 GAAGGAGAACACTTTGAAATGGG - Intergenic
908866652 1:68555791-68555813 CAATGAGAACACTTGCACATAGG + Intergenic
909340134 1:74522440-74522462 CAAGGAGTACACTTCCAGAATGG + Intronic
909891946 1:81018207-81018229 CAAGGAGAGCATGTCTAAGTTGG - Intergenic
911549333 1:99260446-99260468 CAATGAGAACACATCGACATAGG - Intergenic
918671493 1:187223280-187223302 CAAGAAGAACAAGTACAAACAGG - Intergenic
919516677 1:198533750-198533772 CCAAGAGAACAGGTCCAAATTGG + Intronic
924160285 1:241224290-241224312 CAATGAGAACACGTGGACATAGG - Intronic
1063264876 10:4436442-4436464 CTAGGAGAACACTTCCAACCTGG + Intergenic
1063820733 10:9832286-9832308 CAAGGAGAACACGTGGACACAGG + Intergenic
1064347430 10:14545267-14545289 GAAAGAGCACACGTCCAAATAGG - Intronic
1065841585 10:29705681-29705703 CAAGGAGAACACATGGACATAGG - Intronic
1066520964 10:36218502-36218524 CCAGGAGTTCACGTCCAAACTGG - Intergenic
1067208988 10:44242807-44242829 CAGGGAGAACACGTCCATTCAGG - Intergenic
1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG + Intergenic
1071193263 10:83127190-83127212 CAATGAGAACACGTGGACATAGG + Intergenic
1071935388 10:90525335-90525357 CAAGAAGAACAGGTACAAAAAGG - Intergenic
1078732373 11:13986757-13986779 CAATGAGAACACGTGGACATAGG - Intronic
1079895412 11:26113507-26113529 CAAGGGGAAGATGGCCAAATAGG + Intergenic
1082217729 11:49595175-49595197 CAATGAGAACACGTGGACATGGG + Intergenic
1086243729 11:84726308-84726330 CAATGAGAACACGTGGACATAGG - Intronic
1087730317 11:101771436-101771458 CAATGAGAACTCCTCCAAACTGG + Intronic
1088527954 11:110776863-110776885 CAATGAGAACACATGGAAATGGG + Intergenic
1089165754 11:116475212-116475234 CAAGGAGCAGACGTTCAAGTTGG + Intergenic
1092329013 12:7565714-7565736 CAATGAGAACACGTGGACATAGG + Intergenic
1093792529 12:23270238-23270260 CAAGGAAAATACATCCAAGTGGG + Intergenic
1094201386 12:27797941-27797963 CAAGGAGAACACGTCCAAATCGG + Exonic
1094314169 12:29119567-29119589 CAAGGAGAACAAGTCCAAAGGGG - Intergenic
1095195808 12:39315272-39315294 CAAGGAAAACAAGTGCAAAGAGG + Intronic
1096597006 12:52702228-52702250 CAAGGAGCCCACGTCTAAAGGGG - Intronic
1097467975 12:59951528-59951550 CAAGGAGAACACATGGACATAGG + Intergenic
1098695147 12:73543122-73543144 CAAGGAGAACACGTGGACACAGG + Intergenic
1108942192 13:55970239-55970261 CAAGGAGATTTAGTCCAAATGGG + Intergenic
1109946726 13:69444199-69444221 CAAATAGAAGACATCCAAATAGG - Intergenic
1111289489 13:86145608-86145630 CAATGAGAACACGTGGAAACAGG + Intergenic
1112760732 13:102691092-102691114 CAAGGAGAACGGCTGCAAATTGG + Intronic
1116092131 14:40322485-40322507 CAAGGAGAACACATGCACACAGG + Intergenic
1116230517 14:42209810-42209832 CAAGGAGAACTGCTGCAAATAGG - Intergenic
1120131344 14:80810982-80811004 CAAGGAGAACACATGGACATAGG - Intronic
1121778522 14:96606832-96606854 CAAGGAGACCACATCCACATGGG - Intergenic
1125315610 15:38428046-38428068 CCAGGAGAAGACCTCCAAAAGGG - Intergenic
1125354006 15:38797675-38797697 CAATGAGAACACGTGGACATGGG - Intergenic
1125477479 15:40056885-40056907 AAATGAGAACTCCTCCAAATAGG + Intergenic
1126775943 15:52100601-52100623 CAAGAAGAACACGTGCAAAGCGG + Intergenic
1132085965 15:98908475-98908497 CAAGGATAACATATCAAAATCGG - Intronic
1132287416 15:100673760-100673782 CAATGAGAACACGTGGACATGGG - Intergenic
1135047313 16:19166538-19166560 CAAGGAGCACCCGTTCCAATAGG + Intronic
1135173768 16:20210020-20210042 CAAGGAGAAAGCATCCACATGGG - Intergenic
1136113926 16:28082665-28082687 CACGGAGAACACTAACAAATGGG - Intergenic
1138875434 16:60942969-60942991 CAAGGAGAACACGTAGACACAGG + Intergenic
1148436826 17:47692162-47692184 CAATGAGATCAGGTCCAGATTGG + Intergenic
1149128671 17:53268431-53268453 CAAGGAGAACACATGGACATGGG + Intergenic
1154935621 18:21053051-21053073 CAAGGAAAACAACTCAAAATTGG + Intronic
1156687808 18:39670877-39670899 CAAGGAGAAAAAGTCAGAATTGG - Intergenic
1159334005 18:67039694-67039716 GAAGGTGAACAAGTTCAAATGGG - Intergenic
1161681932 19:5684492-5684514 CAAGGAGGACAGGTCCACACAGG + Intronic
924975056 2:165285-165307 CAATGAGAACACGTGGAAACAGG + Intergenic
936807870 2:116358901-116358923 CAAGGAGAACCTGTGCAAAAAGG + Intergenic
942845561 2:180420403-180420425 CAATGAGAACACATGCACATAGG - Intergenic
943939887 2:193979165-193979187 CAAGGAGAACACATGGACATGGG + Intergenic
946717470 2:222567781-222567803 CAAGGAAAACCAGTCCTAATGGG - Intergenic
947005850 2:225510061-225510083 CCAGGAGAAAAAGTCCCAATGGG + Intronic
1169076626 20:2763936-2763958 CTAGGAGAACTTTTCCAAATAGG + Intergenic
1170240409 20:14159695-14159717 CAAAGAAAAGACATCCAAATTGG - Intronic
1173850536 20:46215169-46215191 CATAGAGAACAAGTGCAAATGGG + Intronic
1177388655 21:20439147-20439169 CAATGAGAACACATCCACACAGG + Intergenic
1178714568 21:34952173-34952195 CAAGGAGAACACATGGACATAGG + Intronic
1182914748 22:34019110-34019132 GAAGAAGAACAAGTCCAAAGGGG - Intergenic
1183300732 22:37057816-37057838 CAAGGAGACCAGATCCACATAGG + Intronic
1183482442 22:38072477-38072499 CACGGAGAACACGTCCCCAAAGG - Exonic
953026063 3:39145922-39145944 TAAGGAGAAAATGTCTAAATAGG + Intronic
954504979 3:51061509-51061531 CAATGAGAACACATCGACATAGG + Intronic
954950146 3:54464900-54464922 TAAGGAGAAGATGGCCAAATAGG - Intronic
956222523 3:66919717-66919739 CAATGAGAACACGTGGACATAGG + Intergenic
957961017 3:87252560-87252582 GAAGGAGATCACATCCAACTGGG - Intronic
960764451 3:121110825-121110847 CAGGGAGAACAGGGCCAAGTTGG - Intronic
962974714 3:140436083-140436105 CAAGGTGAACATGGACAAATGGG - Intronic
964560931 3:157995377-157995399 CAATGAGAACACGTGGACATAGG + Intergenic
967492587 3:190110782-190110804 CAAGAAGAATATGTCAAAATTGG + Intronic
971615504 4:28785751-28785773 CAAGGAGAACATGAATAAATTGG + Intergenic
971729989 4:30365769-30365791 CAAGAAGAACACTTTCATATTGG + Intergenic
972824068 4:42736421-42736443 CAAGGAGAACATGGGCAAACAGG + Intergenic
974292427 4:59949149-59949171 CAAGGAGAATGGGTACAAATAGG + Intergenic
974878911 4:67730415-67730437 CAATGAGAACACGTGGACATAGG - Intergenic
975324214 4:73041613-73041635 CATGGACAACACTTCCCAATGGG - Intergenic
975418968 4:74139756-74139778 AAAAGAGAACATGTCAAAATTGG - Intronic
978517084 4:109580073-109580095 CAATGAGAACACGTGGAAACAGG - Intronic
979754235 4:124320534-124320556 GAAAGAAAACACATCCAAATTGG - Intergenic
980154641 4:129089810-129089832 CAAGGAGAACACGTGGACACAGG + Intronic
984847582 4:184120794-184120816 CAAAGAGAACACTTGCAAAGAGG + Intronic
989206208 5:38810893-38810915 CTTGGAGACCACGTCCAGATGGG + Intergenic
990466538 5:56076529-56076551 CAAGCAGAACACGTGGAAAAGGG - Intergenic
991717194 5:69462022-69462044 CAAGGAAAGCACTTCCAATTTGG + Intergenic
993552296 5:89288563-89288585 CAAGGAGAACACTTGGACATAGG - Intergenic
997794872 5:136798639-136798661 CAAATAGAAGACCTCCAAATAGG + Intergenic
997807066 5:136928452-136928474 CAATGAGAACACATGCACATGGG - Intergenic
998909249 5:146940540-146940562 CAAGGAGAACATATCTAAAAAGG + Intronic
999728203 5:154454696-154454718 CAGGGAGAACACTGGCAAATGGG - Intronic
1000507735 5:162142696-162142718 CAATGAGAACACATGCACATAGG + Intronic
1004935059 6:20499372-20499394 CAAAGAGAACATGTTTAAATGGG + Intergenic
1006935877 6:37717283-37717305 GAAGGAGAAGACTTGCAAATGGG + Intergenic
1008389082 6:50928495-50928517 CAATGAGAGAACGTCCAAAAAGG - Intergenic
1008543104 6:52562753-52562775 CAATGAGAACACGTTGACATAGG - Intronic
1010145373 6:72663084-72663106 CAATGAGAACACGTGGACATAGG + Intronic
1011992378 6:93539068-93539090 CAAGGAGAATGGGACCAAATTGG + Intergenic
1015905865 6:138115746-138115768 CAAGGAGCTCACGGCCCAATAGG - Intergenic
1016983748 6:149878164-149878186 CAAAGAAAAGACATCCAAATAGG + Intergenic
1018348396 6:162927599-162927621 CAATGAGAACACATGGAAATGGG + Intronic
1022770149 7:33462190-33462212 CAAGGAGAACATTTCATAATAGG - Intronic
1029600638 7:101561368-101561390 CAAGGGGAAGAAGTCAAAATAGG + Intergenic
1030402412 7:109068560-109068582 CAATGGGAACAGGTCTAAATTGG - Intergenic
1031095234 7:117409528-117409550 CAGGAAGAACACATTCAAATAGG + Intronic
1035830548 8:2690168-2690190 CATAGAGAACACGTCCCCATTGG - Intergenic
1036109703 8:5884311-5884333 CAATGAGAACACTTCGACATGGG + Intergenic
1037430951 8:18812691-18812713 CAAGGTGAACACATCAAAAATGG - Intronic
1039952203 8:42181210-42181232 CAAGGAACACAAGTCCAACTGGG - Intronic
1040571856 8:48618491-48618513 CAAGGACAACAACTTCAAATAGG + Intergenic
1040864158 8:52031563-52031585 CAATGAGAACACGTGGACATAGG + Intergenic
1043700403 8:83280327-83280349 CAATGAGAACACGTGGACATAGG - Intergenic
1044183531 8:89224150-89224172 CAAGGAGAACACGTGGACACAGG + Intergenic
1045274701 8:100692538-100692560 CAGGGGGAACCCGTTCAAATTGG - Intronic
1045828985 8:106435285-106435307 CAAGGAGAGCTCTTCGAAATCGG - Intronic
1046871099 8:119206784-119206806 CTAGGAGAACACTTTCAACTGGG - Intronic
1048120457 8:131575240-131575262 CAATGAGAACACATGGAAATAGG + Intergenic
1051695286 9:19761675-19761697 CAATGAGAACACGTGGACATAGG - Intronic
1057689481 9:97270906-97270928 CAAGTAAAAGACATCCAAATTGG - Intergenic
1186394509 X:9194566-9194588 CAAGGAGAACACATGGACATAGG + Intergenic
1187071880 X:15896708-15896730 CAGTGAGAACACTTCCAGATTGG + Intergenic
1189108599 X:38263293-38263315 CAAGGAAAACATGTTGAAATAGG - Intronic
1189605535 X:42673913-42673935 CAAGGAGAACAAGGAGAAATTGG - Intergenic
1192746120 X:73940682-73940704 CAAGGAGATTACATTCAAATCGG - Intergenic
1193809263 X:86032354-86032376 CAGGGAGAACAGGTACAAAACGG + Intronic
1194301220 X:92188465-92188487 AAGGGAGAACAAGTCCAAATGGG + Intronic
1195492598 X:105489203-105489225 AAAGGATAACAGGACCAAATTGG - Intronic
1196100866 X:111845834-111845856 CAAGGAGAAGGGGTCCAAAATGG - Intronic
1196750375 X:119111552-119111574 CAATGAGAACACATCGACATGGG + Intronic
1198259338 X:134951976-134951998 CAATGAGAACACGTGGAAACAGG + Intergenic
1201377158 Y:13335136-13335158 CAATGAGAACACATGCATATAGG + Intronic