ID: 1094201387

View in Genome Browser
Species Human (GRCh38)
Location 12:27797942-27797964
Sequence AAGGAGAACACGTCCAAATC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094201382_1094201387 -4 Left 1094201382 12:27797923-27797945 CCGCCAGTGGCTCTACCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1094201387 12:27797942-27797964 AAGGAGAACACGTCCAAATCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1094201377_1094201387 21 Left 1094201377 12:27797898-27797920 CCGTGCAGTCCTACAACACCGTC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1094201387 12:27797942-27797964 AAGGAGAACACGTCCAAATCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1094201381_1094201387 -3 Left 1094201381 12:27797922-27797944 CCCGCCAGTGGCTCTACCTCAAG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1094201387 12:27797942-27797964 AAGGAGAACACGTCCAAATCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1094201378_1094201387 12 Left 1094201378 12:27797907-27797929 CCTACAACACCGTCACCCGCCAG 0: 1
1: 0
2: 2
3: 8
4: 73
Right 1094201387 12:27797942-27797964 AAGGAGAACACGTCCAAATCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1094201384_1094201387 -7 Left 1094201384 12:27797926-27797948 CCAGTGGCTCTACCTCAAGGAGA 0: 1
1: 1
2: 0
3: 17
4: 139
Right 1094201387 12:27797942-27797964 AAGGAGAACACGTCCAAATCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1094201380_1094201387 3 Left 1094201380 12:27797916-27797938 CCGTCACCCGCCAGTGGCTCTAC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1094201387 12:27797942-27797964 AAGGAGAACACGTCCAAATCGGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094201387 Original CRISPR AAGGAGAACACGTCCAAATC GGG Exonic
908828044 1:68152363-68152385 AAAGAGAAGAGGTCCAAAGCAGG + Intronic
909316978 1:74234094-74234116 AAGGAGAATATGTCCAGATGAGG + Intronic
911179990 1:94851820-94851842 AAGTAGAACCCCTCCAAATTAGG + Intronic
919516678 1:198533751-198533773 CAAGAGAACAGGTCCAAATTGGG + Intronic
1065704923 10:28463948-28463970 AAGGAAACCAAATCCAAATCCGG - Intergenic
1071556821 10:86610785-86610807 AAGGAGAACATGTGTCAATCTGG - Intergenic
1072979475 10:100087784-100087806 AAAGAGAGTACGTTCAAATCTGG + Intergenic
1075274625 10:121081990-121082012 ACGGAGAACTCGTCCAGATGAGG + Intergenic
1079766808 11:24404622-24404644 AAAGAGAACATTTCCAAATTTGG - Intergenic
1079784941 11:24659826-24659848 AAGGAGAACAGGTTTATATCAGG - Intronic
1083784700 11:64937341-64937363 AAGAAGCACAGCTCCAAATCTGG - Intergenic
1084405654 11:68971354-68971376 AAGGAGAAGGCATCCAGATCAGG - Intergenic
1084621796 11:70276386-70276408 AAGGAGAATACATCAAGATCAGG - Intronic
1087196132 11:95305860-95305882 AAGGAGAACACATCCTGCTCTGG + Intergenic
1089415817 11:118289540-118289562 AAGGAAAATATGTCCAAATTTGG + Intergenic
1089821491 11:121231337-121231359 GATGAAAACACGTTCAAATCAGG - Intergenic
1092301061 12:7250644-7250666 AAGAAGAAAAAGGCCAAATCTGG + Intergenic
1094201387 12:27797942-27797964 AAGGAGAACACGTCCAAATCGGG + Exonic
1097725624 12:63072403-63072425 AATGAGAACAAGTACAAATGCGG - Intergenic
1108579749 13:51818359-51818381 AAATGGAACAAGTCCAAATCTGG - Intergenic
1113887538 13:113668735-113668757 CAGGAGATCACGTCCACACCCGG - Intronic
1122564350 14:102641455-102641477 AAGGAGAACACCACCATAACCGG - Intronic
1125071786 15:35563369-35563391 AAGGAAAACATCTACAAATCTGG - Intergenic
1125376937 15:39040168-39040190 AAAGAGAACAGATGCAAATCTGG - Intergenic
1126163052 15:45631734-45631756 AAGGAAAATAAATCCAAATCAGG - Intronic
1126775944 15:52100602-52100624 AAGAAGAACACGTGCAAAGCGGG + Intergenic
1151815290 17:76468695-76468717 TAGGAGGACACTTCCAAAGCTGG + Exonic
1153969028 18:10207855-10207877 AAAGATAACAAGTCCAAATCTGG - Intergenic
1159334004 18:67039693-67039715 AAGGTGAACAAGTTCAAATGGGG - Intergenic
928297688 2:30098885-30098907 AAGGTGAATACATCCACATCTGG + Intergenic
933893946 2:86793762-86793784 AAGCAGTACACCCCCAAATCTGG - Intronic
942220792 2:173767101-173767123 AAGGAGAACACTTTGACATCTGG - Intergenic
946054311 2:216887532-216887554 AAGGCGAGCAGGTCCAATTCAGG + Intergenic
947082596 2:226415389-226415411 AAGGAGAAAATGTCCACTTCCGG - Intergenic
947082666 2:226416216-226416238 AAGGAGAAAACATCCACTTCCGG - Intergenic
1172978214 20:38921992-38922014 AAGGAGACCACTTCCAAAGCAGG + Exonic
1173410398 20:42804489-42804511 AAAGAGAACAAGACAAAATCAGG + Intronic
1173672315 20:44807305-44807327 AAGGATCCCAAGTCCAAATCAGG + Intronic
1174026109 20:47577043-47577065 AAGGAGAAAACTTAAAAATCTGG - Intronic
1175414576 20:58793187-58793209 GAGGAGAAAAAGTCCAAACCAGG + Intergenic
1178713894 21:34945988-34946010 CAGGAGAACGCATCCAAACCTGG - Intronic
1182951413 22:34379773-34379795 AAGGAGAACAGTTCAAATTCAGG + Intergenic
950486181 3:13275313-13275335 AAGCTGAACACTTCAAAATCAGG + Intergenic
957776380 3:84760631-84760653 CAGGGGAACACCTCCAATTCAGG + Intergenic
972644313 4:40953533-40953555 AATGAGAACACTTCCAACTCAGG + Intronic
975418967 4:74139755-74139777 AAAGAGAACATGTCAAAATTGGG - Intronic
977081566 4:92535904-92535926 GAGGAGAACAAGTCCAGATGCGG - Intronic
992444472 5:76821202-76821224 AAGGAAAACACTTGGAAATCAGG + Intronic
995647260 5:114326923-114326945 AAGGAAAACACGCCAAAATGAGG + Intergenic
1008481022 6:51984879-51984901 AAGGAGAAAACGTCCAAGGATGG + Intronic
1012047546 6:94297797-94297819 AGGGAGCACACTTCCAGATCAGG + Intergenic
1015001462 6:128221674-128221696 AAGGACATCAAATCCAAATCAGG + Intronic
1016590425 6:145737398-145737420 AAGGAGAACAAGACCAAAATAGG + Intergenic
1032542958 7:132719107-132719129 CAGGAGATCAGGTCCAATTCAGG - Intronic
1045030503 8:98130624-98130646 AAGGAGAACAAGGCAACATCAGG + Intronic
1048308767 8:133302130-133302152 AAGGAAAACAATTCCAAATGAGG + Intergenic
1050575829 9:6994287-6994309 AAGGAGAAGTTGTCTAAATCAGG - Intronic
1052601626 9:30639678-30639700 AAGAAGAACACTTCTAACTCAGG - Intergenic
1190627434 X:52350359-52350381 AAAAAGAACACATCCAACTCTGG + Intergenic
1194301221 X:92188466-92188488 AGGGAGAACAAGTCCAAATGGGG + Intronic
1194760991 X:97795693-97795715 AAGGAGAATTCGACCAAAGCAGG - Intergenic